CN1916023A - Polypeptide in small molecule of endothelium inhibin, nucleotide sequence for encoding the polypeptide and complementary strand - Google Patents
Polypeptide in small molecule of endothelium inhibin, nucleotide sequence for encoding the polypeptide and complementary strand Download PDFInfo
- Publication number
- CN1916023A CN1916023A CNA2006100105263A CN200610010526A CN1916023A CN 1916023 A CN1916023 A CN 1916023A CN A2006100105263 A CNA2006100105263 A CN A2006100105263A CN 200610010526 A CN200610010526 A CN 200610010526A CN 1916023 A CN1916023 A CN 1916023A
- Authority
- CN
- China
- Prior art keywords
- polypeptide
- small molecule
- nucleotide sequence
- endostatin
- endothelium inhibin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
This invention relates to endostatin small molecular polypeptide, its coding nucleotide sequence and complementary strand. The endostatin small molecular polypeptide has 30 amino acid residues corresponding to a nucleotide sequence with a full length of 90 bp and a complementary strand with a length of 88 bp. The endostatin small molecular polypeptide avoids the defects of the current endostatin such as high molecular weight, limit to subcutaneous injection and intramuscular injection, large dosage and unsafety in intravenous injection. The endostatin small molecular polypeptide has such advantages as low molecular weight and no medicine accumulation, and is suitable for intravenous, intramuscular and subcutaneous injection. The coding nucleotide sequence and complementary strand can be synthesized by an automatic synthesizer, and used to manufacture endistatin in large scale by genetic engineering after recombination and transformation.
Description
Technical field
The present invention relates to the nucleotide sequence and the complementary strand of a kind of micromolecule polypeptide and this polypeptide of encoding.
Background technology
By suppressing the generation of tumor tissues new vessel, cut off the nutrition supply of tumour cell, force tumour cell to stop growing, even death is a new focus of present tumor pharmacother.Endostatin is the strongest new vessel formation inhibitor of activity of generally acknowledging in the world at present, the endostatin of U.S.'s gene recombinant human has been finished the III clinical trial phase, and test-results confirms that endostatin all has inhibition, therapeutic action significantly to kinds of tumors.Endostatin gets most of the attention because of it has advantages such as antitumor spectrum is wide, toxicity is low and do not develop immunity to drugs.But the endostatin of producing is not suitable for intravenous injection all greater than 180 amino acid at present, can only be used for muscle and subcutaneous injection, and long term injections easily produces scleroma, influences drug absorption.Again because present endostatin is to limit tumor growth indirectly by suppressing vasculogenesis, so treatment time is long, and dosage is big, and when only reaching 20mg/kg in the treatment, tumour can degenerate to original state, and the tumour cell dormancy stops growing.
Summary of the invention
The objective of the invention is in order to solve existing endostatin molecular weight big, can only be used for muscle and subcutaneous injection, dangerous and the big defective of dosage of intravenous administration, and a kind of small molecule of endothelium inhibin polypeptide that provides and the nucleotide sequence and the complementary strand of this polypeptide of encoding.The small molecule of endothelium inhibin amino acid sequence of polypeptide is: MetHisSerHisArgAspPheGlnProValLeuHisLeuValAlaLeuAsnSerPr oLeuSerGlyGlyMetArgGlyAspArgGlyAsp.The nucleotides sequence of above-mentioned small molecule of endothelium inhibin polypeptide of encoding is classified as: ATGCACAGCCACCGTGACTTCCAGCCTGTTCTCCACCTGGTTGCTCTCAACAGCCC TCTGTCAGGTGGTATGCGTGGTGACCGTGGTGAC.The encode nucleotide sequence total length 90bp of above-mentioned small molecule of endothelium inhibin polypeptide of the present invention, wherein T, C, G, A are respectively 23bp (26%), 29bp (32%), 24bp (27%), 14bp (16%).The complementary strand nucleotides sequence of above-mentioned small molecule of endothelium inhibin polypeptide nucleotide sequence is classified as: GTCACCACGGTCACCACGCATACCACCTGACAGAGGGCTGTTGAGAGCAACCAGGT GGAGAACAGGCTGGAAGTCACGGTGGCTGTGC.The complementary strand nucleotide sequence total length 88bp of small molecule of endothelium inhibin polypeptide nucleotide sequence of the present invention, wherein T, C, G, A are respectively 13bp (15), 24bp (27%), 29bp (33%), 22bp (25%), and complementary strand 3 ' end lacks and small molecule of endothelium inhibin polypeptide nucleotide sequence 5 ' two bases of end AT complementary.The present invention encodes the nucleotide sequence of small molecule of endothelium inhibin polypeptide and complementary strand according to the preferences design of intestinal bacteria to password, recombinate with the pTYB carrier through Nde I and Sma I double digestion in the nucleotide sequence of coding small molecule of endothelium inhibin polypeptide and complementary strand phosphorylation annealing back, again transformed into escherichia coli BL21 (DE3).Genetic engineering bacterium BL21 (DE3) induces through IPTG, just can extract the small molecule of endothelium inhibin polypeptide of purifying concentration 〉=95% with the chitin affinity column.The nucleotide sequence and the complementary strand of the coding small molecule of endothelium inhibin polypeptide of the present invention's design are synthetic by the Nucleotide automatic DNA synthesizer DNA, available biological engineering method scale operation endostatin after recombinant conversion.Endostatin among the present invention (small molecule of endothelium inhibin polypeptide) molecular weight is little, only is 30 amino acid, is fit to vein, muscle and subcutaneous injection, is easy to absorb drug safety.Small molecule of endothelium inhibin polypeptide of the present invention can combine with the integration on extracellular matrix competition and the tumor cell membrane is plain, directly suppresses the growth and the transfer of tumour cell, has dual anti-tumor activity, is used for the treatment of tumour, good effect, and dosage is little.Cell culture experiments in vitro, small molecule of endothelium inhibin polypeptide of the present invention (endostatin) anti-tumor activity are 2～3 times of existing other endostatin, press down knurl experiment tumour inhibiting rate in the animal body and improve more than 11 percentage points.
Description of drawings
Fig. 1 is the chicken embryo urea cyst membrane figure behind the inoculation small molecule of endothelium inhibin polypeptide 30h, Fig. 2 is the chicken embryo urea cyst membrane figure behind the inoculation physiological saline 30h, Fig. 3 is the huve cell figure that does not add the small molecule of endothelium inhibin polypeptide in the nutrient solution, Fig. 4 is the rat liver cancer cytological map that does not add the small molecule of endothelium inhibin polypeptide in the nutrient solution, Fig. 5 is the huve cell figure that adds the small molecule of endothelium inhibin polypeptide in the nutrient solution, Fig. 6 is the rat liver cancer cytological map that adds the small molecule of endothelium inhibin polypeptide in the nutrient solution, Fig. 7 is human liver cancer cell cell cycle figure, Fig. 8 is Human umbilical vein endothelial cells cell cycle figure, Fig. 9 is the human liver cancer cell cell cycle figure that adds the small molecule of endothelium inhibin polypeptide in nutrient solution, Figure 10 is the Human umbilical vein endothelial cells cell cycle figure that adds the small molecule of endothelium inhibin polypeptide in nutrient solution, Figure 11 is the figure of tumor-bearing mice after the treatment of small molecule of endothelium inhibin polypeptide, Figure 12 is the figure of tumor-bearing mice without the treatment of small molecule of endothelium inhibin polypeptide, Figure 13 is the figure through the mouse interior tumor of small molecule of endothelium inhibin polypeptide treatment, and Figure 14 is not without the figure of the mouse interior tumor of small molecule of endothelium inhibin polypeptide treatment.
Embodiment
Embodiment one: present embodiment small molecule of endothelium inhibin amino acid sequence of polypeptide is as follows:
MetHisSerHisArgAspPheGlnProValLeuHisLeuValAlaLeuAsnSerProLeuSerGlyGlyMetArgGlyAspArgGlyAsp。
Present embodiment small molecule of endothelium inhibin polypeptide (endostatin) anti-tumor activity height is 2～3 times of existing other endostatin, presses down knurl experiment tumour inhibiting rate in the animal body and improves more than 11 percentage points.Present embodiment small molecule of endothelium inhibin polypeptide (endostatin) molecular weight has only the sixth of Endostatin, is easier to absorb, and has improved the security of medication; Keeping Endostatin to limit the active while of tumor growth indirectly by suppressing vasculogenesis, can also directly suppress the growth and the transfer of tumour cell, improved anti-tumor activity, reduced dosage.
The anti-tumor activity experiment of present embodiment small molecule of endothelium inhibin polypeptide:
1, the small molecule of endothelium inhibin polypeptide suppresses new vessel generation activity experiment
With 0.1 μ g concentration is that 95% small molecule of endothelium inhibin polypeptide and isopyknic physiological saline are inoculated instar chicken embryo urea cyst membrane on the 9th respectively.The chicken embryo urea cyst membrane of inoculation small molecule of endothelium inhibin polypeptide does not have new vessel to generate as shown in Figure 1 behind the 30h; The chicken embryo urea cyst membrane of inoculation physiological saline has a large amount of new vesseles to generate as shown in Figure 2 behind the 30h.Originally experimental results show that the small molecule of endothelium inhibin polypeptide of present embodiment can effectively suppress the generation of new vessel, suppress tumour and absorb nutrition and growth.
2, the TUNEL method detects small molecule of endothelium inhibin polypeptide promotion endotheliocyte and the experiment of rat liver cancer apoptosis
Continue to cultivate 24 hours after in huve cell and rat liver cancer cell culture fluid, adding the small molecule of endothelium inhibin polypeptide of final concentration 44 μ g/mL respectively.The huve cell that does not add the small molecule of endothelium inhibin polypeptide as shown in Figure 3, the rat liver cancer cell that does not add the small molecule of endothelium inhibin polypeptide as shown in Figure 4, the huve cell that adds the small molecule of endothelium inhibin polypeptide as shown in Figure 5, the rat liver cancer cell that adds the small molecule of endothelium inhibin polypeptide is as shown in Figure 6.Apoptotic cell is dyed bright green by fluorescence in Fig. 3～6, experimental result shows adding small molecule of endothelium inhibin polypeptide apoptosis cell showed increased, confirm that the small molecule of endothelium inhibin polypeptide all has apoptosis-promoting effect to huve cell and rat liver cancer cell, can suppress vasculogenesis and the directly growth of inhibition tumour cell.
3, detect the cell cycle experiment with flow cytometer
The human liver cancer cell cell cycle as shown in Figure 7, the Human umbilical vein endothelial cells cell cycle as shown in Figure 8, the human liver cancer cell cell cycle that adds the small molecule of endothelium inhibin polypeptide in nutrient solution, the Human umbilical vein endothelial cells cell cycle that adds the small molecule of endothelium inhibin polypeptide in nutrient solution as shown in figure 10 as shown in Figure 9.Human liver cancer cell G
0-G
1The phase cell is 58.09%, adds the human liver cancer cell cell G of small molecule of endothelium inhibin polypeptide
0-G
1The phase cell is 85.42%, Human umbilical vein endothelial cells G
0-G
1The phase cell is 57.43%, adds the Human umbilical vein endothelial cells G of small molecule of endothelium inhibin polypeptide
0-G
1The phase cell is 59.72%.Proof small molecule of endothelium inhibin polypeptide has tumour cell, endothelial cell period is arrested in G
0-G
1Phase, the growth activity of restriction tumour cell and endotheliocyte.
4, the intravital knurl that presses down of animal is tested
The mouse of inoculation rat liver cancer cell is divided into two groups at random, one group of subcutaneous injection every day small molecule of endothelium inhibin polypeptide 0.44 μ g/kg, another is organized and injects equivalent physiological saline every day, under equal conditions raise, the mouse of accepting small molecule of endothelium inhibin polypeptide treatment after 21 days as shown in figure 11, the mouse of injecting normal saline is as shown in figure 12.Arrow indication position is a tumour in Figure 11～12.Mouse is dissected the taking-up in-vivo tumour, accept the mouse interior tumor diameter average out to 14mm of small molecule of endothelium inhibin polypeptide treatment, as shown in figure 13; The mouse interior tumor diameter average out to 21mm of injecting normal saline, as shown in figure 14.Proof present embodiment small molecule of endothelium inhibin polypeptide (endostatin) has the effect of the growth of obvious inhibition tumour cell in animal body.
Embodiment two: the nucleotide sequence of present embodiment coding small molecule of endothelium inhibin polypeptide is as follows:
ATGCACAGCCACCGTGACTTCCAGCCTGTTCTCCACCTGGTTGCTCTCAACAGCCCTCTGTCAGGTGGTATGCGTGGTGACCGTGGTGAC。
The nucleotide sequence of present embodiment coding small molecule of endothelium inhibin polypeptide is according to the preferences design of intestinal bacteria to password, and small molecule of endothelium inhibin polypeptide (endostatin) can be stablized, be transcribed exactly and translate into to the nucleotide sequence of coding small molecule of endothelium inhibin polypeptide after entering bioengineered strain e. coli bl21 (DE3) with the recombinant vectors conversion.
