CN1224759A - Production and application of human endothelial cell inhibin gene and its expression product - Google Patents
Production and application of human endothelial cell inhibin gene and its expression product Download PDFInfo
- Publication number
- CN1224759A CN1224759A CN 99116065 CN99116065A CN1224759A CN 1224759 A CN1224759 A CN 1224759A CN 99116065 CN99116065 CN 99116065 CN 99116065 A CN99116065 A CN 99116065A CN 1224759 A CN1224759 A CN 1224759A
- Authority
- CN
- China
- Prior art keywords
- ser
- leu
- endothelial cell
- ctg
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention belongs to the field of gene engineering technology. The present invention uses human collagen XVIIIcDNA as template to synthesize human endothelial cell inhibin gene through PCR process and constitute the carrier and strain containing the gene, especially the colibacillus expression carrier pBVE20 and its transferred colibacillus recombined strain DH5 alpha (pBVE20) containing the gene, and uses the strain to produce recombined human endothelial cell inhibin. The strainhas the advantages of high expressed amount and easy-to-purify expression product. The present invention provides one practical way of obtaining recombined human endothelial cell inhibin with stable resource and low cost and preparing new anticancer medicine.
Description
The invention belongs to gene engineering technology field, be specifically related to human endothelial cell inhibin gene, contain the carrier of this gene and the bacterial strain that transforms with this carrier and the production and the application of expression product thereof.
Endostatin (Endostatin) is Folkman laboratory isolating a kind of protein from mouse hemangioendothelioma (Hemangioendothelioma) cell in 1997, is the fragment of the 20KD of collagen protein X VIII (collagen X VIII) C end.The same with angiostatin, it can suppress the formation of the propagation of endotheliocyte and new vessel and suppress Mice Bearing Lewis Lung Cancer, T241 fibrosarcoma, EOMA hemangioendothelioma, the growth of melanomatous primary tumor of B16F10 and metastatic tumor.Different with existing cancer therapy drug, its mechanism of action is by suppressing tumor neovasculature formation, thereby cuts off the blood supply of tumour and transfer and the growth that nutrition supply suppresses tumour.Because the vascular endothelial cell of healthy tissues is a division growth no longer, is not subjected to the influence of this medicine.Thereby this anticancer protein has selectivity, specificity and the minimum toxic side effect of height.Because limited by cultivating hemangioendothelioma cell extraction source, cost height, using gene engineering technique are produced recombinant human endothelial cell statin and are just seemed very necessary.
Purpose of the present invention comprises: 1) recombinant human endothelial cell inhibin gene is provided; 2) make up the carrier expression vector particularly contain this gene; 3) provide microorganism strains by this gene transformation; 4) provide by these transformed bacteria plant height efficient expressions, produce the method for recombinant human endothelial cell statin; 5) application of expression product.
Human endothelial cell inhibin gene of the present invention is to be template with human collagen X VIII cDNA, obtain through the PCR method amplification, it is equivalent to the dna fragmentation of human collagen X VIII cDNA3 ' end from termination codon (5 ' end) 184 common 555bp (comprising the codon ATG that adds the PCR) of codons to its upstream, and the essential characteristic of this gene is as follows:
A. sequence signature:
Length: 555bp
Type: nucleic acid
Chain number: two strands
B. molecule type: DNA
C. originate: the clone is the PCR product of template from human collagen X VIII cDNA
D.DNA sequence and amino acid sequence coded thereof such as sequence table 1 (SEQ ID No:1).
The dna sequence dna of the human collagen X VIII cDNA of pcr template that the present invention is used as is open in following document:
Suk?P.Oh?et?al,Cloning?of?cDNA?and?genomic?DNA?encoding?human?Type?ⅩⅧ?collagenand?localization?of?the?α1(ⅩⅧ)collagen?gene?to?mouse?chromosome?10?and?humanchromosome?21,Genomics,(1994)19:494-499。
The present invention has also made up the carrier that contains above-mentioned human endothelial cell inhibin gene, particularly contains coli expression carrier and Bacillus subtilus, Bijie yeast, candiyeast and the Han Sheng zymic expression vector of this gene.These construction of carrier are according to a conventional method, will insert after enzyme is cut between the corresponding restriction enzyme site of respective carrier by PCR method synthetic human endothelial cell inhibin gene, generate the expression vector that contains human endothelial cell inhibin gene.
The recombinant expression vector that the above-mentioned coli expression carrier that contains human endothelial cell inhibin gene preferably is built into by synthetic human endothelial cell inhibin gene of the present invention and coli expression carrier pBV220, called after pBVE20.Its building process as shown in Figure 1.
The present invention has also made up intestinal bacteria recombinant strain and Bacillus subtilus, Bijie yeast, candiyeast and the Han Sheng Yeast recombinant strain that can efficiently express human endothelial cell inhibin respectively with the above-mentioned corresponding expression vectors that contains human endothelial cell inhibin gene.
The present invention also provides the method for utilizing above-mentioned intestinal bacteria recombinant strain to produce human endothelial cell inhibin, this method is that bacterial strain is carried out cultivation and fermentation and makes it efficiently express the human endothelial cell inhibin recombinant protein through thermal induction, regather thalline, obtain recombinant human endothelial cell statin product through separation and purification.
The bacterial strain that the intestinal bacteria recombinant bacterial strain of above-mentioned energy expressing human endostatin of the present invention is preferably obtained by the expression vector pBVE20 transformed into escherichia coli DH5 α that contains human endothelial cell inhibin gene, called after Escherichia coliDH5 α (pBVE20) is called for short E.coli DH5 α (pBVE20).
The concrete grammar that utilizes this intestinal bacteria recombinant bacterial strain E.coli DH5 α (pBVE20) to produce human endothelial cell inhibin is:
(1) culture of strains fermentation: with bacterial classification inoculation in containing the LB liquid nutrient medium of penbritin 28～30 ℃, 150～200 rev/mins of overnight incubation, next day, transferred species was in identical substratum, 28～30 ℃, cultivate 1～4h for 200～250 rev/mins, be warming up to 42 ℃ and continue to receive bacterium after 3～4h is cultivated in jolting;
(2) purifying of expression product: the thalline of collecting above-mentioned cultivation, with centrifugal collection inclusion body precipitation after the cytoclasis, with the STE solution repetitive scrubbing precipitation that contains Triton X-100 and 2M urea, precipitation is dissolved in the 8M urea then, renaturation and through the Heparin-Sepharose affinity chromatography is the human endothelial cell inhibin of purifying through freeze-drying.
Spawn culture fermentation step in the aforesaid method can adopt 15 liters of fermentor tanks to carry out high density fermentation, to enhance productivity and output.
The recombinant human endothelial cell statin that aforesaid method makes shows the strong restraining effect to tumor growth and transfer in mouse experiment, can be used as the cancer therapy drug that effective ingredient is used to prepare a new generation.
Intestinal bacteria recombinant bacterial strain E.coli DH5 α of the present invention (pBVE20) has been preserved in Chinese typical culture collection center (CCTCC, Chinese Wuhan University are in the school), deposit number: CCTCC M99003, preservation day: on February 8th, 1999.
Can increase, extract and obtain recombinant expression vector pBVE20 of the present invention and human endothelial cell inhibin gene by this E.coli DH5 α (pBVE20) bacterial strain.Method is:
(1) get the single colony inoculation of E.coli DH5 α (pBVE20) in the LB substratum, 30 ℃ of overnight incubation, centrifugal collection thalline is with conventional alkaline lysis method of extracting plasmid pBVE20.
(2) produce two bands with restriction enzyme EcoR I and BamH I enzymolysis plasmid pBVE20, the little band of the about 560bp of separation and Extraction is human endothelial cell inhibin gene.
The human endothelial cell inhibin gene that obtains with aforesaid method is connected with appropriate carriers, can construct the required carrier that contains human endothelial cell inhibin gene.Can transform and construct the recombinant bacterial strain of corresponding energy express recombinant human endothelial cell inhibin with constructed expression vector.
Human endothelial cell inhibin gene of the present invention by with can in corresponding microorganism strains, efficiently express after suitable expression is connected, can obtain highly purified recombinant human endothelial cell statin through separation and purification.So by the present invention's mass production recombinant human endothelial cell statin easily, and cost is lower.This will be for obtaining the cheap recombinant human endothelial cell statin of steady sources, cost and providing a practicable approach with its new generation anti-cancer medicament for preparing the low toxic side effect of high curative effect.
Below by way of embodiments and drawings the present invention is described in further detail.
Fig. 1 is the building process synoptic diagram of recombinant expression vector pBVE20, and wherein, PR, PL are phage promoter, and T1, T2 are the transcription termination sequence of rmB.
Fig. 2 is the SDS-PAGE gel electrophoresis spectrum of recombinant human endothelial cell inhibin gene expression product.Wherein, the 1st, the standard molecular weight contrast, the 2nd, without inductive DH5 α (pBVE20) thalline, 3 is DH5 α (pBV220) thalline that 42 ℃ of inductive contain empty carrier, and 4 is DH5 α (pBVE20) thalline of 42 ℃ of abduction deliverings, and N is an expressing protein.
Fig. 3 is the restraining effect of recombinant human endothelial cell inhibin gene expression product to murine melanoma, and wherein, A is a control group mice, and B is the test group mouse.
Synthesizing of embodiment 1 human endothelial cell inhibin gene
According to the human collagen X VIII cDNA sequence of having delivered, the synthetic two sections primers of design:
5 ' end primer is CCGAATTCATGCACAGCCACCGCGACTTCCA
3 ' end primer is that CCGGATCCGCGGCCGCTACTTGGAAGGCAGTCATGAAGC5 ' end primer adds EcoR I restriction site and codon ATG before 20 homology bases, and 3 ' end primer adds Not I and BamH I restriction site in addition except that 20 homology bases.CDNA is a masterplate with human collagen X VIII, and through the endothelial cell inhibin gene of the synthetic about 0.6kb of pcr amplification, reaction conditions is: first circulation: 94 ℃ of sex change 4 minutes, 55 ℃ of annealing 1 minute, 72 ℃ of extensions 1 minute; Each circulation later on: 94 ℃ of sex change 1 minute, 55 ℃ of annealing 1 minute, 72 ℃ were extended totally 25 circulations 1 minute.Extension amplification outcome to acquisition recombinant plasmid pSPE2 between the EcoR I of carrier pSP72 and the BamH I, is carried out determined dna sequence, result such as sequence table 1.This sequence is consistent with the human endothelial cell inhibin gene sequence of expection, shows that the PCR product is a human endothelial cell inhibin gene.
Embodiment 2 contains the structure of the escherichia coli plasmid pBVE20 of human endothelial cell inhibin
With restriction enzyme EcoR I and BamH I human endothelial cell inhibin gene is downcut from plasmid pSPE2, separating the back is connected with the carrier pBV220 that cuts through EcoR I and BamH I enzyme, transformed into escherichia coli, screening has the transformant of amicillin resistance, extract through plasmid, enzyme is cut and is identified that back reference's endothelial cell inhibin gene has been cloned among the pBV220, with recombinant plasmid called after pBVE20.Building process is seen Fig. 1.
Embodiment 3 can efficiently express the structure of the intestinal bacteria recombinant strain E.coli DH5 α (pBVE20) of human endothelial cell inhibin
Use CaCl
2Method is pBVE20 Transformed E .coli DH5 α, screens transformant containing on the LB flat board of penbritin, detects and the restriction analysis acquisition contains the sub-E.coli DH5 of the recombinant conversion α (pBVE20) of pBVE20 through plasmid.
Embodiment 4 contains the structure of the candiyeast expression vector pUAKE5 of human endothelial cell inhibin gene
Use the EcoR I, the Not I is downcut human endothelial cell inhibin gene from plasmid pBVE20, after the separation and purification with through the EcoR I, pUAK8 after Not I enzyme is cut mixes, connect with the T4 dna ligase, transformed into escherichia coli DH5 α, screening has the transformant of amicillin resistance, extract plasmid with standard method, with restriction enzyme EcoR I, Not I enzyme is cut recombinant plasmid, obtain two fragments, its size is identical with pUAK8 and human endothelial cell inhibin gene respectively, and reference's endothelial cell inhibin gene has been cloned among the pUAK8, with recombinant plasmid called after pUAKE5.
Embodiment 5 can efficiently express the structure of the candiyeast recombinant bacterial strain Candida boidinii (pUAKE5) of human endothelial cell inhibin gene
With the LiCl conversion method pUAKE5 is introduced the Podbielniak candiyeast, screen the recombinant bacterial strain of multi-copy integration with the substratum of the G418 that contains different concns, detect the level of its expressing human endostatin, acquisition can efficiently express human endothelial cell inhibin recombinant bacterial strain Candida boidinii (pUAKE5).
Embodiment 6 contains the structure of the Bacillus subtilus engineering bacteria DB1342 (pURTQE4) of endothelial cell inhibin gene.
With restriction enzyme EcoR I and BamH I digested plasmid pBVE20, electrophoretic separation contains the small segment of human endothelial cell inhibin gene, receive on the corresponding site of bacillus subtilis bacteria plasmid pURTQ4, obtain to contain the expression plasmid pURTQE4 of human endothelial cell inhibin gene.Change pURTQE4 over to Bacillus subtilus DB1342 with the competence conversion method then, promptly obtain Bacillus subtilus engineering bacteria DB1342 (pURTQE4).
Embodiment 7 contains the structure of the living Yeast engineering bacteria of the Chinese of endothelial cell inhibin gene
Human endothelial cell inhibin gene is downcut from plasmid pSPE2, intestinal bacteria-Han Sheng yeast plasmid pUMH32 is advanced in reorganization, acquisition contains the recombinant plasmid pUMHE32 of endothelial cell inhibin gene, the sharp conversion method of electricity consumption is introduced into the Chinese and gives birth to yeast Hansenula polymorpha A16 then, obtains the Chinese and gives birth to Yeast engineering bacteria Hansenula polymorpha A16 (pUMHE32).
Embodiment 8 contains the structure of the Bijie Yeast engineering bacteria of endothelial cell inhibin gene
Human endothelial cell inhibin gene is downcut from plasmid pSPE2, the corresponding site of intestinal bacteria-Bijie yeast plasmid pPU5 is entered in reorganization, and transformed into escherichia coli DH5 α screens transformant on the penbritin flat board, through plasmid detect and enzyme cut evaluation errorless after, with recombinant plasmid called after pPUE5.With the LiCl conversion method pPUE5 is introduced Bijie yeast Pichia pastoris, obtain Bijie Yeast engineering bacteria Pichia pastoris (pPUE5).
Embodiment 9 utilizes bacillus coli gene engineering bacteria E.coli DH5 α (pBVE20) to produce recombinant human endothelial cell statin.
(1) culture of strains fermentation
The single colony inoculation of picking bacillus coli gene engineering bacteria E.coli DH5 α (pBVE20) is in containing the liquid LB substratum of 100ug/ml penbritin, 30 ℃, 200 rev/mins of shaking culture are spent the night, press 10% inoculum size transferred species next day in the same medium of proper volume, 30 ℃, 250 rev/mins of shaking culture 1 hour are treated A
600Be about at 0.4 o'clock and go in 45 ℃ of water-baths and shook 5 minutes, make it to be warming up to rapidly 42 ℃ of induction exogenous genes and express, under 42 ℃ of conditions, continue shaking culture and receive bacterium after 4 hours.
The cell that takes a morsel adds 2 * sample-loading buffer, boils after 5 minutes and walks the SDS-PAGE gel electrophoresis by standard method.Result such as Fig. 2, a new protein band appears on the position of inductive DH5 α (pBVE20) at 20kd, this band does not appear in inductive DH5 α (pBVE20) and DH5 α (pBV220), and reference's endostatin is abduction delivering in DH5 α (pBVE20).
(2) purifying of the recombinant human endothelial cell statin of Biao Daing
Collect the thalline of efficiently expressing recombinant human endostatin, centrifugal collection inclusion body precipitation behind ultrasonic disruption, with STE solution that contains TritonX-100 and the STE solution repetitive scrubbing precipitation that contains 2M urea, remove cell debris, foreign protein, impurity such as nucleic acid add in 2 milliliters of dissolving damping fluids that contain 8M urea by per 10 milligrams of inclusion bodies, and it is solubilized that room temperature is placed 1 hour.The renaturation solution renaturation that slowly adds 10 times of volumes.Recombinant protein is through heparin-Sepharose 4B affinity chromatography and SP-Sepharose ion exchange chromatography purifying, and freeze-drying is the pure product of recombinant human endothelial cell statin.
Embodiment 10 utilizes candiyeast recombinant bacterial strain Candida boidinii (pUAKE5) to produce recombinant human endothelial cell statin
(1) culture of strains fermentation
The single colony inoculation of picking engineering bacteria Candida boidinii (pUAKE5) is in MGM (1.34%YNB, 1% glycerine, 4 * 10
-5The % vitamin H) 30 ℃ of shaking culture are spent the night in the substratum, are forwarded to next day in the fresh same medium again, and 30 ℃ are continued to cultivate, and centrifugal collection supernatant after 24 hours stream adds methyl alcohol to final concentration to be 0.5%, 120 hour is standby with preserving behind the liquid nitrogen flash freezer.
(2) purifying of the recombinant human endothelial cell statin of Biao Daing
After freezing fermented supernatant fluid thawed, concentrate heparin on the concentrated solution-Sepharose 4B affinity chromatography and SP-Sepharose ion exchange chromatography purifying with ultrafiltration process.
Embodiment 11 recombinant human endothelial cell statin press down the test of (resisting) cancer
C57B16/J mouse or nude mice.20 ± 2g, each 20, back subcutaneous vaccination B16 melanoma or people's lung cancer/liver cancer cell suspension (5 * 10
6Individual/mL).Inoculate and treat after 10 days that the knurl volume reaches 100-200mm
3The time, test group is injected 5mg/kg/ days human endothelial cell inhibins respectively, and control group injection 0.3mL PBS was administered once in per 24 hours.Observe the variation of mouse body weight and knurl volume/weight after two weeks, result such as Fig. 3.From the result as seen, the knurl volume of test group mouse is significantly less than control group, illustrates that recombinant human endothelial cell statin can efficiently suppress the growth of B16 melanoma and lung cancer etc., can be used for preparing antitumor drug.
1 ( SEQ ID No:1 ) ATG CAC AGC CAC CGC GAC TTC CAG CCG GTG CTC CAC CTG GTT GCG CTC 48Met His Ser His Arg Asp Phe Gln Pro Val Leu His Leu Val Ala LeuAAC AGC CCC CTG TCA GGC GGC ATG CGG GGC ATC CGC GGG GCC GAC TTC 96Asn Ser Pro Leu Ser Gly Gly Met Arg Gly Ile Arg Gly Ala Asp PheCAG TGC TTC CAG CAG GCG CGG GCC GTG GGG CTG GCG GGC ACC TTC CGC 144Gln Cys Phe Gln Gln Ala Arg Ala Val Gly Leu Ala Gly Thr Phe ArgGCC TTC CTG TCC TCG CGC CTG CAG GAC CTG TAC AGC ATC GTG CGC CGT 192Ala Phe Leu Ser Ser Arg Leu Gln Asp Leu Tyr Ser Ile Val Arg ArgGCC GAC CGC GCA GCC GTG CCC ATC GTC AAC CTC AAG GAC GAG CTG CTG 240Ala Asp Arg Ala Ala Val Pro Ile Val Asn Leu Lys Asp Glu Leu LeuTTT CCC AGC TGG GAG GCT CTG TTC TCA GGC TCT GAG GGT CCG CTG AAG 288Phe Pro Ser Trp Glu Ala Leu Phe Ser Gly Ser Glu Gly Pro Leu LysCCC GGG GCA CGC ATC TTC TCC TTT GAC GGC AAG GAC GTC CTG AGG CAC 336Pro Gly Ala Arg Ile Phe Ser Phe Asp Gly Lys Asp Val Leu Arg HisCCC ACC TGG CCC CAG AAG AGC GTG TGG CAT GGC TCG GAC CCC AAC GGG 384Pro Thr Trp Pro Gln Lys Ser Val Trp His Gly Ser Asp Pro Asn GlyCGC AGG CTG ACC GAG AGC TAC TGT GAG ACG TGG CGG ACG GAG GCT CCC 432Arg Arg Leu Thr Glu Ser Tyr Cys Glu Thr Trp Arg Thr Glu Ala ProTCG GCC ACG GGC CAG GCC TCC TCG CTG CTG GGG GGC AGG CTC CTG GGG 480Ser Ala Thr Gly Gln Ala Ser Ser Leu Leu Gly Gly Arg Leu Leu GlyCAG AGT GCC GCG AGC TGC CAT CAC GCC TAC ATC GTG CTC TGC ATT GAG 528Gln Ser Ala Ala Ser Cys His His Ala Tyr Ile Val Leu Cys Ile GluAAC AGC TTC ATG ACT GCC TCC AAG TAG 555Asn Ser Phe Met Thr Ala Ser Lys stop
Claims (13)
1. human endothelial cell inhibin gene; It is characterized in that:it is as template take human collagen X VIII cDNA; 3 ' of the human collagen X VIII cDNA that derives from that obtains through the PCR method amplification holds corresponding genetic fragment; It is that human collagen X VIII cDNA is upward counted to the upstream dna sequence dna of totally 184 codons from termination codon; ATG555bp,DNA：ATG CAC AGC CAC CGC GAC TTC CAG CCG GTG CTC CAC CTG GTT GCG CTC 48Met His Ser His Arg Asp Phe Gln Pro Val Leu His Leu Val Ala LeuAAC AGC CCC CTG TCA GGC GGC ATG CGG GGC ATC CGC GGG GCC GAC TTC 96Asn Ser Pro Leu Ser Gly Gly Met Arg Gly Ile Arg Gly Ala Asp PheCAG TGC TTC CAG CAG GCG CGG GCC GTG GGG CTG GCG GGC ACC TTC CGC 144Gln Cys Phe Gln Gln Ala Arg Ala Val Gly Leu Ala Gly Thr Phe ArgGCC TTC CTG TCC TCG CGC CTG CAG GAC CTG TAC AGC ATC GTG CGC CGT 192Ala Phe Leu Ser Ser Arg Leu Gln Asp Leu Tyr Ser Ile Val Arg ArgGCC GAC CGC GCA GCC GTG CCC ATC GTC AAC CTC AAG GAC GAG CTG CTG 240Ala Asp Arg Ala Ala Val Pro Ile Val Asn Leu Lys Asp Glu Leu LeuTTT CCC AGC TGG GAG GCT CTG TTC TCA GGC TCT GAG GGT CCG CTG AAG 288Phe Pro Ser Trp Glu Ala Leu Phe Ser Gly Ser Glu Gly Pro Leu LysCCC GGG GCA CGC ATC TTC TCC TTT GAC GGC AAG GAC GTC CTG AGG CAC 336Pro Gly Ala Arg Ile Phe Ser Phe Asp Gly Lys Asp Val Leu Arg HisCCC ACC TGG CCC CAG AAG AGC GTG TGG CAT GGC TCG GAC CCC AAC GGG 384Pro Thr Trp Pro Gln Lys Ser Val Trp His Gly Ser Asp Pro Ash GlyCGC AGG CTG ACC GAG AGC TAC TGT GAG ACG TGG CGG ACG GAG GCT CCC 432Arg Arg Leu Thr Glu Ser Tyr Cys Glu Thr Trp Arg Thr Glu Ala ProTCG GCC ACG GGC CAG GCC TCC TCG CTG CTG GGG GGC AGG CTC CTG GGG 480Ser Ala Thr Gly Gln Ala Ser Ser Leu Leu Gly Gly Arg Leu Leu GlyCAG AGT GCC GCG AGC TGC CAT CAC GCC TAC ATC GTG CTC TGC ATT GAG 528Gln Ser Ala Ala Ser Cys His His Ala Tyr Ile Val Leu Cys Ile GluAAC AGC TTC ATG ACT GCC TCC AAG TAG 555Asn Ser Phe Met Thr Ala Ser Lys stop
2. a carrier is characterized in that this carrier contains the described human endothelial cell inhibin gene of claim 1.
3. according to the described carrier of claim 2, it is characterized in that this carrier is a coli expression carrier.
4. according to the described carrier of claim 3, it is characterized in that this carrier is pBVE20.
5. according to the described carrier of claim 2, it is characterized in that this carrier is that Yeast expression carrier given birth in Bacillus subtilus, candiyeast, Bijie yeast or the Chinese.
6. the intestinal bacteria of the energy expressing human endostatin that transforms by claim 3 or 4 described expression vectors.
7. according to the described intestinal bacteria of claim 6, it is characterized in that: it is that expression vector pBVE20 by claim 4 changes that formed intestinal bacteria recombinant strain E.coli DH5 α (pBVE20) is CCTCCM99003 in the bacillus coli DH 5 alpha over to.
8. Bacillus subtilus, candiyeast, Bijie yeast or the Chinese life yeast of energy the expressing human endostatin that transforms by the described carrier of claim 5.
9. utilize the method for the intestinal bacteria production human endothelial cell inhibin of claim 6, make it efficiently express the human endothelial cell inhibin recombinant protein, obtain recombinant human endothelial cell statin product through separation and purification again through strain culturing, thermal induction.
10. in accordance with the method for claim 9, it is characterized in that used intestinal bacteria are CCTCC M99003.
11. in accordance with the method for claim 10, it is characterized in that concrete steps are:
(1) culture of strains fermentation: with bacterial classification inoculation in containing the LB liquid nutrient medium of penbritin, 28～30 ℃, 150～200 rev/mins of overnight incubation, next day, transferred species was in same medium, 28～30 ℃, cultivated 1～4 hour for 200-250 rev/min, be warming up to 42 ℃ of continuation shaking culture and receive bacterium after 3～4 hours;
(2) purifying of expression product: the thalline of collecting above-mentioned cultivation, with centrifugal collection inclusion body precipitation after the cytoclasis, with the STE solution repetitive scrubbing precipitation that contains TritonX100 and 2M urea, precipitation is dissolved in the 8M urea then, renaturation and through heparin-Sepharose 4B affinity chromatography and SP-Sepharose ion exchange chromatography purifying is the recombinant human endothelial cell statin of purifying through freeze-drying.
12. in accordance with the method for claim 11, it is characterized in that spawn culture fermentation wherein is to adopt 15 liters of fermentor tanks to carry out high density fermentation.
13. will be used to prepare antitumor drug according to the recombinant human endothelial cell statin that the described method of one of claim 9 to 12 obtains.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 99116065 CN1224759A (en) | 1999-02-11 | 1999-02-11 | Production and application of human endothelial cell inhibin gene and its expression product |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 99116065 CN1224759A (en) | 1999-02-11 | 1999-02-11 | Production and application of human endothelial cell inhibin gene and its expression product |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1224759A true CN1224759A (en) | 1999-08-04 |
Family
ID=5278916
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 99116065 Pending CN1224759A (en) | 1999-02-11 | 1999-02-11 | Production and application of human endothelial cell inhibin gene and its expression product |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1224759A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111995686A (en) * | 2019-05-27 | 2020-11-27 | 兰州大学 | Medicine with anti-angiogenesis activity and preparation method thereof |
| CN115120744A (en) * | 2021-03-24 | 2022-09-30 | 四川大学 | Application of recombinant human endostatin adenovirus and anti-PD-1 antibody or anti-PD-L1 antibody in preparation of anti-tumor drugs |
| CN115386009A (en) * | 2022-04-26 | 2022-11-25 | 江苏靶标生物医药研究所有限公司 | Construction method and application of annexin V and angiogenesis inhibitor fusion protein |
-
1999
- 1999-02-11 CN CN 99116065 patent/CN1224759A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111995686A (en) * | 2019-05-27 | 2020-11-27 | 兰州大学 | Medicine with anti-angiogenesis activity and preparation method thereof |
| CN111995686B (en) * | 2019-05-27 | 2022-06-14 | 兰州大学 | Medicine with anti-angiogenesis activity and preparation method thereof |
| CN115120744A (en) * | 2021-03-24 | 2022-09-30 | 四川大学 | Application of recombinant human endostatin adenovirus and anti-PD-1 antibody or anti-PD-L1 antibody in preparation of anti-tumor drugs |
| CN115386009A (en) * | 2022-04-26 | 2022-11-25 | 江苏靶标生物医药研究所有限公司 | Construction method and application of annexin V and angiogenesis inhibitor fusion protein |
| CN115386009B (en) * | 2022-04-26 | 2023-12-01 | 江苏靶标生物医药研究所有限公司 | Construction method and application of annexin V and angiogenesis inhibitor fusion protein |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109966484B (en) | Immunopotentiator, preparation method, avian influenza vaccine and application | |
| CN107254482A (en) | A kind of method for improving Recombinant Swine interferon alpha fusion protein antiviral activity | |
| CN112695054A (en) | Construction method and application of high-expression chitinase endophytic fungus Liquidambaris phomopsis | |
| CN1304422C (en) | Non-amidated omega-conotoxin VIIA and its prepn process and application | |
| CN1224759A (en) | Production and application of human endothelial cell inhibin gene and its expression product | |
| CN1611604A (en) | Swine alpha-interferon gene synthesis, expression vector establishment and product preparing method | |
| CN114539426B (en) | Fusion protein containing interferon alpha, recombinant strain expressing fusion protein and preparation method of recombinant strain | |
| CN101875691B (en) | Scorpion arialgesic antitumoral peptide mutant and preparation method thereof | |
| CN1279288A (en) | Recombination human epidermal growth factor gene, its expression product and its application | |
| CN1125081C (en) | Recombined natural and new-type human insulin and its preparation | |
| CN101544693A (en) | Recombined extrasin alpha 1 two-strand body protein and preparation method thereof | |
| CN1990862A (en) | Production method of recombined human alpha1-thymus peptide and preparation thereof | |
| CN107177614A (en) | A kind of method for improving canine recombinant interferon gamma fusion protein antiviral activity | |
| CN1207305C (en) | Preparing process and application of recombined human interleukin-11 | |
| CN1057564C (en) | Microbe capable of producing active recombinant phycobiliprotein and its preparing method | |
| CN100335633C (en) | Method for preparing N-end acetylation modified thymosin alpha with recombined E. coli | |
| CN1224758A (en) | Production and application of human angiogenesis inhibin gene, carrier and strain containing the gene as well as the expression product | |
| CN1854296A (en) | Production of recombinant human interferon beta | |
| CN100362103C (en) | Human epidermis factor nucleic sequence and use thereof | |
| CN1061992C (en) | Colony stimulating factor for recombination of human granulocytes and medicinal composition thereof | |
| CN1876817A (en) | Production method for human tumor necrosis factor TNF-alpha mutant | |
| CN1291031C (en) | Method for preparing recombined thymosin alpha 1 | |
| CN1258747A (en) | Preparation of 4-tandem thymosin Alpha-1 with colon bacillus | |
| CN111793116B (en) | Transdermal heptapeptide, cosmetic composition containing same and preparation method | |
| CN100487118C (en) | Production process of recombinant human horny cell growth factor-2 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |