CN1884549A - SjADA coding gene, its construction method and its in vitro fusion expression product and expression method - Google Patents

Abstract

This invention provides the gene sequence of schistoma japanicum adenosine deaminase SjADA and the method to obtain it, the expression plasmid pET 32-a(+)-SjADA can express SjADA in HEL cell and the method to obtain it, the fusion protein Trx-SjADA expressed in HEL cell and the method to obtain it. The above fusion protein Trx-SjADA has the activity of schistoma japanicum adenosine deaminase SjADA.

Description

SjADA encoding gene, its construction process and external fusion expressed product and expression method

Technical field

The present invention relates to molecule and RESEARCH ON CELL-BIOLOGY field, be specifically related to the encoding gene of Schistosoma japonica adenosine deaminase (SjADA), and amalgamation and expression in host cell and purifying.

Background technology

Schistosomicide be since people or mammalian infections the caused a kind of infecting both domestic animals and human parasitosis of schistosomicide.Worldwide its number of patients is only second to malaria, is second largest tropical parasitosis (Ross, et al., Clin.Microbiol.Rev.2001,14 (2): 270-295).According to WHO schistosomicide expert consulting report in 1998, estimate that there are 76 popular schistosomicide in countries and regions in the whole world, infected population reaches 200,000,000, compromised crowd 5-6 hundred million, wherein Symptomatic about 1.2 hundred million people, severe and wounded or disabled 2,000 ten thousand people, annual dead 20,000 people are having a strong impact on human beings'health and The development in society and economy.China once was one of schistosomiasis japanica the most serious popular country, and by semicentennial effort, China's schistosomicide preventing and controlling have obtained great achievement.Yet in recent years, in the popular district of China's schistosomicide, epidemic situation is gone up to some extent, and just progressively to Urban Sprawl, prevention and cure of schistosomiasis work faces severe situation.The serious epidemic situation of schistosomicide has caused the great attention of party and country ' s leader, and health ministry has been classified itself and acquired immune deficiency syndrome (AIDS), hepatitis B, pulmonary tuberculosis as 4 serious infectious diseases that China must keypoint control jointly.

The schistosomicide that infects human body has 19 kinds, and main cause of disease is Schistosoma mansoni (Schistosoma.mansoni), Schistosoma japonicum (S.japonicum), Schistosoma haematobium (S.haematobium), interleave schistosomicide (S.intercalatum) and river bank public affairs schistosomicide (S.mekongi) etc.The schistosomicide more complicated life history is included in intravital sexual generation of Mammals final host and in the intravital heterogenetic digenesis of intermediate host's spiral shell, divides worm's ovum, miracidium, born of the same parents' larva of a tapeworm or the cercaria of a schistosome, cercaria, virgin worm and 6 stages of adult its life history.

Schistosomicide is classified as the reproduction transmissible disease by the World Health Organization, is a kind of parasitosis that infects and stage a comeback very easily again.In China and Asia, Schistosoma japonicum is the main pathogen that causes serious schistosomicide disease.Long, metainfective concomitant immunity of, adult life-span many owing to the Schistosoma japonicum animal host and cure after poor, the reason such as intermediate host's oncomelania is wayward of immunizing power, it is the heaviest to be distributed in the state of an illness that the schistosoma japonicum infection in Asia causes, the difficulty of prevention and cure maximum.

At present the main control strategy of schistosomicide is a chemotherapy, and chemotherapy is one of important measures of control schistosomicide morbidity, but colony's chemotherapy is not eliminated the area schistosomicide and can only temporarily be reduced morbidity continuously, and can not blocking propagation.Though the praziquantel of high-efficiency low-toxicity makes the schistosomicide chemotherapy that breakthrough arranged, the same chemicals of prolonged and repeated use, (Ismail M, et al., Trop.Med.Hyg.1999 might cause developing immunity to drugs; 60:932-935; Xiao Shuhua etc., Chinese parasitology and parasitic disease magazine, 1995; 13 (4): 241-248).In addition, praziquantel be one to imago of blood fluke effectively and the medicine invalid to virgin worm though can reduce crowd's infection rate, can not prevent superinfection.China finds that at late nineteen seventies and early eighties Artemisinin, Artemether, Artesunate have antischistosomal effect, such medicine all has certain effect to the schistosomicide of each worm phase, particularly schistosomulum there is very strong killing action, medicine (the Xiao Shuhua etc. of prevention schistosomicide have been developed in the twentieth century end, China's parasitology and parasitic disease magazine, 1995; 13 (4): 241-248; Xiao Shuhua etc., Chinese parasitology and parasitic disease magazine, 1995; 13 (3): 170-173; Wu Lingjuan etc., Chinese prevention and cure of snail fever magazine, 1997; 9 (5): 284-286; Wu Lingjuan etc., Chinese prevention and cure of snail fever magazine, 1996; 8 (5): 267-269).The appearance of Artemether and Artesunate provides condition for the early treatment of schistosomicide, but kills the poor effect of adult.Therefore, WHO/TDR proposed to develop one and had not only had the new drug of killing adult but also the treatment schistosomicide (schistosomicide adult) of killing virgin worm effect being arranged in 2002.At present, though existing both at home and abroad part laboratory begins to carry out this research, multiple reason (Kohn AB, et al., J.Bio.Chem.2001; 276 (40): 36873-36876; MeshnickSR, et al., Int.J.Parasitol.2002; 32:1655-1660; Olliaro PL, et al., Trends Parasitol.2001; 17 (3): 122-126) restricted the development of new drug, still do not had the report of ideal two wires candidate medicine so far.Therefore, the expert thinks that the research of anti schistosoma new drug needs technological innovation, excavates the exploitation that new drug target will help new drug.

From the phase at the beginning of the twenties in last century, the research and the exploration of blood fluke vaccine have just been begun in the world.Recently; WHO/TDR carries out independent detection to most promising blood fluke vaccine candidate molecules; the result shows that protection is all less than 40%; have only the vaccine of part protection to use in the epidemic-stricken area and may finally cause vaccine invalid, the protection level that therefore how to improve the candidate antigens molecule be still the problem of a significant.

Have now and studies show that there are notable difference in bilharzial purine metabolism and its final host, bilharzial adult (Senft AW CG (1983), Pharmacol Ther.20 (3): 341-56; Huang Zuo-yue, et al., Chinese Medical Journal, 1984; 97 (9): 698-706) and larva (Dovey HF, et al., Mol Biochem Parasitol.11:157-67) all can not utilize simple compounds de novo synthesis purine nucleotides, and can only rely on salvage pathway purine biosynthesis Nucleotide fully.Host's red blood corpuscle contains abundant adenine nucleotide, for schistosomicide purine metabolism salvage pathway provides the purine source.Because schistosomicide and its final host kind are being to have greatest differences in the generation, some enzyme in its purine metabolism salvage pathway may have significant difference with its final host, utilize these characteristics can design specific inhibitor or " destructive substrate " (Kouni MH at some enzyme of schistosomicide, et al., Pharmacol Ther.2003 Sep; 99 (3): 283-309.Review.); Simultaneously, the purine transhipment also has obviously different (Levy MG et al. (1975) .J Parasitol.61 (4): 627-32) as the first step of the synthetic salvage pathway of schistosomicide purine with its final host.This shows that some translocator in the schistosomicide purine metabolism approach and enzyme all may be the potential target spots of the new chemotherapy of schistosomicide.At present, purine synthetic salvage pathway provides many successful drug targets (Kouni MH, et al., Pharmacol Ther.2003 Sep for antiparasitic chemotherapy; 99 (3): 283-309.Review; Nelson DJ, et al., Adv Exp Med Biol.1979; 122B:7-12; Carlson HE, et al., ClinEndocrinol (Oxf) .1981 Nov; 15 (5): 491-8), therefore, some key enzymes in the research Schistosoma japonicum purine metabolism approach will help to find that new drug target is used to screen the anti-schistosomiasis compound.

In the schistosomicide purine metabolism salvage pathway, adenosine is before this by deamination reaction (adenosine deaminase, adenosine deaminase, ADA) generate inosine (inosine), generate VITAMIN B4 and guanylic acid (purine nucleotides) by a series of salvage pathway reaction again.This shows that adenosine deaminase is the key enzyme in the purine metabolism approach.Adenosine deaminase (ADA) claims adenosine aminohydrolase (adenosineaminohydrolase) again, and its EC is numbered EC 3.5.4.4.ADA irreversibly the catalysis adenosine (adenosine, Ado) (2 '-deoxyadenosine, deamination reaction dado) are converted to inosine (inosine) and 2 ' Hypoxanthine deoxyriboside (2 '-deoxyinosine) respectively with these two kinds of nucleosides with 2 ' Desoxyadenosine.The best pH of the catalytic enzymatic reaction of ADA is near neutral range (Cristalli G, et al., Med Res Rev.2001 Mar; 21 (2): 105-28.Review).ADA not only plays a significant role in the process of synthetic in vivo AMP, and is requisite key enzyme in the building-up process of GMP.Its disappearance can cause death in mouse and fruit bat, can cause serious acquired immunodeficiency syndrome (SCID) (Giblett ER, et al., Lancet.1972 Nov 18 in the people; 2 (7786): 1067-9).Thereby body outer clone and expression ADA encoding gene are for further its function of research and application provide the foundation.But up to now, still nobody did further investigation to this.

In October, 2003, Brazilian and Chinese two countries scholar has delivered at Man and Schistosoma japonicum at " Nature genetics " magazine simultaneously respectively and has transcribed the major progress that group is studied, the data message and analytical results (the Hu W that transcribe group about Schistosoma mansoni and Schistosoma japonicum have been issued in a large number, et al., Nat.Genet.2003,35 (2): 139-147; Verjovski-Almeida S, et al., Nat.Genet.2003,35 (2): 148-157).

The present inventor transcribes on the basis of group data above-mentioned Schistosoma japonicum, further investigate, go out the full gene of Schistosoma japonica adenosine deaminase SjADA by pcr amplification, and in intestinal bacteria this gene of amalgamation and expression, obtain fusion rotein, behind enzyme activity determination, confirm that the gained fusion rotein has Schistosoma japonica adenosine deaminase SjADA activity, thereby finished the present invention.

Therefore, first purpose of the present invention provides the coding gene sequence of Schistosoma japonica adenosine deaminase SjADA.

Second purpose of the present invention provides the method that obtains the SjADA coding gene sequence.

The 3rd purpose of the present invention provides the recombinant plasmid of vivoexpression SjADA encoding gene.

The 4th purpose of the present invention provides the construction process of recombinant expression plasmid.

The 5th purpose of the present invention provides a kind of for the recombinant expression plasmid transformed host cells.

The 6th purpose of the present invention provides fusion rotein Trx (Trx)-Schistosoma japonica adenosine deaminase (SjADA).

The 7th purpose of the present invention provides the preparation method of fusion rotein Trx-SjADA.

Summary of the invention

The Schistosoma japonica adenosine deaminase SjADA coding gene sequence that a first aspect of the present invention provides is a sequence shown in the SEQ ID NO.1 (GenBank DQ273968) in the sequence table.

The method of the acquisition SjADA coding gene sequence that second aspect present invention provides is to be that template increases with the cDNA clone SJM2AHD10 that contains Schistosoma japonica adenosine deaminase SjADA gene order.

The recombinant expression plasmid of the vivoexpression SjADA encoding gene that a third aspect of the present invention provides is pET32-a (+)-SjADA.

Fourth aspect present invention provides the construction process of recombinant expression plasmid pET 32-a (+)-SjADA, comprises plasmid vector pET 32-a (+) is carried out step of connecting with the SjADA encoding gene.

It is a kind of for recombinant expression plasmid pET 32-a (+)-SjADA transformed host cells that fifth aspect present invention provides, and described host cell is intestinal bacteria.

Sixth aspect present invention provides a kind of fusion expressed product Trx-SjADA that expresses in host cell, its aminoacid sequence comprises aminoacid sequence shown in the SEQ ID NO.2 in the sequence table.

Seventh aspect present invention is provided at the method for expressed fusion protein Trx-SjADA in the host cell, may further comprise the steps:

1) recombinant plasmid pET 32-a (+)-SjADA is transformed in host cell, and in host cell, express, obtain expression product fusion rotein Trx-SjADA;

2) chela and agarose FF resin (Chelating Sepharose FF) affinitive layer purification expression product Trx-SjADA.

Detailed Description Of The Invention

The present inventor is at first by carrying out pcr amplification to Schistosoma japonica adenosine deaminase SjADA gene, the purifying amplified production is built into order-checking with reorganization pUC57-SjADA with products therefrom and plasmid vector pUC57, passes through transformation and selection, extracting recombinant plasmid, and the evaluation of checking order; Subsequently sublimed plasmid pUC57-SjADA is cut, reclaims and be connected by enzyme with plasmid pET 32-a (+), be built into recombinant plasmid pET 32-a (+)-SjADA of SjADA gene prokaryotic; It is converted into competent cell, cultivates and the extracting recombinant plasmid, the gained plasmid is converted in the host cell colibacillus and expresses after PCR, order-checking and enzyme are cut the evaluation affirmation; Get the higher clone of expression amount, fermentative preparation thalline, broken gained thalline; Since the fusion rotein that makes up contain 6 Histidine tails (6 * Histag), can select Chelating Sepharose FF affinitive layer purification fusion rotein for use, and then renaturation.Finally obtain the fusion rotein Trx-SjADA of purifying,, show that the gained fusion rotein has the activity of SjADA by measuring its enzyme activity.SjADA gene in vitro clonal expression and purifying have been finished.

1. the amplification of Schistosoma japonica adenosine deaminase SjADA complete genome sequence:

Cloning SJM2AHD10 with the cDNA that contains Schistosoma japonicum SjADA gene order is template, SEQ IDNO.3 is 5 ' primer, SEQ ID NO.4 is 3 ' primer, carry out pcr amplification, gained PCR product reclaims purifying through agarose gel electrophoresis with QIA fast PCR purification kit (QIAquick PCR Purification Kit).

The SjADA gene PCR product fragment of purifying and pUC 57 plasmid vectors are carried out enzyme cut and be connected, be built into SjADA gene sequencing recombinant plasmid pUC57-SjADA.This plasmid is passed through CaCl ₂Method is converted into the bacillus coli DH 5 alpha competent cell, coat after the cultivation on the LB agar plate that contains X-Gal, select white single bacterium colony, cultivate the back and collect thalline, with contained recombinant plasmid in mini-MTM plasmid DNA extraction system test kit (Mini-MTM PlasmidDNA Extraction System) extracting thalline, measure the full length sequence of SiADA encoding gene behind the plasmid purification by Shanghai Sangon company.

2. make up recombinant plasmid pET 32-a (+)-SjADA that can in host cell, express the SjADA encoding gene:

The plasmid pUC57-SjADA of purifying and plasmid pET 32-a (+) carry out enzyme with restriction enzyme Kpn I and Xho I respectively and cut, and reclaim purifying with QIAquick PCR Purification Kit.Be connected according to the concentration of the target gene fragment behind the purifying, be built into SjADA encoding gene prokaryotic expression recombinant plasmid pET 32-a (+)-SjADA with the carrier endonuclease bamhi.This plasmid is passed through CaCl ₂Method is transformed into the bacillus coli DH 5 alpha competent cell, coat after the cultivation on the LB agar plate that contains penbritin (Amp), the bacterium colony on the above-mentioned flat board of picking is cultivated the back and is collected thalline at random, contained recombinant plasmid in the extracting thalline carries out PCR evaluation, order-checking evaluation and enzyme respectively and cuts evaluation.

3. the expression of recombinant plasmid pET 32-a (+)-SjADA in colibacillus:

By the calcium conversion above-mentioned extracting gained pET 32-a (+)-SjADA recombinant plasmid is transformed into respectively in e. coli bl21 (DE3) and BL21 (DE3) the pLysS competent cell, coats after the cultivation on the LB agar plate that contains Amp.Bacterium colony on the above-mentioned flat board of picking is cultivated bacterium liquid to logarithmic phase at random, adds inductor and continues to cultivate.SDS-polyacrylamide gel (SDS-PAGE) electrophoresis is identified the abduction delivering result.

4. prepare the Trx-SjADA fusion rotein:

Get the higher frozen bacterial classification of expressed fusion protein Trx-SjADA amount in the liquid nutrient medium that contains Amp, after the overnight incubation, transferred species is cultivated bacterium liquid to logarithmic phase to the liquid nutrient medium that contains Amp equally, adds inductor and continues to cultivate, and collects thalline at last.Add damping fluid ultrasonic degradation bacterium in above-mentioned thalline, centrifugal back keeps supernatant and precipitation, by SDS-PAGE electrophoresis qualification result.According to The above results, with denaturing agent cracking gained precipitation, purifying is carried out with Chelating Sepharose FF affinity chromatography resin in centrifugal back.SDS-PAGE checks purification result.

5. identify the enzyme activity of Trx-SjADA:

Utilize homemade enzyme activity determination test kit (50T builds up bio-engineering research institute available from Nanjing) to measure the enzyme activity of adenosine deaminase fusion rotein.

Principle: the hydrolysis of adenosine deaminase ADA catalysis adenosine, produce inosine and ammonia, the ammonia that produces is carried out color reaction, thus the activity of ADA in can calculation sample.

Description of drawings

Fig. 1 is the amplification of Schistosoma japonica adenosine deaminase SjADA complete genome sequence.

Fig. 2 is the digestion with restriction enzyme qualification result of recombinant plasmid pUC57-SjADA.

Fig. 3 is the restriction enzyme qualification result of recombinant plasmid pET 32-a (+)-SjADA.

Fig. 4 is the expression of results of recombinant plasmid pET 32-a (+)-SjADA in e. coli bl21 (DE3).

Fig. 5 is the expression of results of recombinant plasmid pET 32-a (+)-SjADA in e. coli bl21 (DE3) pLysS.

Fig. 6 is that fusion rotein Trx-SjADA expresses after the fermentation culture in e. coli bl21 (DE3) and broken bacterium result.

Fig. 7 is the purification result of fusion rotein Trx-SjADA.

Specific embodiments

The present invention is further elaborated with embodiment below, but these embodiment have any restriction to the present invention absolutely not.Any change that those skilled in the art are done in to the invention process under the enlightenment of this specification sheets all will drop in the scope of claims.

Main agents

The Tag archaeal dna polymerase	Sangon
		Pfu DNA polymerase	Invitrogen
dNTP Mix	Sangon
		Restriction enzyme Kpn I and Xho I, Sma I, T4 dna ligase and buffer	Promega
100bp DNA Ladder	Gene RulerTM
		QIAquick PCR Purification Kit	QIAGEN
The plasmid extraction test kit, DNA reclaims test kit	Hua Shun
		Molecular weight Maker in the albumen (6,6000-1,4000dalton)	Hua Shun
IPTG	The west Bath
		Other reagent	Be homemade analytical reagent

Key instrument equipment

The PCR instrument	Germany Biometra
		Protein electrophoresis instrument (PAC300)	U.S. Bio-RAD
The desk type high speed refrigerated centrifuge	Germany eppendorf
		High speed freezing centrifuge (CR22F)	FDAC
The Milli-Q pure water system	U.S. Millipore
		The ultrasonic cell-break machine	The new sesame in Ningbo
AKTA explore 100 protein chromatographic systems	GE Health

Test materials

The cDNA that contains Schistosoma japonicum SjADA gene (1056bp) sequence clones, is numbered SJM2AHD10, is preserved in Chinese human genome research centre, south and Prevention ﹠ Control Station of Parasitic Disease, China Diseases Prevention ﹠ C.Host strain bacillus coli DH 5 alpha, BL21 (DE3), BL21 (DE3) pLysS, plasmid pUC57, plasmid pET-32a (+) are all available from Invitrogen.

The clone of embodiment 1 Schistosoma japonica adenosine deaminase SjADA gene

1) design primer, the sequence of amplification SjADA:

According to the cDNA clone's who contains the SjADA gene encoding sequence, express software (Primer Express) through primer and analyze the design primer, give birth to the synthetic a pair of primer of worker bio-engineering corporation by Shanghai, sequence is respectively:

P1：5′CTG GGTACCGACGACGACGACAAGATGTGGCTACCTTTGGAT；

P2：5′GTG CTCGAGCTATTATGTTTTGGAGTGA；

Primer P1 (in the sequence table shown in the SEQ ID NO.3) is a SjADA gene 5 ' end primer, has wherein introduced Kpn I restriction enzyme site GGTACC and enteropeptidase recognition sequence; Primer P2 (in the sequence table shown in the SEQ ID NO.4) is SjADA gene a 3 ' end primer, wherein introduces Xho I restriction enzyme site CTCGAG.

2) pcr amplification reaction (50 μ l):

A) the mixed liquid of reaction: template: 1.5 μ l; 5 ' primer P1 (SEQ ID NO.3): 2 μ l; 3 ' primer P2 (SEQ ID NO.4): 2 μ l; DNTP:2.5 μ l; 10 * Pfu damping fluid: 5 μ l; Pfu DNA polymerase: 0.5 μ l; Deionized water: 36.5 μ l.

B) reaction conditions: pre-95 ℃ of 5min of sex change; 56 ℃ of 1min anneal; 72 ℃ of 2min of renaturation.Circulate 30 times, last circulation renaturation prolongs 8min again.

The amplification of Schistosoma japonica adenosine deaminase SjADA complete genome sequence is seen Fig. 1.Wherein, swimming lane M is that PCR is with reference to molecular weight (100bp ladder); Swimming lane 1 is the PCR product of SjADA.The result shows that the stripe size of PCR product shown in the swimming lane 1 is about 1.1Kb, and the result conforms to expectation.

The sequence verification of embodiment 2 SjADA gene PCR products

1) structure of pUC57-SjADA order-checking plasmid:

SjADA gene PCR product with QIAquick PCR Purification Kit purifying embodiment 1 gained.Measure the SjADA gene PCR product fragment of purifying and the OD value of pUC 57 plasmid vectors respectively, and calculate the concentration of PCR product fragment and carrier segments, by PCR product fragment concentrations: carrier segments concentration is that 3: 1 mol ratio is carried out enzyme and cut connection.

A) the mixed liquid of reaction: restriction endonuclease sma I:1 μ l; T4 dna ligase: 1 μ l; 10 * lig damping fluid: 1 μ l; Deionized water; PUC57:80ng; SjADA gene PCR product: 60ng.

B) reaction conditions: with the mixed liquid of above-mentioned reaction amount to 15 μ l in 0.5ml centrifuge tube (Eppendorf pipe) 22 ℃ reacted 2-4 hour.

2) transformation and selection: with recombinant plasmid pUC57-SjADA CaCl ₂Method is transformed into the bacillus coli DH 5 alpha competent cell, and the thalline after transforming is added in the 1ml LB nutrient solution, behind 37 ℃, 250rpm shaking culture 1hr, coats on the LB agar plate that contains X-Gal, and culture dish is inverted in overnight incubation in 37 ℃ of incubators.

Select white single bacterium colony, in 10ml LB nutrient solution, 37 ℃, 250rpm shaking culture 4hr, the centrifuging and taking thalline, and, measure SjADA full length gene sequence by Shanghai Sangon company behind the plasmid purification with contained recombinant plasmid in the Mini-MTM Plasmid DNA Extraction System extracting thalline.

The qualification result of recombinant plasmid pUC57-SjADA restriction enzyme is seen Fig. 2.Wherein, swimming lane M1 is that PCR is with reference to molecular weight 1 (200bp ladder); Swimming lane 1 is the pUC57-SjADA through Kpn I and Xho I double digestion; The pUC57-SjADA that swimming lane 2 is cut for enzyme not; Swimming lane M2 is that PCR is with reference to molecular weight 2 (100bp ladder).The result shows that the band of an about 1.1Kb of size is arranged in the swimming lane 1, and the result conforms to expectation.The order-checking qualification result shows that the result is consistent with expectation.

The structure of recombinant plasmid pET32-a (+)-SjADA of embodiment 3 Schistosoma japonica adenosine deaminase SjADA gene prokaryotics

1) enzyme is cut: the plasmid pUC57-SjADA and the plasmid pET 32-a (+) of purifying are carried out double digestion with restriction enzyme Kpn I and Xho I respectively.

A) the mixed liquid of reaction: template 10 μ l; Kpn I:1 μ l; Xho I:1 μ l; BSA:0.5 μ l; Kpn I damping fluid: 1.5 μ l; Deionized water: 1 μ l.

B) reaction conditions: the mixed liquid of above-mentioned reaction is amounted to 15 μ l, and 37 ℃ of water-baths are spent the night in 1.5ml Eppendorf pipe.

2) purifying: SjADA gene and plasmid pET 32-a (+) after reclaiming purifying enzyme and cut with QIAquick PCR Purification Kit.

3) connect the construction expression plasmid:

Measure the target gene fragment behind the purifying and the OD value of carrier endonuclease bamhi, and calculate each segmental concentration, by the purpose fragment concentrations: carrier segments concentration is that 3: 1 mol ratio connects.

A) the mixed liquid of reaction: T4 dna ligase: 1 μ l; 10 *: 1 μ l; Deionized water; PET 32-a (+): 80ng; SjADA gene: 60ng.

B) reaction conditions: the mixed liquid of above-mentioned reaction is amounted to 10 μ l, 12 ℃ of-14 ℃ of connections in 1.5ml Eppendorf pipe spend the night.

The evaluation of embodiment 4 SjADA expression vectors

Use CaCl ₂Method is transformed into recombinant plasmid pET 32-a (+)-SjADA in the bacillus coli DH 5 alpha competent cell, promptly gets 1 μ l connection product and is transformed in the 50 μ l competent cells.Add 1ml LB nutrient solution in the thalline after conversion, 37 ℃, 250rpm shaking culture were coated on the LB agar plate that contains 100 μ g/ml Amp after 1 hour, and culture dish is inverted in overnight incubation in 37 ℃ of incubators.

1) order-checking of recombinant plasmid is identified:

Sequencing primer is that T7 primer and T7 stop primer (available from Invitrogen company), is measured the full length sequence of the SjADA gene among recombinant plasmid pET 32-a (+)-SjADA by Shanghai Sangon company.The order-checking qualification result shows that the result is consistent with expectation.

2) enzyme of recombinant plasmid is cut evaluation:

SjADA positive colony in the picking culture dish adds the 2 * YT liquid nutrient medium 5ml that contains 100 μ g/ml Amp, 37 ℃, 300rpm overnight incubation at random.With Mini-MTM Plasmid DNA ExtractionSystem extracting and plasmid purification.Extractive plasmid is carried out Kpn I and the evaluation of Xho I double digestion.

The qualification result of the restriction enzyme of recombinant plasmid pET 32-a (+)-SjADA is seen Fig. 3.Wherein, swimming lane M1 is PCR with reference to molecular weight 1 (2,1kb ladder); PET 32-a (+)-SjADA that swimming lane 1 is cut for enzyme not; Swimming lane 2 pET 32-a (+)-SjADA for cutting through Kpn I and Xho I enzyme; Swimming lane M2 is that PCR is with reference to molecular weight 2 (200bp ladder).The result shows that the size that the size band of about 1.1Kb and band are arranged in the swimming lane 2 conforms to the expectation result.

The expression of recombinant expression plasmid in intestinal bacteria of embodiment 5 SjADA

1) transforms:, pET32-a (+)-SjADA recombinant plasmid of respective embodiments 3 gained is transformed into respectively among e. coli bl21 (DE3) and BL21 (DE3) pLysS according to the qualification result of embodiment 4.

A) reaction system: 2 μ l recombinant plasmid pET 32-a (+)-SjADA are joined in the 1.5ml Eppendorf pipe that contains 50 μ l calcium commentaries on classics competent cell.

B) reaction process: behind the ice bath 30min, 37 ℃ of heat-shocked 5min, ice bath 2min immediately.Every pipe adds pre-temperature to 37 ℃ LB substratum, and 37 ℃, 300rpm were cultivated after 1 hour, got 100 μ l and coated on the LB agar plate that contains 100 μ g/ml penbritins, and culture dish is inverted in overnight incubation in 37 ℃ of incubators.

2) induce:

Picking Amp resistance SjADA positive colony is inoculated in 2 * YT liquid nutrient medium that 20ml contains 100 μ g/mlAmp at random from above-mentioned culture dish, cultivates bacterium liquid to OD for 37 ℃ ₆₀₀=0.6.Wherein, it is 0.5mM to final concentration that 10ml adds inductor IPTG, and 10ml does not add inductor IPTG in contrast in addition.Contrast bacterium liquid with wait to induce bacterium liquid to continue in 37 ℃, 250rpm to cultivate 4 hours.Respectively get 1ml in 4 ℃, 4, the centrifugal 10min precipitation of 000g thalline.

The result is induced in the check of SDS-PAGE electrophoresis:

With the 50 μ l PBS damping fluids above-mentioned gained thalline that suspends, take out 15 μ l, add 3 μ l, 6 * electrophoresis sample buffer, thermally denature 3min behind the mixing takes out 2 μ l and makes the SDS-PAGE electrophoresis.

The concentration of SDS-PAGE: spacer gel 4%, separation gel 15%.

Deposition condition: spacer gel 70V, separation gel 120V.

Electrophoresis places Xylene Brilliant Cyanine G R with gel after finishing ₂₅₀Fixing and dyeing is decoloured in ethanol-Glacial acetic acid destainer subsequently in the dye liquor.

The expression of results of recombinant plasmid pET 32-a (+)-SjADA in e. coli bl21 (DE3) seen Fig. 4.Wherein, swimming lane 1 is a standard molecular weight albumen; Swimming lane 2 is pET 32-a (+)-SjADA of not abduction delivering; Swimming lane 3-10 is pET 32-a (+)-SjADA behind the abduction delivering.

The expression of results of recombinant plasmid pET 32-a (+)-SjADA in e. coli bl21 (DE3) pLysS seen Fig. 5.Wherein, swimming lane 1 is a molecular weight standard albumen; Swimming lane 2-5 is pET 32-a (+)-SjADA behind the abduction delivering; Swimming lane 6 is pET 32-a (+)-SjADA of not abduction delivering.

The result shows, the abduction delivering that in two kinds of host cells, carries out, be about the 56kDa place in molecular weight, thalline before thalline after inducing is all induced presents obvious band of expression, be the syzygy of SjADA gene product and Trx (Trx) herein, the molecular weight size conforms to expected results.Screen the higher clone of expression amount according to this result, 8% glycerine pipe is frozen in-80 ℃ of refrigerators.

The preparation of embodiment 6 fusion rotein Trx-SjADA

1) fermentative preparation thalline:

According to embodiment 5 gained results, be taken at the higher frozen bacterial classification inoculation of the amount of expressed fusion protein Trx-SjADA in two kinds of host cells respectively and contain 2 * YT liquid nutrient medium of 100 μ g/ml Amp, 37 ℃ of overnight incubation in 20ml.Its transferred species was contained in the 2nd day 2 * YT liquid nutrient medium of 100 μ g/ml Amp to 1000ml.Cultivate bacterium liquid to OD for 37 ℃ ₆₀₀After=0.6, get 1ml bacterium liquid respectively and do not add inductor IPTG in contrast, add respectively subsequently inductor IPTG to final concentration be 0.5mM.Contrast bacterium liquid with wait to induce bacterium liquid to continue at 37 ℃, 250rpm to cultivate 4 hours.Subsequently, 4 ℃, 8, the centrifugal 10min of 000rpm receives to such an extent that bacterial precipitation is stored in-20 ℃.

2) broken bacterium: in above-mentioned gained bacterial precipitation, by the thalline weight in wet base: damping fluid=ratio of 1: 10 adds PBS (pH8.0) the damping fluid ultrasonic degradation bacterium (each 20sec, 2min altogether) of 20ml precooling respectively.In 4 ℃, 6, the centrifugal 30min of 000rpm, collecting precipitation.

Fusion rotein Trx-SjADA expression after the fermentation culture in e. coli bl21 (DE3), BL21 (DE3) pLysS reaches broken bacterium and the results are shown in Figure 6.Wherein, swimming lane 1 is a molecular weight standard albumen; Swimming lane 2 is the full bacterium of BL21 (DE3) pLysS abduction delivering; Swimming lane 3 is not induced full bacterium for BL21 (DE3) pLysS; Swimming lane 4 is that BL21 (DE3) pLysS expresses broken bacterium supernatant; Swimming lane 5 is that BL21 (DE3) pLysS expresses broken bacterium precipitation; Swimming lane 6 is not induced full bacterium for BL21 (DE3); Swimming lane 7 is that BL21 (DE3) expresses broken bacterium precipitation; Swimming lane 8 is that BL21 (DE3) expresses broken bacterium supernatant; Swimming lane 9 is expressed full bacterium for BL21 (DE3).

Expression of results shows, thalline before the abduction delivering that carries out in two kinds of host cells, the thalline after molecular weight is about the 56kDa place, induces are all induced presents obvious band of expression, be the syzygy of SjADA gene product and Trx (Trx) herein, size conforms to expected results.

Broken bacterium result shows, a) is present in the thalline with the inclusion body form behind the fusion protein expression; B) expression amount of recombination fusion protein will be got well in BL21 (DE3) pLysS in colibacillus BL21 (DE3), and expresses more stable.Therefore, select for use the fusion rotein of in colibacillus BL21 (DE3), expressing to continue next step purifying work.

3) inclusion body cracking purifying:

With step 2 among the resuspended embodiment 6 of small amount of deionized water) the gained precipitation, adding contains in the Tris damping fluid (pH8.0 contains 0.1% mercaptoethanol) of 8M Urea, and stirring at room is more than 1 hour.In 4 ℃, 10, the centrifugal 15min of 000rpm (removing precipitation) gets supernatant liquor and is directly used in purifying.

4) solubilization of inclusion bodies liquid affinity purification:

A) purifying resin: Chelating Sepharose FF affinity chromatography resin;

B) purifying damping fluid:

Level pad A: contain 10mM imidazoles, 500mM NaCl, 20mM Tris (pH8.0), 8M Urea;

Elution buffer B: contain 200mM imidazoles, 200mM NaCl, 20mM Tris (pH8.0), 8M Urea.

C) purification step:

The balance of resin: the buffer A balance resin of getting 5 times of column volumes;

Sample upper prop: with step 3) gained supernatant liquor and resin-bonded among the embodiment 6;

Washing:, steady until baseline with buffer A drip washing chromatographic resin;

Wash-out:, collect elution peak with buffer B wash-out fusion rotein.

D) renaturation step:

Adopt the dialysis refolding method, the dialysis tubing molecular weight cut-off is 10KD.Elutriant is diluted to protein concentration is about 0.2mg/ml, in the dialysis tubing of packing into, dialysed overnight, renaturation buffer is 0.1M Tris damping fluid (pH 8.0).Second day centrifugal collection supernatant liquor.

The purification result of fusion rotein Trx-SjADA is seen Fig. 7.Wherein, swimming lane 1 is a molecular weight standard albumen; Swimming lane 2 is a dissolution precipitation sample before the last sample; Swimming lane 3 is an elution peak, i.e. the albumen of purifying; Swimming lane 4 is the elution peak point, i.e. the albumen of purifying; Swimming lane 5-7 is for penetrating the peak.The result shows that through the purifying protein that wash-out obtains, its molecular weight is 56kDa, and is consistent with theoretical value.

Simultaneously, with BandScan 4.5 gel imaging analysis softwares gained purifying protein (as shown in Figure 7) is carried out purity check, the result shows: the per-cent of target protein gray scale shown in the swimming lane 2 is 70.80%; The per-cent of target protein gray scale shown in the swimming lane 3 is 82.40%; The per-cent of target protein gray scale shown in the swimming lane 4 is 84.10%.Therefore, the proteic purity of gained is about 84%.

The mensuration of embodiment 7 SjADA enzyme activities

1) determining the protein quantity:

Protein concentration with protein content determination test kit (building up bio-engineering research institute) working sample available from Nanjing.Operating process reference reagent box specification sheets.

The measurement result of protein content shows: according to typical curve, the concentration that records the fusion rotein Trx-SjADA behind the embodiment 6 gained purifying is 1.16mg/ml.

2) adenosine deaminase ADA vitality test:

Utilize homemade enzyme activity determination test kit (50T) to measure the enzyme activity of adenosine deaminase (ADA) fusion rotein.Operating process is with reference to the testing cassete specification sheets.Get the purified product that the contains the Trx-SjADA fusion rotein 20 μ l that express by e. coli bl21 (DE3), measure the wherein enzyme activity of adenosine deaminase, do three repeated tests.With every milligram of albumen 37 ℃ the time and substrate-function to produce 1 μ g ammonia nitrogen after 60 minutes be that a unit of enzyme activity is calculated, the enzyme activity that obtains the adenosine deaminase in the fusion rotein Trx-SjADA sample of surveying is 60.73 ± 6.25U/ milligram albumen.(normal reference value: human serum 0-25U/ml)

The above results shows: fusion rotein Trx-SjADA has activity of adenosine deaminase.

Sequence table

SEQUENCE LISTING

＜110〉Prevention ﹠ Control Station of Parasitic Disease, China Diseases Prevention ﹠ C

East China University of Science

Shanghai Center for Bioinformation Technology

＜120〉SjADA encoding gene, its construction process and external fusion expressed product and expression method

<130>CN061004

<160>4

<170>PatentIn version 3.3

<210>1

<211>1059

<212>DNA

＜213〉synthetic

<400>1

atgtggctac ctttggattt gtttgggatt aacttgcatg tccatctaga tggttccatt 60

aggccagaaa cgttgtttga gttatcaaat gataaaatat ccaaacctca gtttaaaacc 120

ttggaagagc tcaaagacaa gttaacgcct aaaaagccac acagtttaaa agacttcctg 180

aaagcttttg agataataat accattaatt gctggtaaga aagaggtttt ggcgcgtata 240

tgtgaagaat tcgtagaaga ttgtgtacaa cgtggtggtt tatgttatgc ggaaacaaga 300

tattgtccat ttttactggc cgactctaga tttaatgcag aagaagttct gaaaacaatt 360

cttgattcgc ttaacagagc tagtaaaaaa cacggcattg aagttcgttc cattttatcc 420

atcatgagac atatgcctga gacagcttca gaaacattag aattggccaa aaattatcaa 480

ccacatggag ttgttgcaat cgacgttgca ggcgatgatt cagttttgaa atcgcaacgt 540

ttaccgaatg aaatagttca aacatttgaa gaagctaaaa aggctggtat tcatcgtacg 600

gttcatgttg gtgaaaatag tccagcaagt agtgtatatg aagcagtcaa tattctacac 660

gctgaacgta ttggtcatgg gtatcatata ctagatgatg aaaaggctta taaatcttta 720

cttcaagcag gtgtacattt cgaggtatgc ccatcatcga gttttgttac gggttctgtc 780

gactctaaaa ttttaaataa ccatcctgta catcgtttca ttgaagataa agctaacttc 840

tctattaata ccgatgatcc aacattaaca gagagatggg atatacaaga agcacaatat 900

tgtttagaaa cattaggtat aaaacctagt caattaataa atgctaatta taatgctgca 960

atgtcagcat ttcttactac ttctgaaaaa gaaatcttaa tttcccatat aaatattaga 1020

tcaagaaata gaataatcga aattcactcc aaaacataa 1059

<210>2

<211>352

<212>PRT

＜213〉synthetic

<400>2

Met Trp Leu Pro Leu Asp Leu Phe Gly Ile Asn Leu His Val His Leu

1 5 10 15

Asp Gly Ser Ile Arg Pro Glu Thr Leu Phe Glu Leu Ser Asn Asp Lys

20 25 30

Ile Ser Lys Pro Gln Phe Lys Thr Leu Glu Glu Leu Lys Asp Lys Leu

35 40 45

Sequence table

Thr Pro Lys Lys Pro His Ser Leu Lys Asp Phe Leu Lys Ala Phe Glu

50 55 60

Ile Ile Ile Pro Leu Ile Ala Gly Lys Lys Glu Val Leu Ala Arg Ile

65 70 75 80

Cys Glu Glu Phe Val Glu Asp Cys Val Gln Arg Gly Gly Leu Cys Tyr

85 90 95

Ala Glu Thr Arg Tyr Cys Pro Phe Leu Leu Ala Asp Ser Arg Phe Asn

100 105 110

Ala Glu Glu Val Leu Lys Thr Ile Leu Asp Ser Leu Asn Arg Ala Ser

115 120 125

Lys Lys His Gly Ile Glu Val Arg Ser Ile Leu Ser Ile Met Arg His

130 135 140

Met Pro Glu Thr Ala Ser Glu Thr Leu Glu Leu Ala Lys Asn Tyr Gln

145 150 155 160

Pro His Gly Val Val Ala Ile Asp Val Ala Gly Asp Asp Ser Val Leu

165 170 175

Lys Ser Gln Arg Leu Pro Asn Glu Ile Val Gln Thr Phe Glu Glu Ala

180 185 190

Lys Lys Ala Gly Ile His Arg Thr Val His Val Gly Glu Asn Ser Pro

195 200 205

Ala Ser Ser Val Tyr Glu Ala Val Asn Ile Leu His Ala Glu Arg Ile

210 215 220

Gly His Gly Tyr His Ile Leu Asp Asp Glu Lys Ala Tyr Lys Ser Leu

225 230 235 240

Leu Gln Ala Gly Val His Phe Glu Val Cys Pro Ser Ser Ser Phe Val

245 250 255

Thr Gly Ser Val Asp Ser Lys Ile Leu Asn Asn His Pro Val His Arg

260 265 270

Phe Ile Glu Asp Lys Ala Asn Phe Ser Ile Asn Thr Asp Asp Pro Thr

275 280 285

Leu Thr Glu Arg Trp Asp Ile Gln Glu Ala Gln Tyr Cys Leu Glu Thr

290 295 300

Leu Gly Ile Lys Pro Ser Gln Leu Ile Asn Ala Asn Tyr Asn Ala Ala

305 310 315 320

Met Ser Ala Phe Leu Thr Thr Ser Glu Lys Glu Ile Leu Ile Ser His

325 330 335

Ile Asn Ile Arg Ser Arg Asn Arg Ile Ile Glu Ile His Ser Lys Thr

340 345 350

Sequence table

<210>3

<211>42

<212>DNA

＜213〉synthetic

<400>3

ctgggtaccg acgacgacga caagatgtgg ctacctttgg at 42

<210>4

<211>28

<212>DNA

＜213〉synthetic

<400>4

gtgctcgagc tattatgttt tggagtga 28

Claims (10)

1. Schistosoma japonica adenosine deaminase SjADA encoding gene is characterized in that having sequence shown in the SEQ ID NO.1 in the sequence table.

2.SjADA the preparation method of encoding gene is characterized in that the cDNA clone SJM2AHD10 to contain Schistosoma japonica adenosine deaminase SjADA gene order is that template increases.

3. recombinant expression plasmid pET 32-a (+)-SjADA.

4. the construction process of recombinant expression plasmid pET 32-a (+)-SjADA is characterized in that comprising the Connection Step with the SjADA encoding gene with plasmid vector pET32-a (+).

5. one kind with claim 3 described recombinant plasmid pET 32-a (+)-SjADA transformed host cells.

6. host cell as claimed in claim 5, described host cell are intestinal bacteria.

7. fusion rotein Trx-SjADA is characterized in that comprising aminoacid sequence shown in the SEQ ID NO.2 in the sequence table.

8. the preparation method of fusion rotein Trx-SjADA is characterized in that comprising recombinant expression plasmid pET32-a (+)-SjADA is transformed in host cell, and the step of expressing in host cell.

9. method as claimed in claim 8 is characterized in that also comprising the purifying of Trx-SjADA.

10. purification process as claimed in claim 9 is characterized in that the affinitive layer purification with Chelating Sepharose FF.

Images