Embodiment three: the complementary strand nucleotide sequence of present embodiment small molecule of endothelium inhibin polypeptide nucleotide sequence is as follows:
GTCACCACGGTCACCACGCATACCACCTGACAGAGGGCTGTTGAGAGCAACCAGGTGGAGAACAGGCTGGAAGTCACGGTGGCTGTGC。
Present embodiment complementary strand nucleotide sequence 3 ' end lacks and small molecule of endothelium inhibin polypeptide nucleotide sequence 5 ' two bases of end AT complementary.Article two, chain warp phosphorylation after annealing, an end is the cohesive end that has more two bases of AT, the other end is a flush end, helps cutting back and plasmid vector pTYB reorganization with Nde I and Sma I enzyme.
Sequence table
＜110〉Harbin Medical University
＜120〉nucleotide sequence and the complementary strand of small molecule of endothelium inhibin polypeptide and this polypeptide of encoding
<160>3
<210>1
<211>90
<212>DNA
＜213〉artificial sequence
<220>
<221>CDS
<222>(1)…(90)
＜223〉design according to small molecule of endothelium inhibin polypeptid acid sequence and intestinal bacteria preferences password.
<400>1
atg?cac?agc?cac?cgt?gac?ttc?cag?cct?gtt?ctc?cac?ctg?gtt?gct?ctc?16
Met?His?Ser?His?Arg?Asp?Phe?Gln?Pro?Val?Leu?His?Leu?Val?Ala?Leu
1 5 10 15
aac?agc?cct?ctg?tca?ggt?ggt?atg?cgt?ggt?gac?cgt?ggt?gac?30
Asn?Ser?Pro?Leu?Ser?Gly?Gly?Met?Arg?Gly?Asp?Arg?Gly?Asp
20 25 30
<210>2
<211>30
<212>PRT
＜213〉artificial sequence
<220>
＜223〉according to the endostatin active fragments and can with extracellular matrix competition and with tumor cell membrane on integrate plain bonded ammonia
Base acid sequence and designing.
<400>2
Met?His?Ser?His?Arg?Asp?Phe?Gln?Pro?Val?Leu?His?Leu?Val?Ala?Leu
1 5 10 15
Asn?Ser?Pro?Leu?Ser?Gly?Gly?Met?Arg?Gly?Asp?Arg?Gly?Asp
20 25 30
<210>3
<211>88
<212>DNA
＜213〉artificial sequence
<220>
＜223〉nucleotide sequence according to coding small molecule of endothelium inhibin polypeptide designs, and being used for changes with the reorganization of pTYB carrier again
Change e. coli bl21 (DE3).
<400>3
gtcaccacgg?tcaccacgca?taccacctga?cagagggctg?ttgagagcaa?ccaggtggag?60
aacaggctgg?aagtcacggt?ggctgtgc?88
Claims (3)
1, small molecule of endothelium inhibin polypeptide is characterized in that the small molecule of endothelium inhibin amino acid sequence of polypeptide is as follows:
MetHisSerHisArgAspPheGlnProValLeuHisLeuValAlaLeuAsnSerProLeuSerGlyGlyMetArgGlyAspArgGlyAsp
2, the nucleotide sequence of small molecule of endothelium inhibin polypeptide according to claim 1 of encoding, the nucleotide sequence of the small molecule of endothelium inhibin polypeptide that it is characterized in that encoding is as follows:
ATGCACAGCCACCGTGACTTCCAGCCTGTTCTCCACCTGGTTGCTCTCAACAGCCCTCTGTCAGGTGGTATGCGTGGTGACCGTGGTGAC
3, as the complementary strand of small molecule of endothelium inhibin polypeptide nucleotide sequence as described in the claim 2, it is characterized in that the complementary strand nucleotide sequence is as follows:
GTCACCACGGTCACCACGCATACCACCTGACAGAGGGCTGTTGAGAGCAACCAGGTGGAGAACAGGCTGGAAGTCACGGTGGCTGTGC
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100105263A CN100427503C (en) | 2006-09-08 | 2006-09-08 | Polypeptide in small molecule of endothelium inhibin, nucleotide sequence for encoding the polypeptide and complementary strand |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100105263A CN100427503C (en) | 2006-09-08 | 2006-09-08 | Polypeptide in small molecule of endothelium inhibin, nucleotide sequence for encoding the polypeptide and complementary strand |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1916023A true CN1916023A (en) | 2007-02-21 |
| CN100427503C CN100427503C (en) | 2008-10-22 |
Family
ID=37737105
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2006100105263A Active CN100427503C (en) | 2006-09-08 | 2006-09-08 | Polypeptide in small molecule of endothelium inhibin, nucleotide sequence for encoding the polypeptide and complementary strand |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100427503C (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104530199A (en) * | 2014-11-18 | 2015-04-22 | 哈尔滨医科大学 | Antitumor polypeptide, and preparation method and application thereof |
| CN113912739A (en) * | 2021-09-30 | 2022-01-11 | 哈尔滨医科大学 | Endostatin 33 peptide with anti-tumor activity and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2537179A1 (en) * | 2003-08-29 | 2005-03-10 | Children's Medical Center Corporation | Anti-angiogenic peptides from the n-terminus of endostatin |
-
2006
- 2006-09-08 CN CNB2006100105263A patent/CN100427503C/en active Active
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104530199A (en) * | 2014-11-18 | 2015-04-22 | 哈尔滨医科大学 | Antitumor polypeptide, and preparation method and application thereof |
| CN104530199B (en) * | 2014-11-18 | 2015-09-30 | 哈尔滨医科大学 | A kind of tumor protein p53 and its preparation method and application |
| CN113912739A (en) * | 2021-09-30 | 2022-01-11 | 哈尔滨医科大学 | Endostatin 33 peptide with anti-tumor activity and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100427503C (en) | 2008-10-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1916023A (en) | Polypeptide in small molecule of endothelium inhibin, nucleotide sequence for encoding the polypeptide and complementary strand | |
| CN1207305C (en) | Preparing process and application of recombined human interleukin-11 | |
| CN102139093A (en) | Application of short-chain cobrotoxin in preparation of intrathecally administrated analgesic medicines | |
| CN102191207A (en) | Gene engineering bacterium of expression of soluble FGF-21 and construction method and application thereof | |
| CN101875691B (en) | Scorpion arialgesic antitumoral peptide mutant and preparation method thereof | |
| CN1296059C (en) | Mackefulan immune liquid | |
| CN104558148A (en) | Ciliary neurotrophic factor mutant, and modified mutant and application thereof | |
| CN1760203A (en) | Antibacterial tripeptides and modified chemicals, and application | |
| CN101921820B (en) | Preparation method of recombinant tumor specificity antiapoptotic factors with activity and application of products thereof | |
| CN101875688B (en) | Folic acid modification step of method for preparing recombinant tumor specific apoptosis factor and application of products of recombinant tumor specific apoptosis factor | |
| CN1057564C (en) | Microbe capable of producing active recombinant phycobiliprotein and its preparing method | |
| CN1294987C (en) | Protein having antitumor function, and high performance expression in vitro | |
| CN1167712C (en) | Interleukin 11 analog | |
| CN1170845C (en) | Giant-web bombinator antineoplastic protein and its prepn and gene | |
| CN1768762A (en) | Novel drug administering route of pantocrine injection, its preparation process and novel indications | |
| CN1239516C (en) | Tumor necrosis factor relative cell death inducing ligand extracellular region mutation polypeptide and its prepn and use | |
| CN1394956A (en) | Human epidermal growth factor receptor specific fusion protein and its application | |
| CN1221795A (en) | Human interleukin 6 core transcription factor expression plasmid series and its application in treating tumour | |
| CN1524879A (en) | Anti endothelial cell element, genes encoding same and pharmaceutical uses thereof | |
| CN1204145C (en) | Preparation of human vasal endothelial cell growth inhibitor and its application in tumor angiogenesis resisting treatment | |
| CN1172953C (en) | Gene sequence and amino-acid sequence of varient omega-conch toxin polypeptide and their preparing method and medicinal use | |
| CN1277921C (en) | Method for producing recombinant human lactoferrin in silkworm body by gene engineering technology | |
| CN100350932C (en) | Medicine for non operation treating nasitis and pharyngolaryngitis | |
| CN1224759A (en) | Production and application of human endothelial cell inhibin gene and its expression product | |
| CN1883709A (en) | Bi-functional targeting antineoplastic polypeptide and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |