CN1896282A - Main-gene bph2 molecular mark method for rice variety anti-brownspot gene site - Google Patents
Main-gene bph2 molecular mark method for rice variety anti-brownspot gene site Download PDFInfo
- Publication number
- CN1896282A CN1896282A CNA2006100854002A CN200610085400A CN1896282A CN 1896282 A CN1896282 A CN 1896282A CN A2006100854002 A CNA2006100854002 A CN A2006100854002A CN 200610085400 A CN200610085400 A CN 200610085400A CN 1896282 A CN1896282 A CN 1896282A
- Authority
- CN
- China
- Prior art keywords
- asd7
- gene
- brown
- rice
- brown planthopper
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention belongs to the molecular genetics field and relates to the molecular marker method of the major gene bph2 for brown planthopper resistance in the rice variety ASD7. Via genetic linkage analysis of the individual F2 plant genotype and the brown planthopper resistance level of each F2:3 family produced by hybridizing the insect-resistant variety ASD7 with insect-susceptible variety C418, the molecular markers RM463 and RM7102 of the major gene loci bph2 in the insect-resistant variety ASD7 are obtained. In the ASD7/C418BC1 population the correct rate of selection by either marker is 91.2%. In the BC2 population, the correct rate of selection by RM463 is 91.2%, the correct rate of selection by RM7102 is 89.9%. Detection of this major gene loci in ASD7 and its derivatives via these molecular markers will increase the selection efficiency of brown planthopper resistant rices.
Description
One, technical field
The invention provides the molecule marking method of rice varieties ASD7 brown planthopper resistant key-gene bph2, belong to the molecular genetics field, be exclusively used in the seed selection of paddy rice brown planthopper resistant kind and the utilization of germ plasm resource.
Two, technical background
Paddy rice is the important food crop of China.Brown paddy plant hopper is a kind of paddy rice monophagy insect, belongs to the Homoptera Delphacidae.Suck rice stem stalk phloem juice by lancet, be typical sucking pest.Cause rice strain bottom blackening, rotten smelly, paralysed when serious, be referred to as " lice burning ", cause the paddy rice underproduction or mistake to be received.At present, the control of brown paddy plant hopper is mainly depended on chemical pesticide, but this measure has not only increased production cost, and contaminate environment, therefore, economical and effective and the prophylactico-therapeutic measures that do not pollute is the application of pest-resistant cultivar the most.
So far, 13 brown planthopper resistant key-genes have been found and have identified.Wherein, 6 of dominant genes, i.e. Bph-1 (Athwal et al., 1971), Bph-3 (Lakshiminarayana and Khush, 1977), Bph-6 (Kabir andKhush, 1988), Bph-9 (Ikeda et al., 1985; Nemoto et al., 1989a), Bph-10 (t) (Multani etal., 1994; Ishii et al., 1994) and Bph-13 (t) (Liu Guoqing etc., 2001).7 of recessive genes, i.e. bph-2 (Athwal et al., 1971), bph-4 (Lakshiminarayana and Khush, 1977), bph-5 (Khush etal., 1985) and bph-7 (Kabir and Khush, 1988), bph-8 (Ikeda, 1985; Nemoto et al., 1989a), bph-11 (t) and bph-12 (t) (Hirabayashi and Ogawa, 1999).The molecule Position Research of brown planthopper resistant has also been carried out in other researchs, has identified 26 brown planthopper resistant QTL, but really is used for the brown planthopper resistant gene of breeding and few.
The International Rice Research Institute from 1973 seed selection successively a series of rice varieties that carry brown planthopper resistant key-genes such as Bph-1, bph-2 and Bph-3 respectively, controlled breaking out of brown paddy plant hopper effectively in the area of these kinds of plantation.Yet because the generation of brown paddy plant hopper true tumor type, the brown planthopper resistant kind is lost resistance gradually or is faced the danger of resistant lose (Pathak and Khush, 1979; Pathak and Saxena, 1980; Heinrichs, 1986; Saxena and Khan, 1989; Heinrichs, 1994; Gallagher et al., 1994).China also successively breeds a series of kinds (combination) that contain brown planthopper resistant gene Bph-1, has play a part positive to the control of brown paddy plant hopper.3328 parts of new rice varieties (being) that Lv Zhongxian etc. (2002) are national to 1986～2000 years and Zhejiang Province's breeding tackling key problem cooperative groups provides have carried out brown planthopper resistant evaluation and screening, found that from " the Seventh Five-Year Plan ", " eight or five " to " 95 " pest-resistant cultivar rate of reflecting out on a declining curvely, the breeding of paddy rice brown planthopper resistant is not subjected to enough attention.At present, domestic brown paddy plant hopper causes the strong Bangladesh's type biotype ratio of harmful power and rises based on biotype 2, has the pest-resistant cultivar of Bph-1 originally, loses resistance gradually, thereby presses for the new pest-resistant cultivar that carries a plurality of resistant genes of cultivation.
Because the complicacy that insect-resistance is identified utilizes the conventional breeding means often to be difficult to the different anti insect gene of polymerization effectively.And finding with the anti insect gene close linkage or be total on the basis of isolating molecule marker, by molecular marker assisted selection (Marker-assisted selection, MAS) technology then can on purpose be carried out the polymerization of anti insect gene and QTL, seed selection durable resistance kind delays the degeneration time limit of pest-resistant cultivar and prevents the generation of brown paddy plant hopper true tumor type.
Three, summary of the invention
Technical problem
The objective of the invention is: the molecule marking method that rice varieties ASD7 brown planthopper resistant key-gene bph2 is provided, by detecting and the chain molecule marker of this brown planthopper resistant major gene loci, can detect the brown paddy plant hopper resistance of rice plant, accelerate the selection progress of brown planthopper resistant paddy rice.
Technical scheme
The molecule marking method of rice varieties ASD7 brown planthopper resistant key-gene bph2 is characterized in that:
Use labeled primer RM7102,
Left end primer sequence CGGCTTGAGAGCGTTTTTAG
Right-hand member primer sequence TACTTGGTTACTCGGGTCGG
Perhaps use labeled primer RM463,
Left end primer sequence TTCCCCTCCTTTTATGGTGC
Right-hand member primer sequence TGTTCTCCTCAGTCACTGCG
Amplifying rice brown planthopper resistant kind or breeding material DNA, if can amplify the amplified fragments of 168bp with primer RM7102, perhaps can amplify the amplified fragments of 195bp with primer RM463, all indicate the existence of paddy rice ASD7 brown planthopper resistant key-gene site bph2, wherein in the zone of this gene locus between rice genome the 12nd chromosomal marker RM463 and RM7102, with two marks respectively at a distance of 7.2cM and 7.6cM, rice varieties ASD7 is subjected to the monogenic control of bph2 to the resistance of brown paddy plant hopper, mark RM463 and RM7102 are with brown planthopper resistant kind ASD7 (Athwal D S, M D Pathak, E H Bacalangco, and C D Pura, Crop Sci.1971, be maternal 11:747-750), sense brown paddy plant hopper japonica rice variety C418 (Yang Zhenyu, Zhang Zongxu, Wei Yaolin, Zhao Yingchun, high brave. hybrid rice, 1998,13 (3): 31-32) be male parent, the BC of preparation C418/ASD7//C418
1F
1Colony is 95.1% to the assisted Selection accuracy of this colony's brown paddy plant hopper resistance; C418/ASD7//C418/ //C418 BC
2F
1The auxiliary accuracy that the brown paddy plant hopper resistance is selected is respectively 91.2% and 89.9% in the colony.
The process of screening above-mentioned labeled primer is as follows:
1. be female parent with brown planthopper resistant kind ASD7, sense brown paddy plant hopper japonica rice variety C418 is a male parent, and hybridization has made up the F that comprises 134 individual plants
2Segregating population, ASD7/C418 F
2Colony is used for molecular marker analysis; Each F
2Individual plant obtains corresponding F by selfing
2: 3Family is used for insect-resistance and identifies.
2. extract parent, F with the SDS method
1And F
2The DNA of each strain system of colony.Adopt simple repeated sequence mark SSR that two parents are carried out the polymorphism screening, PCR carries out on PTC-200 (MJ Research Inc.) amplification instrument, amplified production carries out electrophoretic analysis on 8% (g/ml) polyacrylamide gel, polymorphic primer is arranged at F between the parent
2Analyze in the colony, the pcr amplification program is the same, obtains F
2Each individual plant genotype data of colony;
3. according to chain exchange rule, utilize colony's genotype data to make up the genetic map of paddy rice, used software is MAPMARKER/EXP3.0, with the Kosambi function recombination value is converted to genetic distance;
4. adopting the inoculation in seedling stage to carry out insect-resistance identifies.Brown paddy plant hopper be biotype 1 and biotype 2 mixed populations (method with reference to " Ma Fei writes for Cheng Xianian, Wu Jincai. brown paddy plant hopper research and control, Chinese agriculture press, first version in 2003, p53-62 ").Two leaves are inoculated 2-3 brown paddy plant hopper in age nymph in the ratio of 10/seedling during one heart stage, nylon yarn guard on the back cover, when sense worm kind TN1 is all dead, method with reference to (2001) such as (1971) IRRI (1988) such as Athwal and Huang carries out 0 to each individual plant, 1,3,5,7 or 9 grades evaluation of resistance.To the resistance rank of each family in parent material and three colonies, and infer this individual plant genotype according to the resistance rank by this family of weighted average calculation.
5. utilize MAPMARKER/EXP3.0 software to carry out linkage analysis to colony's genotype data of each molecule marker with the pest-resistant rank that the brown paddy plant hopper resistance of its corresponding each family is identified, One-way ANOVA records and the incoherent probability P value of brown paddy plant hopper resistance, the molecule marker of P＜0.05 is promptly chain with a key-gene site, the position of brown planthopper resistant key-gene is determined by the chromosome position of molecule marker: find in ASD7 in probability P＜0.05 o'clock, mark RM7102, RM463 and the 12nd chromosomal brown planthopper resistant major gene loci bph2 are not chain, show that RM7102 mark and RM463 mark promptly are the molecule markers of the paddy rice ASD7 brown planthopper resistant major gene loci bph2 of acquisition.
The molecule marking method of beneficial effect rice varieties ASD7 provided by the present invention brown planthopper resistant key-gene bph2 has the following advantages:
(1) located brown planthopper resistant key-gene bph2 among the rice varieties ASD7 with the SSR mark first in the world by the present invention.
(2) by the localized key-gene of molecule marker of the present invention site locality specific, it is convenient to identify.By detecting and the chain molecule marker of this gene locus, promptly can predict the brown paddy plant hopper resistance of rice plant, whether the genotype detection that is used for rice varieties or strain has the brown paddy plant hopper resistance to judge this kind or strain, and then rapid screening disease-resistant variety or strain are used for rice breeding.It is easy to detect fast, and is not affected by environment;
(3) the assistant breeding select target is clear and definite, saves cost.In traditional breeding way, at first to collect parent and Cultivar and carry out a series of hybridization, and will carry out individual plant to the brown paddy plant hopper resistance and select with anti insect gene.The paddy rice brown paddy plant hopper is carried out the phenotypic evaluation complexity, at first will obtain the worm source, raise brown paddy plant hopper, to obtain to inoculate the worm source in addition and rice seedling synchronous, unusual difficulty, and affected by environment, the result reliability of phenotypic evaluation is low.Therefore breeding for pest resistance is not only time-consuming, and difficulty is big, the cost height.By detecting the brown planthopper resistant major gene loci, can just identify the individual plant of high brown planthopper resistant in seedling stage, eliminate other plant, not only save production cost but also improve the efficiency of selection of brown planthopper resistant paddy rice greatly.
Four, description of drawings
The position of Fig. 1 rice varieties ASD7 brown planthopper resistant key-gene bph2 on the 12nd karyomit(e) is long-armed.
Fig. 2 mark RM7102 is to C418/ASD7//C418 BC
1F
1For the molecular marker assisted selection electrophoretogram.M, molecular weight marker; P1, C418; P2, ASD7; F
1, F
11-21, BC
1F
1Individual.
Fig. 3 mark RM463 to C418/ASD7//C418/ //C418 BC
2F
1For the molecular marker assisted selection electrophoretogram; M, molecular weight marker; P1, C418; P2, ASD7; F
1, F
11-21, BC
2F
1Individual.
Five, embodiment
Of the present invention being described in detail as follows:
Studies show that the brown planthopper resistant gene resource mainly is present in Sri Lanka and India's long-grained nonglutinous rice and the wild seed rice (Ikedaand Vaughau, 1991).Athwal et al. (1971) (Athwal D S, M D Pathak, E H Bacalangco, andC D Pura, Crop Sci.1971,11:747-750) report Mudgo, CO22 and MTU15 carry same brown planthopper resistant gene Bph-1, and ASD7 carries a recessive anti insect gene bph-2.Athwal and Pathak (1972) report MGL2 contains anti insect gene Bph-1, and Ptb18 contains bph-2.Martinez and Khush (1974) report IR747B2-6 contains Bph-1, and R1154-243 and IR4-93 contain bph-2.Lakshiminarayana and Khush (1977) report Sri Lanka pest-resistant cultivar Rathu Heenati is by the dominant gene Bph-3 control with the Bph-1 independent separate; Kind Babawee is then by the recessive gene bph-4 control with the bph-2 independent separate.The rice varieties that Sidhu and Khush (1978) report carries Bph-3 or bph-4 all shows resistance to all brown paddy plant hopper biotypes.Thailand rice varieties Col.5 Thailand and Col.11 Thailand, Burma rice varieties Chin Saba controls (Ikeda, 1985) by same with bph-2 and the inequipotential recessive anti insect gene bph-8 of bph-4.Identify and the genetic research of these anti insect genes is that the cultivation of pest-resistant cultivar provides the foundation, and wherein Bph-1, bph-2 and Bph-3 are applied in the breeding for pest resistance.But, because the complicacy that insect-resistance is identified utilizes the conventional breeding means often to be difficult to the different anti insect gene of polymerization effectively.And finding with the anti insect gene close linkage or be total on the basis of isolating molecule marker, by molecular marker assisted selection (Marker-assisted selection, MAS) technology then can on purpose be carried out the polymerization of anti insect gene and QTL, seed selection durable resistance kind delays the degeneration time limit of pest-resistant cultivar and prevents the generation of brown paddy plant hopper true tumor type.
By the evaluation in insect-proof rice kind ASD7 brown planthopper resistant key-gene of the present invention site and the discovery of molecule marker, can be used to instruct the seed selection work of brown planthopper resistant rice varieties, with chain with it molecule marker pest-resistant cultivar is screened, improve breeding efficiency greatly.
Materials and methods:
(1) ASD7/C418 (F
2, F
2: 3) colony, C418/ASD7//C418 (BC
1F
1, BC
1F
2), C418/ASD7//C418/ //C418 (BC
2F
1, BC
2F
2) structure and the phenotypic evaluation of colony:
(1) to pest-resistant cultivar ASD7 (♀) (Athwal D S, M D Pathak, E H Bacalangco, and C D Pura, CropSci.1971,11:747-750) with China japonica rice variety C418 (♂) (Yang Zhenyu, Zhang Zongxu, Wei Yaolin, Zhao Yingchun, high brave. hybrid rice, 1998,13 (3): 31-32) hybridize acquisition F
1(ASD7/C418), F
1Selfing produces ASD7/C418 F
2, acquisition comprises the F of 134 individual plants
2Segregating population, ASD7/C418 F
2Colony is used for molecular marker analysis.Each F
2Individual plant obtains corresponding ASD7/C418F by selfing
2: 3Family is used for insect-resistance and identifies.
(2) simultaneously, C418 is female parent (♀) with sense brown paddy plant hopper japonica rice variety, and brown planthopper resistant kind ASD7 is male parent (♂), hybridization F
1(C418/ASD7), again with F
1(C418/ASD7) backcross with male parent C418 for maternal, obtain to comprise the BC of 89 individual plants
1F
1(C418/ASD7//C418) colony utilizes ASD7/C418F
2What colony's molecular marker analysis was obtained screens with chain molecule marker RM7102, the RM463 of resistant gene, the banding pattern of selecting two marks all with the identical BC of resistance parent ASD7
1F
1Plant continues to backcross with male parent C418 for maternal, has made up the BC that comprises 154 individual plants
2F
1(C418/ASD7//C418/ //C418) colony.Selfing obtains BC respectively
1F
2(C418/ASD7//C418), BC
2F
2(C418/ASD7//C418/ //C418) colony.
(3) adopt connect seedling stage the worm identification method (Su Changchao, Cheng Xianian, Zhai Hu canal, Wan Jianmin. Acta Genetica Sinica, 2002,29 (4): 332-338), to the F of above-mentioned parent ASD7 and C418, ASD7/C418
1, ASD7/C418 F
2: 3, C418/ASD7//C418 BC
1F
2, C418/ASD7//C418/ //BC of C418
2F
2Carrying out insect-resistance identifies.For guaranteeing parent, F
1Consistent with each the family growth in three colonies, all distinguish presoaking and germinating prior to seeding for the examination material.Each family (kind) is got 25 planting seeds respectively in a diameter 8.5cm, high 9.0cm, fills with (aperture is arranged at the alms bowl bottom, is convenient to osmotic absorbent) in the round plastic alms bowl of nutrition soil, and spacing in the rows is 2.5cm.Each kind is planted 3 alms bowls at random.Per 28 polypotss place the plastic box of a 65cm * 44cm * 14cm interior (keeping about water layer 2cm in the case).Sow thinning after 7 days, eliminate sick and weak seedling, remain into every alms bowl 20 strains, treat seedling length to two leaves during one heart stage in the ratio of 10/seedling inoculation 2-3 brown paddy plant hopper in age nymph, nylon yarn guard on the back cover, when contrast sense worm kind TN1 is all dead, method with reference to (2001) such as (1971) such as Athwal, IRRI (1988) and Huang carries out 0 to each individual plant, 1,3,5,7 or 9 grades evaluation of resistance (table 1), to the resistance rank of each family in parent material and three colonies, and infer this family genotype according to the resistance rank by this family of weighted average calculation.
The anti-sense brown paddy plant hopper judgement criteria that this institute of table 1 uses
| Pest-resistant rank | Be subjected to the brown paddy plant hopper performance of causing harm seedling stage | Resistance level |
| 0 1 3 5 7 9 | Blade does not have atrophy, healthy one to two yellow leaf of a yellow leaf of plant or blade atrophy one are withered to the atrophy of Herba Lysimachiae Insignis sheet or withered three to four the blade atrophys of blade or two to four blades, and the plant plant that still lives is withered | Anti-(MR) sense (S) sense (S) in anti-(MR) among anti-(R) anti-(R) |
(2) molecular marker analysis of ASD7/C418 F2 colony
(1) extracts ASD7/C418 F with the SDS method
2Each individual plant DNA;
(2) ssr analysis is with reference to the program of Chen et al. (1997).10 μ l reaction systems comprise: 10mM Tris-HCl pH8.3,50mM KCl, 1.5mM MgCl
2, 50 μ M dNTPs, 0.2 μ M primer, 0.5U Taq polysaccharase (TaKaRa, Dalian) and 20ng dna profiling.Amplified reaction carries out on PTC-200 (MJ Research Inc.) PCR instrument: 94 ℃ of 4min; 94 ℃ of 1min, 55 ℃ of 1min, 72 ℃ of 1.5min, 35 circulations; 72 ℃ of 7min.Amplified production separates with 8% non-sex change PAGE glue, dyes colour developing by silver, and silver dyes the method for program according to Sanguinetti et al. (1994).The lamp box that luminescent lamp is equipped with in the DNA band utilization of amplification is observed.The record result is with polymorphic labeled analysis F is arranged between the parent
2The marker gene type of each individual plant of colony obtains F
2The genotype data of each individual plant of colony;
(3) according to chain exchange rule, the SSR mark that utilizes polymorphism between the parent to detect to filter out is to 134 F
2Individual plant is analyzed, requirement by Mapmaker software will be 1 with the individual assignment of the identical banding pattern of ASD7, with the individual assignment of the identical banding pattern of C418 is 2, individual assignment with parents' banding pattern (heterozygosis band) is 3, what data lacked is designated as 0, utilize MAPMAKER (EXP3.0) software to carry out linkage analysis (Lincoln SE et al., 1993), make up SSR mark linkage map;
(4) utilize QTL Cartographer 2.0 softwares to F
2The brown planthopper resistant resistance rank of each molecular marker gene type data of each individual plant of colony and corresponding family is carried out linkage analysis, with the Kosambi function recombination value is converted to genetic distance.One-way ANOVA records and the incoherent probability P value of brown paddy plant hopper resistance, the molecule marker of P＜0.05 is promptly chain with a key-gene site, the position of brown planthopper resistant key-gene is determined by the chromosome position of molecule marker: find in ASD7 in probability P＜0.05 o'clock, mark RM7102, RM463 and the 12nd chromosomal brown planthopper resistant major gene loci bph2 are not chain, show that RM7102 mark and RM463 mark promptly are the molecule markers of the paddy rice ASD7 brown planthopper resistant major gene loci bph2 of acquisition.
(5) to the BC of C418/ASD7//C418
1F
1Generation 89 individual plants and C418/ASD7//C418/ //C418 BC
2F
1154 individual plants from generation to generation calculate the efficient of marker assisted selection, in conjunction with phenotype and molecular data, calculate the hereditary exchange rate of mark and gene in two colonies, with the Kosambi function crossover value are converted to map distance.And calculate the efficiency of selection of 2 marks.
(3) result and analysis:
Group's inoculation in seedling stage identifies that the pest-resistant rank that shows ASD7 and C418 is respectively 1.1 and 8.7, and this shows the ASD7 brown planthopper resistant and C418 sense brown paddy plant hopper.F
1The pest-resistant rank of plant is 1.8, to brown paddy plant hopper performance resistance, shows that the insect-resistance of ASD7 is controlled by dominant gene.134 F
2: 3Family is continuous distribution to the pest-resistant rank frequency distribution of brown paddy plant hopper, and minimum is 0.1, is 9.00 to the maximum, and 3 tangible tame coefficient peak values occur in 1,5 and 8 three positions of pest-resistant rank.According to its to the pest-resistant rank of brown paddy plant hopper with F
2: 3Family is divided into, and pest-resistant, anti-sense separates and three kinds of phenotypes of sense worm, and corresponding F
2The genotype of individual plant then is respectively and is designated as three kinds of RR (it is pest-resistant to isozygoty), Rr (heterozygosis is pest-resistant) and rr (the sense worm of isozygotying).F
2Colony meets 1: 2: 1 ratio (x to the anti-sense separation of brown paddy plant hopper
2=2.95, x
2 0.05, 2=5.99) (table 2).
Murata et al., the bph2 gene of report kind PL4 in 1998 is positioned at the 12nd karyomit(e), for this reason, the polymorphism analysis of parent ASD7 and C418 is at first carried out in this research to 43 SSR marks on the 12nd karyomit(e), and the result has 12 marks (accounting for 28%) to present polymorphism between the parent.Wherein, be positioned at the separation of the mark RM463 of the 12nd karyomit(e) on long-armed and reveal remarkable positive correlation with separating table to the brown paddy plant hopper resistance.Further select for use to be positioned at around the RM463 and between the parent, to have other polymorphic SSR marks and carry out linkage analysis, and made up the 12nd chromosomal SSR mark linkage map.One-way ANOVA records and the incoherent probability P value of brown paddy plant hopper resistance, the molecule marker of P＜0.05 is promptly chain with a key-gene site, the position of brown planthopper resistant key-gene is determined by the chromosome position of molecule marker: find in ASD7 in probability P＜0.05 o'clock, mark RM7102, RM463 and the 12nd chromosomal brown planthopper resistant major gene loci bph2 are not chain, be 0.05 respectively with the incoherent probability P value of brown paddy plant hopper resistance, show that RM7102 mark and RM463 mark promptly are the molecule markers of the paddy rice ASD7 brown planthopper resistant major gene loci bph2 of acquisition.These two marks and brown planthopper resistant gene site bph2 are respectively at a distance of 7.2cM and 7.6cM (Fig. 1).
Utilize RM463 and RM7102 to C418/ASD7//C418 BC
1F
1And C418/ASD7//C418/ //C418BC
2F
1Carry out from generation to generation molecular marker analysis, in conjunction with the resistance rank performance of pest-resistant evaluation, calculate the efficient of two marker assisted selection, Fig. 2, Fig. 3 have shown that respectively RM7102 is at C418/ASD7//C418 BC
1F
1From generation to generation and RM463 C418/ASD7//C418/ //C418 BC
2F
1Amplification polymorphism in the generation part individual plant.With the phenotype of A (a) expression plant, " A-" represents pest-resistant plant, " aa " expression sense worm plant; B (b) expression SSR loci gene type is formed, 2 allelotrope sites of " BB " expression are all from resistant variety ASD7, allelotrope site of " Bb " expression is from resistant variety ASD7, and another site is from C418, and 2 allelotrope sites of " bb " expression are all from C418.By table 3 as seen: RM463 and RM7102 are at C418/ASD7//C418 BC
1F
1In the colony, both select accuracy to be 95.1%, C418/ASD7//C418/ //C418 BC
2F
1In the colony, the selection accuracy of RM463 is 91.2%, and the selection accuracy of RM7102 is 89.9%, fully shows the reliability of brown planthopper resistant gene bph2 being carried out mark auxiliary selection method with SSR mark RM463 and RM7102.
Predict or detect the rice plant resistance by above-mentioned molecular markers for identification key-gene site, expectation can improve the breeding process of China's paddy rice brown planthopper resistant kind rapidly.
Table 2 ASD7/C418 F
2134 individual plants of segregating population are to the anti-sense of brown paddy plant hopper resistance segregation ratio
| F 2Genotype a) | F 2Number of individuals b) | Corresponding F 2∶3The family phenotype c) |
| RR Rr rr | 35 74 25 | RS＜2 2≤RS＜7 RS≥7 |
A)RR, it is pest-resistant to isozygoty; Rr, heterozygosis is pest-resistant; Rr, the sense worm of isozygotying
B)1RR: 2Rr: 1rr test of goodness of fit value x
2Be 2.95 (x
2 0.05, 2=5.99);
4)This column is pest-resistant rank codomain; RS, Resistance Score (pest-resistant rank)
The assisted Selection efficient of table 3 mark RM463 and RM7102
| From generation to generation | Mark | A-Bb | A-bb | aaBb | aabb | Sum | Crossover value | cM | Assisted Selection efficient |
| BC 1F 1 BC 2F 1 | RM463 RM7102 RM463 RM7102 | 46 46 71 70 | 2 2 5 5 | 0 0 2 3 | 41 41 76 76 | 89 89 154 154 | 2.5％ 2.5％ 4.5％ 5.2％ | 2.5 2.5 4.5 5.2 | 95.1％ 95.1％ 91.2％ 89.9％ |
A (a) shows the phenotype of plant, and " A-" represents pest-resistant plant, " aa " expression sense worm plant; B (b) expression SSR loci gene type is formed, 2 allelotrope sites of " BB " expression are all from resistant variety ASD7, allelotrope site of " Bb " expression is from resistant variety ASD7, and another site is from C418, and 2 allelotrope sites of " bb " expression are all from C418.
Claims (2)
1, the molecule marking method of rice varieties ASD7 brown planthopper resistant key-gene bph2 is characterized in that:
Use labeled primer RM7102,
Left end primer sequence CGGCTTGAGAGCGTTTTTAG
Right-hand member primer sequence TACTTGGTTACTCGGGTCGG
Perhaps use labeled primer RM463,
Left end primer sequence TTCCCCTCCTTTTATGGTGC
Right-hand member primer sequence TGTTCTCCTCAGTCACTGCG
Amplifying rice brown planthopper resistant kind or breeding material DNA, if can amplify the amplified fragments of 168bp with primer RM7102, perhaps can amplify the amplified fragments of 195bp with primer RM463, all indicate the existence of paddy rice ASD7 brown planthopper resistant key-gene site bph2, this gene is in the 12nd chromosomal marker RM463 and the zone between the RM7102 of rice genome, with two marks respectively at a distance of 7.2cM and 7.6cM, mark RM463 and RM7102 are at the BC of C418/ASD7//C418
1F
1In the colony, the assisted Selection accuracy is 95.1%; C418/ASD7//C418/ //C418 BC
2F
1The accuracy of assisted Selection is respectively 91.2% and 89.9% in the colony.
2, the molecule marking method of rice varieties ASD7 brown planthopper resistant key-gene bph2 according to claim 1 is characterized in that the process of screening above-mentioned labeled primer is as follows:
(1) be female parent with brown planthopper resistant kind ASD7, sense brown paddy plant hopper japonica rice variety C418 is a male parent, and hybridization makes up ASD7/C418 F
2Segregating population is used for molecular marker analysis; Each F
2Individual plant obtains corresponding F by selfing
2:3Family is used for insect-resistance and identifies;
(2) extract parent ASD7 and C418, ASD7/C418F with the SDS method
1And ASD7/C418F
2The DNA of each strain system of colony: adopt simple repeated sequence mark SSR that two parents are carried out the polymorphism screening, PCR carries out on PTC-200 amplification instrument, and amplified production carries out electrophoretic analysis on 8% polyacrylamide gel, polymorphic primer is arranged at F between the parent
2Analyze in the colony, the pcr amplification program is the same, obtains colony's genotype data;
(3) according to chain exchange rule, utilize colony's genotype data to make up the genetic map of paddy rice, used software is MAPMARKER/EXP3.0, with the Kosambi function recombination value is converted to genetic distance;
(4) adopting the inoculation in seedling stage to carry out insect-resistance identifies: brown paddy plant hopper is biotype 1 and biotype 2 mixed populations;
(5) the pest-resistant rank of utilizing MAPMARKER/EXP3.0 software that the brown paddy plant hopper resistance of each molecular marker gene type data of each family of colony and corresponding family is identified is carried out linkage analysis, One-way ANOVA records and the incoherent probability P value of brown paddy plant hopper resistance, the molecule marker of P＜0.05 is promptly chain with a key-gene site, the position of brown planthopper resistant key-gene is determined by the chromosome position of molecule marker: find the 12nd karyomit(e) RM7102 mark and RM463 mark and brown planthopper resistant major gene loci close linkage in ASD7, be 0.05 with the incoherent probability P value of brown paddy plant hopper resistance, RM7102 mark and RM463 mark are the labeled primer of mark paddy rice ASD7 brown planthopper resistant major gene loci bph2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2006100854002A CN1896282A (en) | 2006-06-13 | 2006-06-13 | Main-gene bph2 molecular mark method for rice variety anti-brownspot gene site |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2006100854002A CN1896282A (en) | 2006-06-13 | 2006-06-13 | Main-gene bph2 molecular mark method for rice variety anti-brownspot gene site |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1896282A true CN1896282A (en) | 2007-01-17 |
Family
ID=37608927
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2006100854002A Pending CN1896282A (en) | 2006-06-13 | 2006-06-13 | Main-gene bph2 molecular mark method for rice variety anti-brownspot gene site |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1896282A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010079383A2 (en) * | 2009-01-06 | 2010-07-15 | Wuhan University | Rice brown planthopper resistance gene and its application |
| CN101403011B (en) * | 2008-11-20 | 2011-04-13 | 广西壮族自治区农业科学院 | Anti-nilaparvata lugens major gene, molecular mark method and uses thereof |
| CN102199596B (en) * | 2008-11-20 | 2013-02-20 | 广西壮族自治区农业科学院 | SSR marker BYL8 of brown planthopper resistant genetic locus bph20(t) |
| CN103215237A (en) * | 2013-03-25 | 2013-07-24 | 南京农业大学 | Set of paddy rice anti-brown-planthopper genes, coded protein thereof, and application thereof |
| CN103509791A (en) * | 2013-07-31 | 2014-01-15 | 江西省农业科学院水稻研究所 | Gene marker of major gene Bph14 for resisting brown planthopper in rice and application thereof |
| CN113207682A (en) * | 2021-06-02 | 2021-08-06 | 广西壮族自治区农业科学院 | Rice breeding method for strengthening polygene polymerization and genetic background stability of high-yield, high-quality and biotic and abiotic stress resistant rice |
-
2006
- 2006-06-13 CN CNA2006100854002A patent/CN1896282A/en active Pending
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101403011B (en) * | 2008-11-20 | 2011-04-13 | 广西壮族自治区农业科学院 | Anti-nilaparvata lugens major gene, molecular mark method and uses thereof |
| CN102199596B (en) * | 2008-11-20 | 2013-02-20 | 广西壮族自治区农业科学院 | SSR marker BYL8 of brown planthopper resistant genetic locus bph20(t) |
| WO2010079383A2 (en) * | 2009-01-06 | 2010-07-15 | Wuhan University | Rice brown planthopper resistance gene and its application |
| WO2010079383A3 (en) * | 2009-01-06 | 2010-09-16 | Wuhan University | Rice brown planthopper resistance gene and applications thereof |
| CN103215237A (en) * | 2013-03-25 | 2013-07-24 | 南京农业大学 | Set of paddy rice anti-brown-planthopper genes, coded protein thereof, and application thereof |
| CN103215237B (en) * | 2013-03-25 | 2015-06-24 | 南京农业大学 | Set of paddy rice anti-brown-planthopper genes, coded protein thereof, and application thereof |
| CN103509791A (en) * | 2013-07-31 | 2014-01-15 | 江西省农业科学院水稻研究所 | Gene marker of major gene Bph14 for resisting brown planthopper in rice and application thereof |
| CN103509791B (en) * | 2013-07-31 | 2016-03-16 | 江西省农业科学院水稻研究所 | The genetic marker of Rice Resistance brown paddy plant hopper major gene Bph14 and application thereof |
| CN113207682A (en) * | 2021-06-02 | 2021-08-06 | 广西壮族自治区农业科学院 | Rice breeding method for strengthening polygene polymerization and genetic background stability of high-yield, high-quality and biotic and abiotic stress resistant rice |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1896281A (en) | Molecular mark method for rice variety anti-brownspot gene site | |
| CN101418349B (en) | Molecular marker method of rice variety brown planthopper resistance main gene Bph3 | |
| Salgotra et al. | Introgression of bacterial leaf blight resistance and aroma genes using functional marker-assisted selection in rice (Oryza sativa L.) | |
| CN101956019B (en) | Molecular marker of anti-nilaparvata-lugens major gene Bph3 of rice | |
| CN1896282A (en) | Main-gene bph2 molecular mark method for rice variety anti-brownspot gene site | |
| CN101914531A (en) | Molecular marker of major gene Bph6 resistant to brown planthopper and application thereof | |
| Raina et al. | Genetic enhancement for semi-dwarf and bacterial blight resistance with enhanced grain quality characteristics in traditional Basmati rice through marker-assisted selection | |
| Ates et al. | The identification of the resistance levels of Fusarium oxysporum f. sp. radicis-lycopersici and Tomato yellow leaf curl viruses in different tomato genotypes with traditional and molecular methods | |
| Butcher et al. | Genetic linkage mapping in Acacia mangium. 2. Development of an integrated map from two outbred pedigrees using RFLP and microsatellite loci | |
| CN111073991B (en) | Rice blast resistance gene Pi67(t), codominant molecular marker closely linked with same and application | |
| Obanor et al. | Genetic variation in Spilocaea oleagina populations from New Zealand olive groves | |
| WO2020214451A1 (en) | Powdery mildew resistant pepper plants | |
| Jayawardana et al. | Evaluation of DNA markers linked to blast resistant genes, Pikh, Pit (p), and Pita, for parental selection in Sri Lankan rice breeding | |
| Parvin et al. | RAPD analysis of Sclerotium rolfsii isolates causing collar rot of eggplant and tomato | |
| CN1896283A (en) | Molecular mark method for rice anti-leaf drop streak site | |
| CN108456680A (en) | Brown planthopper resistant gene Bph33 and its molecule labelling method | |
| Samsampour et al. | Marker assisted selection to pyramid seedling resistance gene Lr24 and adult plant resistance gene Lr48 for leaf rust resistance in wheat | |
| CN114032323A (en) | Co-dominant SSR marker closely linked with black shank resistance gene of cigar and application thereof | |
| Valkova et al. | Response of sunflower genotypes to mid-stalk rot caused by Sclerotinia sclerotiorum. | |
| CN111073990B (en) | Dominant molecular marker of rice blast resistance gene Pi67(t) and application thereof | |
| Das et al. | Molecular characterization of parental lines of rice aiming to address high yield and nutritional quality under drought and cold stress condition | |
| CN108165649A (en) | The molecular labeling of rice brown planthopper resistant major gene resistance qBph4 (t) and its application | |
| CN109338005B (en) | High-throughput detection marker for wheat soil-borne mosaic disease resistant gene and application thereof | |
| CN110923356B (en) | Molecular marker primer of rice gall midge-resistant major gene Gm5, and marking method and application thereof | |
| Chamoli et al. | Evaluation of French bean germplasm from Garhwal Himalayas for resistance to angular leaf spot |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |