CN1629189A - Specific antigen of Japanese blood fluke and its use - Google Patents

Specific antigen of Japanese blood fluke and its use Download PDF

Info

Publication number
CN1629189A
CN1629189A CN 200310109397 CN200310109397A CN1629189A CN 1629189 A CN1629189 A CN 1629189A CN 200310109397 CN200310109397 CN 200310109397 CN 200310109397 A CN200310109397 A CN 200310109397A CN 1629189 A CN1629189 A CN 1629189A
Authority
CN
China
Prior art keywords
lys
antibody
glu
leu
asp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 200310109397
Other languages
Chinese (zh)
Inventor
胡薇
王兆军
沈大康
薛纯良
冯正
韩泽广
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Basic Medical College Of Shanghai Second Medical University
NANFANG RESEARCH CENTRE STATE HUMAN GENE GROUP
Chinese National Human Genome Center at Shanghai
National Institute of Parasitic Diseases of Chinese Center for Disease Control and Prevention
Original Assignee
Basic Medical College Of Shanghai Second Medical University
NANFANG RESEARCH CENTRE STATE HUMAN GENE GROUP
National Institute of Parasitic Diseases of Chinese Center for Disease Control and Prevention
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Basic Medical College Of Shanghai Second Medical University, NANFANG RESEARCH CENTRE STATE HUMAN GENE GROUP, National Institute of Parasitic Diseases of Chinese Center for Disease Control and Prevention filed Critical Basic Medical College Of Shanghai Second Medical University
Priority to CN 200310109397 priority Critical patent/CN1629189A/en
Publication of CN1629189A publication Critical patent/CN1629189A/en
Pending legal-status Critical Current

Links

Images

Landscapes

  • Peptides Or Proteins (AREA)

Abstract

The invention provides specific antigens of Schistosoma japonicum, which are Schistosoma japonicum immunisin protein Sj50 and calcium bonded protein Sj16, the genes of Schistosoma japonicum immunisin protein Sj50 and calcium bonded protein Sj16 are isolated, these two proteins are expressed through recombination, thus achieving the source of large quantity diagnosis antigens. Sj50 and Sj16 can responsively and specifically detect Schistosoma japonicum antibody, especially Sj50 has the possibility of distinguishing acute and chronic infection, thus the invention has good application prospect.

Description

Specific antigens of Schistosoma japonicum and purposes
Technical field
The present invention relates to molecular biology and parasitology.More specifically, the present invention relates to specific antigens, the Preparation Method And The Use of Schistosoma japonicum (Schistosoma japonicum).
Background technology
Schistosoma japonicum (Schistosoma japonicum) is a kind of parasite of serious threat human health.
The sensitivity of schistosomicide amynologic diagnostic method and specificity are removed with outside the Pass the method for selecting experiment different have, and be main relevant with the characteristic of used diagnostic antigen.Though rough adult at present commonly used is higher with the susceptibility that egg antigen is used for schistosomiasis diagnosis, owing to it often is mixed with host antigen and contains other parasite such as the total antigenic component of liver fluke, lung fluke, easily produce cross reaction, specificity is lower.
Because it is traditional antigen mostly is worm source property, and it is less to originate, expensive big in addition, be difficult to adapt to the needs of looking into disease on a large scale.Development along with Protocols in Molecular Biology, producing synthetic antigen with gene recombination method is used to diagnose parasitosis to become possibility, also studies confirm that both at home and abroad, the use schistosomicide is specific, the antigen natural or reorganization of purifying not only can improve the susceptibility and the specificity of schistosomiasis diagnosis, and the short distance antibody of anti-some specific antigen of detection has certain efficacy assessment value
Nineteen eighty-three Cordingley etc. are carrier with PJSC73, the success from the Schistosoma mansoni worm's ovum, cloned a 40kDa can with the polypeptide of anti-SEA rabbit anteserum generation kickback.From then on, the various countries investigator has carried out extensive studies to the schistosomicide recombinant antigen.
Antibody (Immunophilin) is the acceptor of immunosuppressor cyclosporin A (CsA), belongs to FK506 conjugated protein (FKBP) superfamily, with structural similitude such as the plain p59 of heat-shocked binding immunoassay.It has peptidyl-propyl cis-trans isomerase (PPIase) activity, is mate molecule important in the protein folding, and can with multiple intracellular receptor protein binding.Being present in the intravital antibody of schistosomicide can interact with FKBP12 in the human body, plays an important role in schistosomicide.
Nineteen ninety-five Osman from Schistosoma mansoni cercaria cDNA library, filter out one with the gene (Smp50 gene) of the 1.4kb of antibody dna homolog, and in intestinal bacteria, express.The recombinant protein molecular weight of expressing is 50kDa, can be multi-clone rabbit serum identification [the Osman A of Schistosoma mansoni adult antigen immune, Kiang D, Lo Verde PT, et al.Schistosoma mansoni:characterization ofp50, an immunophilin.Exp Parasitol 1995; 80 (3): 550-559].
Moser in 1992 at in-vitro recombination expression a kind of calcium binding protein Sm16 in the Schistosoma mansoni worm's ovum, this albumen can be the identification of immunize rabbit serum, diagnostic antigen [the Moser D that is considered to a kind of tool potentiality, Doenhoff MJ, Klinkert MQ.A stage-specific calcium-binding proteinexpressed in eggs of Schistosoma mansoni.Mol Biochem Parasitol1992; 51 (2): 229-238].Thereafter the Sm16 that discovers of Rao has anti-infectious effect, be that a kind of rabbit epidemic disease adjusting albumen plays an important role in bilharzial immune evasion, recombinant expressed Sm16 has the intensive immunocompetence and can be polyclonal immunize rabbit serum and discern [Rao KV, Ramaswamy K.Cloning andexpression of a gene encoding Sm16, an anti-inflammatory protein fromSchistosoma mansoni.Mol Biochem Parasitol 2000; 108 (1): 101-108].
Yet, the specific antigen protein of Schistosoma japonicum was not also disclosed up to now.Therefore, this area presses for the specific antigens of exploitation Schistosoma japonicum.
Summary of the invention
Purpose of the present invention just provides the specific antigen protein of a kind of Schistosoma japonicum.
Another object of the present invention provides the method for making and the purposes of described Schistosoma japonicum specific antigen protein.
In a first aspect of the present invention, a kind of isolating sj16 albumen is provided, it is the Schistosoma japonicum specific antigens, and is selected from down group:
(a) has the albumen of aminoacid sequence shown in the SEQ ID NO:2;
(b) one or more amino acid whose displacements, disappearance or insertion take place by the albumen of (a) and form have immunogenic albumen at Schistosoma japonicum.
In another preference, described albumen has the aminoacid sequence shown in the SEQ ID NO:2.
In a second aspect of the present invention, a kind of isolating polynucleotide are provided, its sj16 albumen of the present invention of encoding.
Preferably, described polynucleotide, it is selected from down group:
(a) nucleotide sequence of 1-438 position among the SEQ ID NO:1;
(b) nucleotide sequence of 1-435 position among the SEQ ID NO:1.
In a third aspect of the present invention, carrier that contains above-mentioned polynucleotide and the host cell that contains described carrier are provided.
In a fourth aspect of the present invention, a kind of preparation method of Schistosoma japonicum immunogenic protein is provided, this method comprises:
(a) under expression condition, cultivate the above-mentioned host cell of the present invention;
(b) from culture, isolate the albumen that contains aminoacid sequence shown in the SEQ ID NO:2.
In a fifth aspect of the present invention, also provide a kind of can with sj16 protein-specific bonded antibody of the present invention.
In a sixth aspect of the present invention, the method that whether has anti schistosoma antibody in a kind of test sample is provided, comprising:
With sample and above-mentioned contacting with sj16 protein-specific bonded antibody,
Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample anti schistosoma antibody.
In a seventh aspect of the present invention, a kind of test kit that detects antibody of Schistosoma japonicum is provided, it contains sj16 albumen of the present invention and specification sheets.Preferably, this test kit also contains sj50 albumen of the present invention.More preferably, this test kit also contains positive control and negative control.
In a eighth aspect of the present invention, a kind of composition is provided, it contains sj16 albumen of the present invention or its immunogenic fragments and derivative and pharmaceutically acceptable carrier.Preferably, said composition also contains sj50 albumen of the present invention or its immunogenic fragments and derivative.Composition of the present invention can be used as vaccine and is used to prevent Schistosoma japonicum.
Description of drawings
Fig. 1 is the pcr amplification electrophorogram (1% agarose gel electrophoresis) of Schistosoma japonicum Sj50 and Sj16 gene.Each swimming lane is: M, and PCR is with reference to molecular weight; 1, the Sj16 gene amplification product; 2, the Sj50 amplified production.
Fig. 2 is the PCR evaluation figure (1% agarose gel electrophoresis) of recombinant plasmid pGEX4T-1-Sj50 and pGEX4T-1-Sj16.Each swimming lane is: M, and PCR is with reference to molecular weight; 1, pGEX4T-1-Sj50 PCR product, plasmid are template; 2, pGEX4T-1-Sj16 PCR product, plasmid are template; 3, pGEX4T-1-Sj50 PCR product, the amplification bacterium is a template.4, pGEX4T-1-Sj16 PCR product, the amplification bacterium is a template.
Fig. 3 is recombinant plasmid restriction endonuclease analysis Fig. 1 % agarose gel electrophoresis).Each swimming lane is: M, and PCR is with reference to molecular weight; F, the pGEX4T-1-Sj50 that cuts through EcoR I and Xho I enzyme; S, the pGEX4T-1-Sj16 after EcoR I and Xho I enzyme are cut.
Fig. 4 is the 12%SDS-PAGE analysis chart of recombinant plasmid pGEX4T-1-Sj50 and pGEX4T-1-Sj16 expression product in e. coli bl21.Each swimming lane is: M, standard molecular weight albumen; 1, the pGEX4T-1-Sj50 behind the abduction delivering; 2, the pGEX4T-1-Sj50 before the abduction delivering; 3, the pGEX4T-1-Sj16 behind the abduction delivering; 4, the pGEX4T-1-Sj16 before the abduction delivering; 5, the PGEX4T-1 after inducing.
Fig. 5 is GST-Sj50 fusion rotein and GST-Sj16 fusion rotein, and 12%SDS-PAGE analyzes after zymoplasm (zymoplasm) is cut.Each swimming lane is: M, standard molecular weight albumen; 1, the GST-Sj50 fusion rotein; 2, enzyme is cut incomplete GST-Sj50 fusion rotein; 3, the GST-Sj50 fusion rotein after enzyme is cut; 4, the GST-Sj16 fusion rotein; 5, enzyme is cut incomplete GST-Sj16 fusion rotein; 3, the GST-Sj16 fusion rotein after enzyme is cut.
Fig. 6 has shown anti-Sj50 and anti-Sj16 antibody test result in the schistosoma japonicum infection rabbit anteserum.
Fig. 7 has shown anti-Sj50 antibody test result in the schistosoma japonicum infection rabbit anteserum.Treatment group rabbit was accepted praziquantel treatment in infecting the back in 10 weeks.
Fig. 8 has shown anti-Sj16 antibody test result in the schistosoma japonicum infection rabbit anteserum.Treatment group rabbit was accepted praziquantel treatment in infecting the back in 10 weeks.
Fig. 9 has shown anti-Sj50 antibody and anti-Sj16 antibody test result among normal people and the acute and chronic Schistosoma japonicum patients serum.
Embodiment
The inventor is extensive studies through going deep into, not only isolated Schistosoma japonicum antibody Protein S j50 and calcium binding protein Sj16 first, also recombinant expressed Schistosoma japonicum antibody Protein S j50 and calcium binding protein Sj16 also use it for the detection of schistosome antibody.Finished the present invention on this basis.
The inventor is according to schistosomicide antibody coding gene sequence, designed a pair of oligonucleotide primer, with Schistosoma japonicum adult cDNA is template, amplification in vitro Schistosoma japonicum antibody (Sj50) encoding gene, after being recombined into plasmid PGEX-4T-1, obtain the protein s j50 of a 50kDa at e. coli expression and purifying.Detect as the ELISA that diagnostic antigen is used for schistosome antibody with Sj50, detection specificity and susceptibility are respectively 94.12% and 76.67% in experimentation on animals, and anti-Sj50 antibody horizontal can reflect that rabbit infects and the treatment situation in the infected rabbits serum.When being used for the antibody test of schistosomicide human serum, the specificity that sj50 detects is 98.3%, and the susceptibility that acute patient and chronic patient detect is respectively 95.2% and 63.2%, and can be used for distinguishing acute and chronic infection.
In addition, the inventor also separates and recombinant expressed calcium binding protein Sj16, and uses it for the diagnosis of schistosomiasis japanica, has all obtained comparatively ideal results in infection animal serum and human serum detect.
As used herein, in a few days japonicum antibody Protein S j50 and calcium binding protein Sj16 of term " albumen of the present invention " or " polypeptide of the present invention ".
The present invention also comprises having the variant form that immunogenicity, SEQ ID NO.2 or 4 sequences of identical anti schistosoma are arranged with described antigen protein except comprising the Schistosoma japonicum specific antigen protein shown in SEQ ID NO:2 and 4.These variant forms comprise (but being not limited to): one or more (it is individual to be generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function or immunogenicity usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic immunogenicity usually.This term also comprises SEQ ID NO:2 and 4 proteic active fragments and reactive derivatives.
In addition, in the present invention, the conservative property variation polypeptide that has also comprised the immune protein of SEQ ID NO:2 or 4 "; promptly compare with the aminoacid sequence of SEQ ID NO:2 or 4; have 10 at the most; preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.
With Sj16 is example, and the coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.For sj16, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region (1-435 position) sequence shown in the SEQ ID NO:1.
With Sj50 is example, and the coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:3 or the varient of degeneracy.For sj50, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:4, but with the differentiated nucleotide sequence of coding region (12-1286 position) sequence shown in the SEQ ID NO:3.
The Nucleotide full length sequence of Schistosoma japonicum specific antigen protein of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence.At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or encoding sequence, and the method that produces polypeptide of the present invention through recombinant technology.
By the recombinant DNA technology of routine, can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the albumen of the present invention of reorganization.In general following steps are arranged:
(1). invent proteic polynucleotide (or varient) with code book, or transform or the transduction proper host cell with the recombinant expression vector that contains these polynucleotide;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results 2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl 2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
Can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
On the other hand, the present invention comprises that also Schistosoma japonicum sj16 and sj50 albumen are had specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab) 2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule; Or chimeric antibody.Antibody of the present invention can be prepared by the known various technology of those skilled in that art.
The present invention also provides the method that whether has anti schistosoma antibody in the test sample.When detecting antibody with recombinant antigen, if contain carrier proteins in the recombinant antigen, carrier proteins may suppress epitope, also may cause cross reaction.Used prokaryotic expression plasmid is pGEX4T-1 (available from a Pharmacia company) among the present invention, and this plasmid is a gst gene in SD sequence downstream, and clone's foreign gene then links to each other with gst gene.When carrying out genetic expression, expression product is the syzygy of GST and goal gene product.The product that efficiently expresses can be removed GST and obtain required albumen through Glutathione Sepharose 4B purifying after zymoplasm is cut.Sj50 that the present invention is used and Sj16 are the purifying protein of having removed the GST carrier, are used for the schistosome antibody detection and can improve the sensitivity and specificity of detection.
Prepare antigen by gene engineering method, the antigen purity height that obtains can mass production.Not only can solve the source of a large amount of diagnostic antigens, and be beneficial to the stdn of detection method.The present invention for the diagnosis of schistosomiasis japanica provide two kinds of diagnostic antigen Sj50 and Sj16, particularly Sj50 because of its have distinguish acute and chronic infection may, have very wide prospect in the diagnosis of schistosomiasis japanica.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment
Material
Plasmid PGEX4T-1 (available from Pharmacia company).
Taq archaeal dna polymerase (Shen You company), Pfu DNA polymerase (BBST company), dNTP Mix (Sangon company), 10 * Pfu buffer (BBST company)
Restriction enzyme EcoR I and Xho I, EcoR I buffer, BSA
T4 dna ligase (Promega), 2 * connection damping fluid (Promega), 10 * connection damping fluid (Promega)
100bp?DNA?Ladder(Gene?RulerTM)
GST-5 ' primer, GST-3 ' primer (Shen You company)
QIAquick?PCR?Purification?kit(QIAGEN)
Mini-MTM?Plasmid?DNA?Extraction?System(V10GENE)
Goat anti-human igg's binding substances (Sigma) of the goat anti-rabbit igg binding substances of horseradish peroxidase mark, horseradish peroxidase mark.
96 hole enzyme plates (Nunc company)
Embodiment 1
Prepare various serum
1.1 schistosoma japonicum infection rabbit anteserum
Set up the schistosoma japonicum infection animal model.New Zealand's white is planted 30 of rabbits, and sub-cage rearing is respectively through 100 of stomach wall inoculation schistosoma japonicum cercariaes.Infect 10 weeks of back, randomly draw 10 rabbits and raise with praziquantel 200mg/kg stomach and carry out pharmacological agent.Get blood 1-2ml from rabbit ear vein every other week, separation of serum in 12 hours ,-20 ℃ are frozen.
1.2 normal people and schistosomicide patient saliva and serum
Patients serum's sample is from Inst. of Parasitic Disease, Chinese Academy of Preventive Medical Sciences, Chinese schistosomicide reference serum storehouse, and wherein the acute disease human serum is 62 parts, 57 parts of chronic patient serum.Normal human serum and saliva sample are taken from the students of the No2. University of Medical Sciences, amount to 57 parts.
Embodiment 2
The acquisition of Sj50 gene and Sj16 gene
2.1 primer design and synthetic
According to Sj50 gene and Sj16 gene order, through Primerexpress software analysis design primer, by the synthetic two pairs of primers of Shen, Shanghai friend's biotinylated biomolecule engineering corporation.
Sj50-F is 5 ' CCGGAATTCATGTCGGAGACGCCAAAGC3 ' (SEQ ID NO:5), introduces EcoR I restriction enzyme site GAATTC;
Sj50-R is 5 ' CCGCTCGAGCAGAATTAAGCTCTCACAGGGCA3 ' (SEQ ID NO:6); Introduce Xho I restriction enzyme site CTCGAG;
Primer Sj16-F is 5 ' CCGGAATTCCTTCATCTCAGAATAATGTCGGA3 ' (SEQ ID NO:7), introduces EcoR I restriction enzyme site GAATTC;
Sj16-R is 5 ' CCGCTCGAGCATACGTTTGACGTACATAAGCT ' 3 ' (SEQ ID NO:8), introduces Xho I restriction enzyme site CTCGAG.
Primer is stored concentration 50mM, working concentration is 10mM.
2.2.Sj50 the pcr amplification of gene, Sj16 gene
With Schistosoma japonicum adult and worm's ovum cDNA with the ordinary method preparation is template, carries out pcr amplification.Reaction system amounts to 50 μ l, wherein template 1.5 μ l, 5 ' primer 2 μ l, 3 ' primer 2 μ l, dNTP 2.5 μ l, 10 * Pfu damping fluid, 5 μ l, Pfu DNA polymerase 0.5 μ l, deionized water 36.5 μ l.Reaction conditions is 95 ℃ of 5min of pre-sex change; 94 ℃ of 1min of sex change; 56 ℃ of 1min anneal; 72 ℃ of 2min of renaturation; Circulate 30 times, after last circulation renaturation prolongs 8min again, be stored in 4 ℃ behind the sample.The PCR product reclaims purifying with QIAquickPCR Purification kit.
The result: 1% agarose gel electrophoresis shows Sj50 gene PCR amplified production has the about 1.1Kb of band size identical with expectation.Sj16 gene PCR amplified production has an about 440bp of stripe size conform to theoretical amplification size (Fig. 1) clearly.
The PCR product is checked order, and the result shows that the nucleotide sequence of Sj16 gene is shown in SEQ ID NO:1, and ORF is positioned at the 1-435 position, the albumen (SEQ ID NO:2) that the total length of encoding is 145aa.The nucleotide sequence of Sj50 gene such as SEQ ID NO:3, its ORF is positioned at the 12-1286 position, the albumen (SEQ ID NO:4) that the total length of encoding is 425aa.
MSDENRWIAV?FNSLDKDGNK?LLTRDEIEQC?LKSLGVSESF?AEKIIKETDL 50
NKDGKISLDE?YLKALRKIPP?RDKCSSVERW?KEVFQSIDKD?NSGKVSAKEL 100
DEFLKSTGND?INKSCLENWM?ATNDKNKDGE?LDYAEFLAYV?RQTYE 145
(SEQ?ID?NO:2)
MSETPKQSEE?EYLKDFIDLS?PSGDRGILKK?VVREGYSDIK?PCDGDTVIVH 50
YVGTNFGGEK?HGEVFDSSRA?RNEKFEFTIG?KGSVIKAWDI?GVATMRLGEV 100
CELIASPEYA?YMDGKSLKFE?VELFETMGSD?VSRNKDGSIR?KSIIKKGRDI 150
HNPVAGAEAT?IVFRNLLNLT?EETEVTYCVG?DPPSNVPDEL?DQSVRHMNTG 200
EVSRIVVYKD?GHSLTSGDSD?KDRIVYELTL?KSFEKTKHLS?GITSFPERIA 250
YANTLKEKAN?NFLKDSKFDS?AIELYKRLDD?ELQYVVANGP?TRQRNCLGFT 300
VAVQLNLALV?YLKLCKPRQC?IEFCKKVLDN?FSDNEKALFR?IGQAHLLRKD 350
HEEAVVYFKG?LYPKILTMHL?LYNRFKSVRK?RLEEPKDIER?KKFRHIFERC 400
KDTGIKLDAQ?NHEDGVVVND?EKSAL 425
(SEQ?ID?NO:4)
2.3 the structure of expression vector
The Sj50 gene, Sj16 gene and the plasmid pGEX4T-1 that reclaim purifying carry out enzyme with restriction enzyme EcoRI and Xho I respectively and cut.10 μ l templates add EcoR I 1 μ l, Xho I 1 μ l, EcoR I buffer1.5 μ l, BSA 0.5 μ l and deionized water 1 μ l, amount to 15 μ l, 37 ℃ of water-baths in 1.5ml Eppendorf pipe and spend the night.
Sj50 gene after enzyme is cut, Sj16 gene and plasmid pGEX4T-1 reclaim purifying with QIAquick PCRPurification kit.The target gene fragment of purifying and carrier endonuclease bamhi are measured the OD value, calculate fragment and carrier segments concentration, and the purpose fragment is connected by 3: 1 mol ratios with carrier segments.Contain T4 dna ligase 1 μ l, 10 * connection damping fluid 1 μ l, deionized water, pGEX4T-1 (80ng), Sj50 gene (60ng) or Sj16 gene (20ng) in the linked system, amount to 10 μ l, 12 ℃ of-14 ℃ of connections in 1.5ml Eppendorf pipe and spend the night, be built into Sj50 gene, Sj16 gene table nuclear expression recombinant plasmid pGEX4T-1-Sj50 and pGEX4T-1-Sj16.
Result: be connected with plasmid pGEX4T-1 respectively with Sj50 gene, Sj16 gene after Xho I enzyme is cut through restriction enzyme EcoR I, be built into recombinant plasmid pGEX4T-1-Sj50 and pGEX4T-1-Sj16, be transformed into amplification in the bacillus coli DH 5 alpha.With the amplification bacterium is template, and GST-5 ', GST-3 ' are obtained band and the consistent (see figure 2) of target stripe size by primer carries out pcr amplification.
2.3 the evaluation of expression vector
Change recombinant plasmid pGEX4T-1-Sj50 and pGEX4T-1-Sj16 difference transformed into escherichia coli DH5 α competent cell by electricity.1 μ l connects product and transforms 50 μ l competent cells, voltage 2KV, electric capacity 25 μ F, resistance 300 Ω, transformation time 5.43mS.Thalline after the conversion adds 1ml LB nutrient solution, and 37 ℃, behind the 250rpm shaking culture 1hr, to coat on the LB agar plate that contains penbritin, culture dish is inverted in 37 ℃ of overnight incubation.
Bacterium colony on the above-mentioned flat board of picking carries out the PCR evaluation at random.Reaction system amounts to 10 μ l, includes template 3 μ l, GST-5 ' primer 0.25 μ l, GST-3 ' primer 0.25 μ l, dNTP 0.4 μ l, 10 * Pfu buffer1 μ l, Tag archaeal dna polymerase 0.1 μ l, deionized water 5 μ l.Reaction conditions is 94 ℃ of 3min of pre-sex change; 94 ℃ of 1min of sex change; 56 ℃ of 1min anneal; 72 ℃ of 1.5min of renaturation; Circulate 30 times, after last circulation renaturation prolongs 8min again, be stored in 4 ℃ behind the sample.The PCR product detects through 1% agarose electrophoresis.
Picking Sj50 and Sj16 positive colony add the 2XYT liquid nutrient medium 5ml that contains 100 μ g/ml penbritins respectively at random, and 37 ℃ of 300rpm amplification cultivation are spent the night.With Mini-MTM Plasmid DNAExtraction System extracting and plasmid purification.Taking out plasmid is carried out EcoR I and Xho I enzyme is cut evaluation.
Result: with Mini-MTM Plasmid DNA Extraction System extracting and plasmid purification from intestinal bacteria.Taking out plasmid is carried out EcoR I and Xho I enzyme is cut evaluation.The result shows respectively two tangible bands (plasmid and goal gene are seen Fig. 3).
Embodiment 3
Sj16 and the expression of Sj50 recombination in intestinal bacteria
By calcium commentaries on classics method above extractive pGEX4T-1-Sj50 and pGEX4T-1-Sj16 recombinant plasmid transformed are gone into e. coli bl21.Including 50 μ l BL21 calcium changes adding recombinant plasmid 2 μ l in the 1.5ml Eppendorf pipe of experiencing polypeptide cell, behind the ice bath 30min, and 37 ℃ of heat-shocked 5min, ice bath 2min immediately.Every pipe adds pre-warm LB to 37 ℃ and trains liquid, after 37 ℃ of 300rpm cultivate 1hr, gets 100 μ l and coats on the LB agar plate that contains 100 μ g/ml penbritins, and culture dish is inverted in 37 ℃ of overnight incubation.
Picking Sj16 and Sj50 positive colony are inoculated in the 2XYT liquid nutrient medium that 3ml contains 100 μ g/ml penicillin Gs at random, and 37 ℃ are shaken to OD600=0.6.Get 2ml and add IPTG to final concentration 1mM, 1ml does not add inductor in contrast, and 28 ℃ of 250rpm cultivate 4hour.The 4 ℃ of centrifugal 10min precipitation of 4000g thalline.Induce the every pipe of pipe to add 100 μ l PBS, the every pipe of control tube adds 50 μ l PBS.Every pipe takes out 15 μ l thalline and adds 3 μ l, 6 * SDS-PAGE sample buffer, 2 μ l and make the SDS-PAGE electrophoresis, concentrates glue 4%, separation gel 12%.Deposition condition: concentrate glue 80V, separation gel 100V.Electrophoresis finishes glue to be fixed in Kao Shi light blue R250 dye liquor, dyes, and decolours in ethanol-Glacial acetic acid liquid.
The e. coli bl21 that result: pGEX4T-1-Sj50 and pGEX4T-1-Sj16 transform is after IPTG induces, respectively occur the band that a part amount is about 80kDa and 40kDa before inducing, be the syzygy (Fig. 4) of syzygy, Sj16 gene product and the GST of Sj50 gene product and glutathione sulfydryl transferase (GST).
Embodiment 4
The mass preparation of GST-Sj50 and GST-Sj16 fusion rotein and purifying
4.1 the mass preparation of fusion rotein
But the bacterial clone of choosing expressed fusion protein GST-Sj50 and GST-Sj16 respectively is inoculated in the 2XYT liquid nutrient medium that 5ml contains 100 μ g/ml penicillin Gs, 37 ℃ of overnight incubation.Respectively it was inoculated into the 2XYT liquid nutrient medium that 500ml contains 100 μ g/ml penicillin Gs on the 2nd day.37 ℃ are shaken to OD600=0.6, and every bottle adds IPTG is 1mM to concentration, and 4hr is cultivated in continuation, and 4 ℃ 8, the centrifugal 10min results of 000rpm bacterium is stored in-20 ℃.
In two kinds of bacterial precipitations of results, add PBS, 240 μ l 1M DTT and the 480 μ l PMSF of 20ml precooling respectively, ultrasonic degradation bacterium (each 20sec amounts to 2min).Adding 20% TritonX-100 is 1% to final concentration, and ice bath 30min dissolves fused albumen fully.4 ℃ with 13, and the centrifugal 30min of 000rpm collects supernatant liquor.
In the supernatant of 27ml, add 1ml 50% Glutathione Sepharose 4B gel slurry, put upside down mixing in conjunction with 1hr for 4 ℃.3000rpm, 4 ℃ of centrifugal 10min remove supernatant.Add 5ml PBS in precipitation, 4 ℃ of centrifugal 10min remove supernatant, and collecting precipitation repeats 3 times altogether.The precipitation of collecting is transferred in the gel column, treat that the post bed is stable after, with a large amount of unconjugated foreign proteins of PBS wash-out.In 1ml bed volume glue, add reduced glutathione solution (pH 8.0 for 10mM Glutathione, 50mM Tris-HCl) 1ml, put upside down the 10min that is mixed under the room temperature, collect the fusion rotein that elutriant is purifying.With PBS dialysis melting albumen, measure OD260, OD280 value, calculate protein concentration.
4.2 the proteic purifying of Sj16 and Sj50
Add the ratio of 0.2 μ l zymoplasm in 40 μ g albumen, add zymoplasm respectively in the GST-Sj50 of purifying and GST-Sj16 fusion rotein, room temperature is put upside down the 2hr that is mixed.Add 1ml 50%Glutathione Sepharose 4B gel slurry in the protein liquid after the zymoplasm enzyme is cut, put upside down mixing in conjunction with 1hr for 4 ℃.3000rpm, 4 ℃ of centrifugal 10min collect supernatant liquor, are the Sj16 and the Sj50 albumen of purifying.Measure OD260, OD280 value, calculate protein concentration.
The result: the fusion rotein of expression has obtained comparatively pure fusion rotein after affinity chromatography (glutathione sepharose 4B), make the zymoplasm (thrombin) from the fusion rotein of expressing, downcut GST molecule (26kDa) again, obtained Sj50 and Sj16 molecule (Fig. 5) that molecular weight is about 40kDa and 16kDa purifying respectively.
Embodiment 5
Enzyme linked immunosorbent assay
Method:
By 96 hole enzyme plates, room temperature is crossed liquid with 0.5 μ g/ml, 100 μ l Sj16 and Sj50 albumen bag.1hour is sealed for 37 ℃ with the every hole 120 μ l of 0.3% Tween-20-PBS in 0.3% Tween-20-PBS (1: 10) the washing back of dilution.Wash the people or the rabbit anteserum sample 100 μ l that add dilution in 1: 100 after 3 times, hatched 1 hour for 37 ℃.The washing back adds the goat anti-human igg's superoxide enzyme conjugates or the every hole of goat-anti rabbit superoxide enzyme conjugates 100 μ l of dilution in 1: 2000, hatches 1 hour for 37 ℃.After the washing, every hole added 100 μ l substrate OPD color development at room temperature after 15 minutes, added 2mol/L H2SO4 termination reaction.Automatically reading the OD value with the 492nm wave band on the microplate reader.Judging criterion: each OD value of being examined sample is equal to or greater than negative control OD value average and adds 2 standard deviations (x+2SD) and be decided to be positive threshold value.
5.1 the detection of the specific antibody in the sick rabbit anteserum of schistosomicide
Sj50 and Sj16 with purifying are diagnostic antigen, and it is preceding detected with the anti-Sj50 antibody and the anti-Sj16 antibody that infect in the back 9-11 week rabbit anteserum to have 17 hare infections.
Fig. 6 has shown the result of two antibody tests in the serum.Both have 1 rabbit to be positive before infection, and the specificity of detection is 94.12%.9-11 week after infection, anti-Sj50 antibody in the rabbit anteserum and anti-Sj16 antibody all have remarkable rising (P<0.05) before infecting, anti-Sj50 antibody positives in 13 rabbit bodies wherein, positive rate 76.47%, anti-Sj16 antibody positive in 15 rabbit bodies, positive rate 88.23% (table 1).
Anti-Sj50 and anti-Sj16 antibody test result in the table 1 schistosoma japonicum infection rabbit anteserum
Diagnosis OD value (the positive dividing value number positive P value of x ± SD)
Sample number
Infect before antigen infects and infect back 9-11 week (paired t-test) before infect back 9-11 week (x+2*SD)
Sj50 0.593±0.164 1.289±0.468 0.921 17 1 13 9.163E-06
Sj16 0.606±0.197 1.501±0.524 1.000 17 1 15 6.855E-06
Fig. 7 has shown anti-Sj50 antibody dynamic change in treatment group and the not treatment group rabbit anteserum.Anti-Sj50 antibody horizontal is compared significance before 11 weeks and the treatment and is descended (p=0.00080<0.05) in the treatment group rabbit anteserum after treatment, with infect before antibody horizontal compare there was no significant difference (p=0.84466>0.05).Contemporaneity, the intravital antibody of non-treatment group rabbit still maintain high level and infect 11 week of back no significance difference (p=0.70445>0.05).Compare between treatment group and non-treatment group group, before infection with infect in back 9-11 week two groups of rabbit anteserums all there was no significant difference (p=0.15183 before infecting>0.05 of anti-Sj50 antibody horizontal, infect back p=0.32546>0.05) and treatment 11 weeks of back, treatment group rabbit internal antibody level is far below not treatment group of contemporaneity (p=0.00089<0.05) (table 2).
The dynamic change of anti-Sj50 antibody in the table 2 schistosoma japonicum infection rabbit anteserum
The OD value
The group sample number infects all number P values (t check)
(x±SD)
Infect preceding 0.653 ± 0.111 0.70445 (it is relatively all with 11 that not treatment group infects 21 weeks of back)
11 weeks 1.415 ± 0.552 0.00344 after not treatment group 8 infects (21 weeks of not treatment group infection back are relatively preceding with infection)
Infect 21 weeks 1.456 of back ± 0.486 0.00080 (21 weeks of treatment group infection back compared with 9 weeks)
Infect preceding 0.539 ± 0.190 0.84466 (21 weeks of treatment group infection back are relatively preceding with infection)
Infect 9 weeks 1.177 of back ± 0.377 0.15183 (treatment group and not treatment group are relatively before infecting)
Treatment group 9
21 weeks 0.32546 after infecting (infecting back 9-11 week treatment group compares with not treatment group)
0.547±0.150
(treatment 11 weeks of back) 0.00089 (infecting back 21 all treatment groups and not treatment group relatively)
Fig. 8 has shown anti-Sj16 antibody dynamic change in treatment group and the not treatment group rabbit anteserum.Identical with anti-Sj50 antibody, anti-Sj 16 antibody horizontals 11 all significancees after treatment descend (p=0.00171<0.05) in the treatment group rabbit anteserum, compare there was no significant difference (p=0.104242>0.05) with antibody horizontal before the infection.Contemporaneity, the intravital antibody of non-treatment group rabbit still maintain high level and infect 11 week of back no significance difference (p=0.865405>0.05).Compare between treatment group and non-treatment group group, before infection with infect anti-Sj16 antibody horizontal person there was no significant difference (p=0.56034 before infecting>0.05 in back 9-11 week two groups of rabbit anteserums, infect back p=0.58679>0.05), and treatment 11 weeks of back, treatment group rabbit internal antibody level is far below not treatment group of contemporaneity (p=0.00834<0.05) (table 3).
The dynamic change of anti-Sj16 antibody in the table 3 schistosoma japonicum infection rabbit anteserum
The OD value
The group sample number infects all number P values (t check)
(x±SD)
Infect preceding 0.576 ± 0.108 0.86541 (it is relatively all with 11 that not treatment group infects 21 weeks of back)
Do not control
11 weeks 1.423 ± 0.612 0.00277 after 8 infection (21 weeks of not treatment group infection back and infection are relatively preceding)
The treatment group
Infect 21 weeks 1.443 of back ± 0.532 0.00171 (21 weeks of treatment group infection back compared with 9 weeks)
Infect preceding 0.633 ± 0.263 0.10424 (21 weeks of treatment group infection back are relatively preceding with infection)
Infect 9 weeks 1.570 of back ± 0.457 0.56034 (treatment group and not treatment group are relatively before infecting)
Treatment group 9
21 weeks 0.58679 after infecting (infecting back 9-11 week treatment group compares with not treatment group)
0.766±0.215
(treatment 11 weeks of back) 0.00834 (infecting back 21 all treatment groups and not treatment group relatively)
5.2 the detection of specific antibody in the acute and chronic schistosomicide human serum
Sj50 and Sj16 antigen are used for schistosomicide human serum detection of antibodies, the results are shown in Figure 9 and table 4.
Among table 4 normal people and the acute and chronic Schistosoma japonicum patients serum
Anti-Sj50 antibody and anti-Sj16 antibody test result
Positive threshold value number positive
Diagnosis group OD value (the sample number P value (t of group check) of x ± SD)
(x+2*SD) (positive rate %)
Antigen
Normal people 0.2826 ± 0.0815 58 1 (1.7%) 7.20E-26 are normal-anxious blood)
Sj50 acute schistosomiasis people 0.7614 ± 0.2244 0.4457 62 59 (95.2%) 5.42E-14 (normal-slow blood)
Chronic schistosomiasis people 0.5571 ± 0.2078 57 36 (63.2%) 1.04E-06 (anxious blood-slow blood)
Normal people 0.2824 ± 0.078 58 1 (1.7%) 7.28E-17 (normal-anxious blood)
Sj16 acute schistosomiasis people 0.6421 ± 0.2491 0.4389 62 53 (85.5%) 2.94E-15 (normal-slow blood)
Chronic schistosomiasis people 0.5806 ± 0.2104 57 40 (70.2%) 0.14701 (anxious blood-slow blood)
Two diagnostic antigens respectively have 1 part of sample to be positive false positive rate 1.7% in 58 parts of normal human serum samples.Show for the detected result of 62 serum of acute schistosomicide patient, in 59 patient's bodies, look into and see that anti-Sj50 antibody, positive rate are 95.2% to be higher than the positive rate 85.5% (53/62) of anti-Sj16 antibody test.Anti-Sj50 antibody and anti-Sj16 detection of antibodies rate all are lower than the acute schistosomiasis people in the chronic schistosomiasis human serum, and the susceptibility of wherein anti-Sj50 detection of antibodies is 63.2% (36/57), and the susceptibility of anti-Sj16 antibody test is 70.2% (40/57).After detected result carried out statistical analysis, it is diagnostic antigen that the inventor finds with Sj50, between acute and chronic schistosomiasis people antibody test result significant difference (P=1.04E-06<0.05) is arranged, Sj16 antigen then can't be distinguished acute and chronic infection (P=0.14701>0.05).
Discuss
In the present invention, the inventor has isolated Schistosoma japonicum antibody Protein S j50 and calcium binding protein Sj16, and also recombinant expressed Schistosoma japonicum antibody Protein S j50 and calcium binding protein Sj16 also use it for the detection of schistosome antibody.For the diagnosis of schistosomiasis japanica, in infection animal serum and human serum detection, all obtained comparatively ideal results.
In order to seek new schistosomiasis japanica diagnostic antigen, the inventor has carried out the order-checking of extensive ESTs (expressed sequence tag) to Schistosoma japonicum continent strain adult cDNA library.Obtained the ESTs that several and Smp50 have higher homology in analyzing the process of expressed sequence tag, the inventor carries out electronic splicing with these ESTs, has obtained the complete encoding sequence of Schistosoma japonicum Sjp50 gene.Carry out homology relatively with nt and nr storehouse among the GenBank, find and (the Schistosoma japonicum immunophilin-like mRNA sequence of the antibody gene order from the strain of Schistosoma japonicum Philippines, AF175126) the Nucleotide consistence is up to 94%, but do not see the pertinent literature report; And with the antibody gene order Nucleotide consistence 84% of Sm, the amino acid consistence is 71%.
Because Sjp50 and the consistence of Smp50 on the nucleotide level amino acid levels have reached 71%, the inventor thinks that they also have similar function probably.The P50 that studies show that of Smp50 belongs to FK506 conjugated protein (antibody) superfamily, with structural similitude such as the plain P59 of heat-shocked binding immunoassay, has the PPIase activity, can help intravital albumen assembling of schistosomicide and protein folding, and can interact with heat shock protein 90, constitute the composition of steroid hormone receptor mixture together.Known host's hormone is to the bilharzial regulating effect of having grown, but up to the present, people as yet not direct evidence show have steroid hormone receptor to exist in the schistosomicide body.And the existence of Sjp50 and Smp50 may provide some supports to the checking steroid receptor.Studies show that in the past, P50 can be discerned by Schistosoma mansoni solubility extract and epidermis extract, illustrate that Smp50 may be present in epidermis, and the antiserum(antisera) of anti-P50 can not be discerned Hela cell and colibacillary extract, on general structure many similaritys are arranged though the FKBP that derives from different plant species is described, the difference on entire infrastructure and sequence is enough to produce different antibody responses.These experimental result promptings, Sjp50 can be used as the potential diagnosis and the vaccine target spot is further studied.
The inventor Sj16 that recombinated in this experiment, and use it for the diagnosis of schistosomiasis japanica has obtained comparatively ideal results in infection animal serum and human serum detect.
The SME16 gene of Sj16 and Schistosoma mansoni has higher homology.SME16 is considered to special calcium binding protein of worm's ovum stage, but its function in worm's ovum it be unclear that.Moser in 1992 at in-vitro recombination expression a kind of calcium binding protein Sm16 (SME16) in the Schistosoma mansoni worm's ovum, this albumen can be the identification of immunize rabbit serum, is considered to a kind of diagnostic antigen of tool potentiality.Thereafter the Sm16 that discovers of Rao has anti-infectious effect, is that a kind of rabbit epidemic disease is regulated albumen and played an important role in bilharzial immune evasion, and recombinant expressed Sm16 has the intensive immunocompetence and can be polyclonal immunize rabbit serum and discern.It should be noted that, calcium binding protein is the protein family that cellular activity is regulated in the important participation of a class, this proteinoid changes with making latter's occurred conformation after target protein combines, thereby excite a series of biologicallies, as [Silva AC, Reinach FC.Calcium binding inducesconformational changes in muscle regulatory proteins.Trends BiochemSci 1991 such as Muscle contraction, neurotransmitter release, enzyme activation and cell growths; 16 (2): 53-7].In view of the high expression level of SME16 in worm's ovum and the important physiological function of calcium binding protein, have reason to think that SME16 must bring into play important and unique effect in regulating worm's ovum cellular activity process.Ironically SME16 and virgin worm, the special calcium binding protein sm20[AvercroftJC of adult, Huggins MC, Dunne DW, et al.Characterisation of Sm20, a 20-kilodaltoncalcium-binding protein of Schistosoma manoni.Mol Biochem Parasitol1990; 38 (2): 211-9] and special 8-KDa calcium binding protein [the Am D of cercaria, Grossman Z, Markovics A, et al.Rapid changes in the expression of a gene encoding a calciumbinding protein in Schistosoma mansoni.Mol Biochem Parasitol1989; 34 (2): 167-75] except having similar calcium binding site, do not have tangible homology each other.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
<110〉Nanfang Research Centre, State Human Gene Group
Prevention ﹠ Control Station of Parasitic Disease, China Diseases Prevention ﹠ C
Preclinical medicine institute of Shanghai Second Emdical University
<120〉specific antigens of Schistosoma japonicum and purposes
<130> 027623
<160> 8
<170> PatentIn?version?3.1
<210> 1
<211> 438
<212> DNA
<213〉Schistosoma japonicum (Schistosoma japonicum)
<220>
<221> CDS
<222> (1)..(435)
<223>
<400> 1
atg?tcg?gat?gaa?aac?cga?tgg?att?gca?gtt?ttt?aat?tca?cta?gat?aaa 48
Met?Ser?Asp?Glu?Asn?Arg?Trp?Ile?Ala?Val?Phe?Asn?Ser?Leu?Asp?Lys
1 5 10 15
gat?gga?aat?aag?tta?tta?aca?cgt?gat?gaa?att?gag?caa?tgc?ttg?aaa 96
Asp?Gly?Asn?Lys?Leu?Leu?Thr?Arg?Asp?Glu?Ile?Glu?Gln?Cys?Leu?Lys
20 25 30
agt?ctt?ggc?gtt?tct?gaa?agt?ttt?gcc?gaa?aag?ata?atc?aag?gaa?act 144
Ser?Leu?Gly?Val?Ser?Glu?Ser?Phe?Ala?Glu?Lys?Ile?Ile?Lys?Glu?Thr
35 40 45
gac?ttg?aat?aaa?gat?gga?aaa?atc?tct?ttg?gat?gaa?tac?ctg?aaa?gca 192
Asp?Leu?Asn?Lys?Asp?Gly?Lys?Ile?Ser?Leu?Asp?Glu?Tyr?Leu?Lys?Ala
50 55 60
cta?aga?aaa?atc?cct?cca?cgt?gac?aaa?tgt?tca?agt?gtt?gaa?cgt?tgg 240
Leu?Arg?Lys?Ile?Pro?Pro?Arg?Asp?Lys?Cys?Ser?Ser?Val?Glu?Arg?Trp
65 70 75 80
aaa?gaa?gta?ttt?caa?tcc?ata?gat?aaa?gat?aat?tca?ggc?aaa?gtt?tct 288
Lys?Glu?Val?Phe?Gln?Ser?Ile?Asp?Lys?Asp?Asn?Ser?Gly?Lys?Val?Ser
85 90 95
gct?aaa?gaa?ctg?gac?gaa?ttt?ttg?aaa?tca?act?ggt?aat?gat?ata?aac 336
Ala?Lys?Glu?Leu?Asp?Glu?Phe?Leu?Lys?Ser?Thr?Gly?Asn?Asp?Ile?Asn
100 105 110
aaa?agc?tgt?ttg?gaa?aat?tgg?atg?gct?aca?aat?gac?aaa?aac?aag?gat 384
Lys?Ser?Cys?Leu?Glu?Asn?Trp?Met?Ala?Thr?Asn?Asp?Lys?Asn?Lys?Asp
115 120 125
ggt?gaa?cta?gat?tat?gcc?gaa?ttt?tta?gct?tat?gta?cgt?caa?acg?tat 432
Gly?Glu?Leu?Asp?Tyr?Ala?Glu?Phe?Leu?Ala?Tyr?Val?Arg?Gln?Thr?Tyr
130 135 140
gaa?taa 438
Glu
145
<210> 2
<211> 145
<212> PRT
<213〉Schistosoma japonicum (Schistosoma japonicum)
<400> 2
Met?Ser?Asp?Glu?Asn?Arg?Trp?Ile?Ala?Val?Phe?Asn?Ser?Leu?Asp?Lys
1 5 10 15
Asp?Gly?Asn?Lys?Leu?Leu?Thr?Arg?Asp?Glu?Ile?Glu?Gln?Cys?Leu?Lys
20 25 30
Ser?Leu?Gly?Val?Ser?Glu?Ser?Phe?Ala?Glu?Lys?Ile?Ile?Lys?Glu?Thr
35 40 45
Asp?Leu?Asn?Lys?Asp?Gly?Lys?Ile?Ser?Leu?Asp?Glu?Tyr?Leu?Lys?Ala
50 55 60
Leu?Arg?Lys?Ile?Pro?Pro?Arg?Asp?Lys?Cys?Ser?Ser?Val?Glu?Arg?Trp
65 70 75 80
Lys?Glu?Val?Phe?Gln?Ser?Ile?Asp?Lys?Asp?Asn?Ser?Gly?Lys?Val?Ser
85 90 95
Ala?Lys?Glu?Leu?Asp?Glu?Phe?Leu?Lys?Ser?Thr?Gly?Asn?Asp?Ile?Asn
100 105 110
Lys?Ser?Cys?Leu?Glu?Asn?Trp?Met?Ala?Thr?Asn?Asp?Lys?Asn?Lys?Asp
115 120 125
Gly?Glu?Leu?Asp?Tyr?Ala?Glu?Phe?Leu?Ala?Tyr?Val?Arg?Gln?Thr?Tyr
130 135 140
Glu
145
<210> 3
<211> 1413
<212> DNA
<213〉Schistosoma japonicum (Schistosoma japonicum)
<220>
<221> CDS
<222> (12)..(1286)
<223>
<400> 3
acgcagttga?c?atg?tcg?gag?acg?cca?aag?cag?tct?gaa?gag?gaa?tat?cta 50
Met?Ser?Glu?Thr?Pro?Lys?Gln?Ser?Glu?Glu?Glu?Tyr?Leu
1 5 10
aaa?gat?ttc?ata?gac?tta?agc?cca?tct?ggt?gat?cgt?ggt?att?ctc?aag 98
Lys?Asp?Phe?Ile?Asp?Leu?Ser?Pro?Ser?Gly?Asp?Arg?Gly?Ile?Leu?Lys
15 20 25
aaa?gta?gta?cga?gaa?ggc?tac?tcg?gac?atc?aaa?cca?tgc?gat?ggt?gac 146
Lys?Val?Val?Arg?Glu?Gly?Tyr?Ser?Asp?Ile?Lys?Pro?Cys?Asp?Gly?Asp
30 35 40 45
acg?gtc?ata?gta?cat?tat?gtc?ggt?act?aac?ttc?ggt?ggt?gaa?aag?cat 194
Thr?Val?Ile?Val?His?Tyr?Val?Gly?Thr?Asn?Phe?Gly?Gly?Glu?Lys?His
50 55 60
ggt?gaa?gta?ttc?gac?tca?agc?aga?gcc?cga?aat?gaa?aag?ttt?gaa?ttt 242
Gly?Glu?Val?Phe?Asp?Ser?Ser?Arg?Ala?Arg?Asn?Glu?Lys?Phe?Glu?Phe
65 70 75
aca?att?ggg?aaa?ggt?agt?gta?att?aaa?gct?tgg?gat?atc?ggt?gtt?gca 290
Thr?Ile?Gly?Lys?Gly?Ser?Val?Ile?Lys?Ala?Trp?Asp?Ile?Gly?Val?Ala
80 85 90
act?atg?agg?ttg?gga?gaa?gtt?tgt?gaa?ttg?atc?gcg?tcg?cct?gaa?tat 338
Thr?Met?Arg?Leu?Gly?Glu?Val?Cys?Glu?Leu?Ile?Ala?Ser?Pro?Glu?Tyr
95 100 105
gcg?tac?atg?gat?ggg?aaa?tct?ctt?aag?ttt?gag?gtg?gag?ctt?ttt?gaa 386
Ala?Tyr?Met?Asp?Gly?Lys?Ser?Leu?Lys?Phe?Glu?Val?Glu?Leu?Phe?Glu
110 115 120 125
act?atg?ggc?tct?gat?gtc?agc?aga?aac?aaa?gat?ggg?agt?att?cgc?aag 434
Thr?Met?Gly?Ser?Asp?Val?Ser?Arg?Asn?Lys?Asp?Gly?Ser?Ile?Arg?Lys
130 135 140
tca?att?att?aaa?aag?gga?aga?gat?atc?cac?aat?cct?gta?gct?ggg?gct 482
Ser?Ile?Ile?Lys?Lys?Gly?Arg?Asp?Ile?His?Asn?Pro?Val?Ala?Gly?Ala
145 150 155
gaa?gcc?act?att?gtt?ttc?cgc?aat?ctt?ttg?aac?ttg?acg?gag?gaa?aca 530
Glu?Ala?Thr?Ile?Val?Phe?Arg?Asn?Leu?Leu?Asn?Leu?Thr?Glu?Glu?Thr
160 165 170
gaa?gtc?aca?tat?tgt?gtt?ggc?gac?cct?cca?tca?aac?gta?ccg?gat?gag 578
Glu?Val?Thr?Tyr?Cys?Val?Gly?Asp?Pro?Pro?Ser?Asn?Val?Pro?Asp?Glu
175 180 185
ttg?gac?caa?tct?gtt?cgt?cac?atg?aat?aca?ggt?gaa?gtc?agc?cgt?att 626
Leu?Asp?Gln?Ser?Val?Arg?His?Met?Asn?Thr?Gly?Glu?Val?Ser?Arg?Ile
190 195 200 205
gtg?gtt?tac?aaa?gac?ggt?cat?tca?tta?act?tct?gga?gat?tcg?gat?aaa 674
Val?Val?Tyr?Lys?Asp?Gly?His?Ser?Leu?Thr?Ser?Gly?Asp?Ser?Asp?Lys
210 215 220
gat?aga?ata?gtt?tac?gaa?cta?aca?ctg?aag?tct?ttt?gaa?aag?acc?aaa 722
Asp?Arg?Ile?Val?Tyr?Glu?Leu?Thr?Leu?Lys?Ser?Phe?Glu?Lys?Thr?Lys
225 230 235
cac?ctc?tct?ggt?att?acg?tct?ttt?cca?gag?cga?ata?gcc?tat?gca?aat 770
His?Leu?Ser?Gly?Ile?Thr?Ser?Phe?Pro?Glu?Arg?Ile?Ala?Tyr?Ala?Asn
240 245 250
aca?ctt?aaa?gag?aag?gcc?aac?aat?ttc?tta?aag?gat?tct?aaa?ttt?gat 818
Thr?Leu?Lys?Glu?Lys?Ala?Asn?Asn?Phe?Leu?Lys?Asp?Ser?Lys?Phe?Asp
255 260 265
tca?gct?atc?gaa?tta?tat?aaa?cgt?ttg?gac?gat?gag?ctg?cag?tac?gta 866
Ser?Ala?Ile?Glu?Leu?Tyr?Lys?Arg?Leu?Asp?Asp?Glu?Leu?Gln?Tyr?Val
270 275 280 285
gtg?gct?aat?ggg?cct?acc?aga?caa?agg?aat?tgt?ctg?ggg?ttc?act?gta 914
Val?Ala?Asn?Gly?Pro?Thr?Arg?Gln?Arg?Asn?Cys?Leu?Gly?Phe?Thr?Val
290 295 300
gct?gtc?caa?ctc?aat?tta?gct?ctg?gtc?tat?ctg?aag?ctt?tgt?aaa?ccc 962
Ala?Val?Gln?Leu?Asn?Leu?Ala?Leu?Val?Tyr?Leu?Lys?Leu?Cys?Lys?Pro
305 310 315
aga?caa?tgt?att?gag?ttt?tgc?aag?aaa?gtg?ctc?gat?aat?ttt?agc?gac 1010
Arg?Gln?Cys?Ile?Glu?Phe?Cys?Lys?Lys?Val?Leu?Asp?Asn?Phe?Ser?Asp
320 325 330
aac?gaa?aag?gcg?cta?ttt?aga?att?ggt?cag?gca?cat?tta?cta?cgt?aag 1058
Asn?Glu?Lys?Ala?Leu?Phe?Arg?Ile?Gly?Gln?Ala?His?Leu?Leu?Arg?Lys
335 340 345
gac?cat?gaa?gaa?gca?gtt?gtt?tac?ttc?aaa?gga?ttg?tat?cca?aaa?atc 1106
Asp?His?Glu?Glu?Ala?Val?Val?Tyr?Phe?Lys?Gly?Leu?Tyr?Pro?Lys?Ile
350 355 360 365
cta?aca?atg?cat?ctg?ctg?tat?aac?agg?ttc?aaa?tct?gtg?agg?aag?aga 1154
Leu?Thr?Met?His?Leu?Leu?Tyr?Asn?Arg?Phe?Lys?Ser?Val?Arg?Lys?Arg
370 375 380
tta?gaa?gag?cca?aaa?gat?ata?gaa?cga?aag?aag?ttt?cgt?cat?att?ttc 1202
Leu?Glu?Glu?Pro?Lys?Asp?Ile?Glu?Arg?Lys?Lys?Phe?Arg?His?Ile?Phe
385 390 395
gaa?cgt?tgt?aaa?gac?acc?ggg?att?aaa?ctc?gat?gct?caa?aat?cat?gag 1250
Glu?Arg?Cys?Lys?Asp?Thr?Gly?Ile?Lys?Leu?Asp?Ala?Gln?Asn?His?Glu
400 405 410
gat?ggg?gtt?gta?gtg?aat?gat?gaa?aag?tct?gcc?ctg?tgagagctta 1296
Asp?Gly?Val?Val?Val?Asn?Asp?Glu?Lys?Ser?Ala?Leu
415 420 425
attctgtgtg?tggcatgaag?ttagcacccc?cgtgattttg?taaatgtttc?ttataattac 1356
tggtttaatt?tcaagttgct?gaatacattt?taaagcaacc?aaaaaaaaaa?aaaaaaa 1413
<210> 4
<211> 425
<212> PRT
<213〉Schistosoma japonicum (Schistosoma japonicum)
<400> 4
Met?Ser?Glu?Thr?Pro?Lys?Gln?Ser?Glu?Glu?Glu?Tyr?Leu?Lys?Asp?Phe
1 5 10 15
Ile?Asp?Leu?Ser?Pro?Ser?Gly?Asp?Arg?Gly?Ile?Leu?Lys?Lys?Val?Val
20 25 30
Arg?Glu?Gly?Tyr?Ser?Asp?Ile?Lys?Pro?Cys?Asp?Gly?Asp?Thr?Val?Ile
35 40 45
Val?His?Tyr?Val?Gly?Thr?Asn?Phe?Gly?Gly?Glu?Lys?His?Gly?Glu?Val
50 55 60
Phe?Asp?Ser?Ser?Arg?Ala?Arg?Asn?Glu?Lys?Phe?Glu?Phe?Thr?Ile?Gly
65 70 75 80
Lys?Gly?Ser?Val?Ile?Lys?Ala?Trp?Asp?Ile?Gly?Val?Ala?Thr?Met?Arg
85 90 95
Leu?Gly?Glu?Val?Cys?Glu?Leu?Ile?Ala?Ser?Pro?Glu?Tyr?Ala?Tyr?Met
100 105 110
Asp?Gly?Lys?Ser?Leu?Lys?Phe?Glu?Val?Glu?Leu?Phe?Glu?Thr?Met?Gly
115 120 125
Ser?Asp?Val?Ser?Arg?Asn?Lys?Asp?Gly?Ser?Ile?Arg?Lys?Ser?Ile?Ile
130 135 140
Lys?Lys?Gly?Arg?Asp?Ile?His?Asn?Pro?Val?Ala?Gly?Ala?Glu?Ala?Thr
145 150 155 160
Ile?Val?Phe?Arg?Asn?Leu?Leu?Asn?Leu?Thr?Glu?Glu?Thr?Glu?Val?Thr
165 170 175
Tyr?Cys?Val?Gly?Asp?Pro?Pro?Ser?Asn?Val?Pro?Asp?Glu?Leu?Asp?Gln
180 185 190
Ser?Val?Arg?His?Met?Asn?Thr?Gly?Glu?Val?Ser?Arg?Ile?Val?Val?Tyr
195 200 205
Lys?Asp?Gly?His?Ser?Leu?Thr?Ser?Gly?Asp?Ser?Asp?Lys?Asp?Arg?Ile
210 215 220
Val?Tyr?Glu?Leu?Thr?Leu?Lys?Ser?Phe?Glu?Lys?Thr?Lys?His?Leu?Ser
225 230 235 240
Gly?Ile?Thr?Ser?Phe?Pro?Glu?Arg?Ile?Ala?Tyr?Ala?Asn?Thr?Leu?Lys
245 250 255
Glu?Lys?Ala?Asn?Asn?Phe?Leu?Lys?Asp?Ser?Lys?Phe?Asp?Ser?Ala?Ile
260 265 270
Glu?Leu?Tyr?Lys?Arg?Leu?Asp?Asp?Glu?Leu?Gln?Tyr?Val?Val?Ala?Asn
275 280 285
Gly?Pro?Thr?Arg?Gln?Arg?Asn?Cys?Leu?Gly?Phe?Thr?Val?Ala?Val?Gln
290 295 300
Leu?Asn?Leu?Ala?Leu?Val?Tyr?Leu?Lys?Leu?Cys?Lys?Pro?Arg?Gln?Cys
305 310 315 320
Ile?Glu?Phe?Cys?Lys?Lys?Val?Leu?Asp?Asn?Phe?Ser?Asp?Asn?Glu?Lys
325 330 335
Ala?Leu?Phe?Arg?Ile?Gly?Gln?Ala?His?Leu?Leu?Arg?Lys?Asp?His?Glu
340 345 350
Glu?Ala?Val?Val?Tyr?Phe?Lys?Gly?Leu?Tyr?Pro?Lys?Ile?Leu?Thr?Met
355 360 365
His?Leu?Leu?Tyr?Asn?Arg?Phe?Lys?Ser?Val?Arg?Lys?Arg?Leu?Glu?Glu
370 375 380
Pro?Lys?Asp?Ile?Glu?Arg?Lys?Lys?Phe?Arg?His?Ile?Phe?Glu?Arg?Cys
385 390 395 400
Lys?Asp?Thr?Gly?Ile?Lys?Leu?Asp?Ala?Gln?Asn?His?Glu?Asp?Gly?Val
405 410 415
Val?Val?Asn?Asp?Glu?Lys?Ser?Ala?Leu
420 425
<210> 5
<211> 28
<212> DNA
<213〉artificial sequence
<220>
<221> misc_feature
<222> (1)..(28)
<223〉primer
<400> 5
ccggaattca?tgtcggagac?gccaaagc 28
<210> 6
<211> 32
<212> DNA
<213〉artificial sequence
<220>
<221> misc_feature
<222> (1)..(32)
<223〉primer
<400> 6
ccgctcgagc?agaattaagc?tctcacaggg?ca 32
<210> 7
<211> 32
<212> DNA
<213〉artificial sequence
<220>
<221> misc_feature
<222> (1)..(32)
<223〉primer
<400> 7
ccggaattcc?ttcatctcag?aataatgtcg?ga 32
<210> 8
<211> 32
<212> DNA
<213〉artificial sequence
<220>
<221> misc_feature
<222> (1)..(32)
<223〉primer
<400> 8
ccgctcgagc?atacgtttga?cgtacataag?ct 32

Claims (10)

1. isolating albumen, it is the Schistosoma japonicum specific antigens, it is characterized in that, it is selected from down group:
(a) has the albumen of aminoacid sequence shown in the SEQ ID NO:2;
(b) one or more amino acid whose displacements, disappearance or insertion take place by the albumen of (a) and form have immunogenic albumen at Schistosoma japonicum.
2. albumen as claimed in claim 1 is characterized in that, it has the aminoacid sequence shown in the SEQ ID NO:2.
3. isolating polynucleotide is characterized in that, the described albumen of its coding claim 1.
4. polynucleotide as claimed in claim 3 is characterized in that, it is selected from down group:
(a) nucleotide sequence of 1-438 position among the SEQ ID NO:1;
(b) nucleotide sequence of 1-435 position among the SEQ ID NO:1.
5. a carrier is characterized in that, it contains the described polynucleotide of claim 3.
6. a host cell is characterized in that, it contains the described carrier of claim 5.
7. the preparation method of a Schistosoma japonicum immunogenic protein is characterized in that, this method comprises:
(a) under expression condition, cultivate the described host cell of claim 6;
(b) from culture, isolate the albumen that contains aminoacid sequence shown in the SEQ ID NO:2.
8. energy and the described protein-specific bonded of claim 1 antibody.
9. whether there is the method for anti schistosoma antibody in the test sample, it is characterized in that, comprising:
The described antibody of sample and claim 9 is contacted,
Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample anti schistosoma antibody.
10. a test kit that detects antibody of Schistosoma japonicum is characterized in that, it contains described albumen of claim 1 and specification sheets.
CN 200310109397 2003-12-15 2003-12-15 Specific antigen of Japanese blood fluke and its use Pending CN1629189A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 200310109397 CN1629189A (en) 2003-12-15 2003-12-15 Specific antigen of Japanese blood fluke and its use

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 200310109397 CN1629189A (en) 2003-12-15 2003-12-15 Specific antigen of Japanese blood fluke and its use

Publications (1)

Publication Number Publication Date
CN1629189A true CN1629189A (en) 2005-06-22

Family

ID=34843047

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 200310109397 Pending CN1629189A (en) 2003-12-15 2003-12-15 Specific antigen of Japanese blood fluke and its use

Country Status (1)

Country Link
CN (1) CN1629189A (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101570573B (en) * 2008-04-30 2013-04-24 中国疾病预防控制中心寄生虫病预防控制所 Method and reagent kit for diagnosing Japanese schistosomiasis
CN103197059A (en) * 2013-04-07 2013-07-10 中国科学院上海应用物理研究所 Schistosomiasis electrochemistry sensing quick determination kit, detection method and preparation method of kit
CN105315368A (en) * 2015-11-17 2016-02-10 南京医科大学 Anti-schistosoma japonicum Sj16 molecule monoclonal antibody and preparation method thereof
CN109060972A (en) * 2018-05-16 2018-12-21 苏州药明泽康生物科技有限公司 Application of the rabbit blood in preparation human disease's external diagnosis reagent case
CN115043922A (en) * 2022-03-30 2022-09-13 中国医学科学院病原生物学研究所 Schistosoma japonicum antigen protein rSjScP57 and application thereof

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101570573B (en) * 2008-04-30 2013-04-24 中国疾病预防控制中心寄生虫病预防控制所 Method and reagent kit for diagnosing Japanese schistosomiasis
CN103197059A (en) * 2013-04-07 2013-07-10 中国科学院上海应用物理研究所 Schistosomiasis electrochemistry sensing quick determination kit, detection method and preparation method of kit
CN105315368A (en) * 2015-11-17 2016-02-10 南京医科大学 Anti-schistosoma japonicum Sj16 molecule monoclonal antibody and preparation method thereof
CN105315368B (en) * 2015-11-17 2021-10-26 南京医科大学 Anti-schistosoma japonicum Sj16 molecular monoclonal antibody and preparation method thereof
CN109060972A (en) * 2018-05-16 2018-12-21 苏州药明泽康生物科技有限公司 Application of the rabbit blood in preparation human disease's external diagnosis reagent case
CN109060972B (en) * 2018-05-16 2021-09-24 苏州药明泽康生物科技有限公司 Application of rabbit blood in preparing human disease in-vitro diagnosis kit
CN115043922A (en) * 2022-03-30 2022-09-13 中国医学科学院病原生物学研究所 Schistosoma japonicum antigen protein rSjScP57 and application thereof
CN115043922B (en) * 2022-03-30 2023-09-15 中国医学科学院病原生物学研究所 Japanese blood fluke antigen protein rSjScP57 and application thereof

Similar Documents

Publication Publication Date Title
CN101031647A (en) Process for producing erysipelothrix rhusiopathiae surface protective antigen mutant in escherichia coli
CN101065398A (en) Peptides and APL-type derivatives of hsp60 and pharmaceutical compositions
CN1629188A (en) Specific antigen of Japanese blood fluke and its use
CN1255540C (en) Vaccine-induced hepatitis B viral strain and uses thereof
CN1629189A (en) Specific antigen of Japanese blood fluke and its use
CN1714153A (en) Recombinant protein variants
CN1531548A (en) Chimeric chains that code for proteins that induce effects directed against viruses
CN1618804A (en) Paddy rice potassium, sodium ion transport gene and its application
CN1648135A (en) Transduction peptide-humanized chloine acetylase fusion protein and its use
CN1526017A (en) Gene associated with leishmania parasite virulence
CN1864746A (en) Gene engineered poly-valence subunit vaccine of Hp AhpC and preparation method thereof
CN1258317A (en) Process for expression of genes of dengue viruses
CN1948335A (en) Candida albicans mycellium regulating and controlling factor gene and its use
CN1303102C (en) Method for diagnosing and curing alopecia utilizing the Rhor gene of human and rat and the encoding products
CN1736479A (en) Prevention, treatment and detection of pig progressive atrophic rhinitis
CN1769436A (en) Nanjing bass 3-hydroxyl-3-methyl glutaryl coenzyme A reductase protein encoding sequence
CN1948334A (en) Candida albicans cell wall adhesion factor gene and its use
CN1159333C (en) Trichina antigen gene Ts 87 and use thereof
CN1616663A (en) O type foot and mouth disease virus DNA vaccine and its preparing method
CN100341891C (en) Tanscription activating factor genes of candida albicans and their use
CN1281962C (en) Tumor relevant secretory protein as a liver cancer marker and uses thereof
CN1241941C (en) Protein for promoting nerve differentiation and resisting cell death, and its coding gene
CN1760363A (en) Coded sequence of reductase enzyme protein of eucommia 3-hydroxy-3-coenzyme of methyl glutaryl A
CN101036790A (en) Protein genetic vaccines on the surface of mutans streptococci and its preparing method
CN1749397A (en) Bi-recombinant active carrier vaccine of co-expression pig gyrate virus and foot and mouth disease virus

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C12 Rejection of a patent application after its publication
RJ01 Rejection of invention patent application after publication