CN1882604A - Genetic markers for obesity - Google Patents

Genetic markers for obesity Download PDF

Info

Publication number
CN1882604A
CN1882604A CN 200480034302 CN200480034302A CN1882604A CN 1882604 A CN1882604 A CN 1882604A CN 200480034302 CN200480034302 CN 200480034302 CN 200480034302 A CN200480034302 A CN 200480034302A CN 1882604 A CN1882604 A CN 1882604A
Authority
CN
China
Prior art keywords
obesity
plin6
plin5
plin4
plin1
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN 200480034302
Other languages
Chinese (zh)
Other versions
CN100471863C (en
Inventor
J·M·奥尔多瓦斯
L·齐
A·格林伯格
D·科尔拉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tufts University
Original Assignee
Tufts University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tufts University filed Critical Tufts University
Publication of CN1882604A publication Critical patent/CN1882604A/en
Application granted granted Critical
Publication of CN100471863C publication Critical patent/CN100471863C/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Abstract

The present invention is directed to new genetic variants or polymorphisms at the perilipin locus (PLIN) including PLIN1: 6209T (allele 1) >C (allele 2); PLIN3 10171 (allele 1) A >T (allele 2); PLIN4: 11482G (allele 1) >A (allele 2); PLIN5: 13041A (allele 1) >G (allele 2) and PLIN6: 14995A (allele 1) >T (allele 2), and their use in diagnostic and prognostic applications for obesity and and obesity-related diseases, such as metabolic syndrome and cardiovascular disease.

Description

The genetic marker of obesity
Cross reference
The interests of the U.S. Provisional Application that the U.S. Provisional Application that the application requires to submit on September 22nd, 2003 U.S. Provisional Application is submitted to number on November 12nd, 60/504,830,2003 is submitted to number on February 13rd, 60/519,109 and 2004 number 60/544,524.
Government supports
The present invention is subjected to the NIH/NHLBI subsidy HL 54776 of USDA (U.S.Department of Agriculture) and the support of contract 53-K06-5-10 and 58-1950-9-001.United States Government has its certain right.
Background
During evolution, human body has developed the exquisite method of handling the heat insufficiency of intake, and we just begin to recognize the complicacy of these metabolism networks up to date.During heat was taken in a large number in current developed country, this exquisiteness and complicated system began we are produced negative influence, and the disease of causeing fat is seriously popular with relevant metabolic trouble.
Fatty tissue is the essential component in the human body.Yet, the too many body fat disease of causeing fat, it is serious medical condition, currently influences the grownup of the U.S. about 1/3 and about 14% children and teenager.Energy abundance and sedentary lifestyle have made obesity become global phenomenon in the developed country.In the U.S., we can say that obesity is the current main cause of disease (www.obesity.org) of second place that is only second to the preventability death of smoking.
Obesity is that environmental factors and inherited genetic factors are united the typical multi-factor disease that causes.For example, the familial that health is formed in uniovular twins is trooped and the height consistence in can see the strong evidence of the hereditary component of human obesity disease.Yet the effect of inherited genetic factors is complicated and may determines that every kind of gene may have relatively little influence by the interaction of several genes.This genoid be called " susceptibility " gene and they make up mutually and with environmental factors such as nutrition absorption, body movement and smoking combination in see their phenotypic effect.
Up to now, reported at least about 80 kinds of genes relevant with obesity (see, for example, the ob gene spectrum data storehouse of http://obesitygene.pbrc.edu (ObesityGene Map Database)).These genes many kind at fatty tissue formation and keep in play regulating effect.
Obesity is relevant with other diseases usually.For example, relevant with abdominal obesity and comprise that glucose intolerance, dyslipidemias mass formed by blood stasis (dyslipidemia) and hypertensive " metabolism bunch " are also referred to as metabolism syndrome X (Reaven sometimes, 1988) or abdominal fatness-metabolism syndrome (Bjorntorp, 1991).The basic reason close interaction of stomach fat pattern, whole body obesity and insulin resistant seemingly of this symptom associating.The also normally adult non-insulin-dependent diabetes mellitus (NIDDM) (type ii diabetes) of showing effect of obesity and the situation that is pre-existing in of multiple other diseases.Although obtaining progress aspect the metabolic knowledge of fatty tissue, still there is deficiency in the current treatment plan of fatty tissue metabolic trouble and wishes the therapy that exploitation is new.
Summary of the invention
The present invention relates to enclose fat and drip genetic variant new on albumen (perilipin) locus or polymorphism and they in the diagnosis of obesity and associated metabolic disease and the purposes in the prognosis application.
The invention provides the method for determining the danger of the increase of obesity and obesity relative disease in the individuality, it comprises step: the genotype of a) determining PLIN16209T/C, PLIN3 10171A/T, PLIN4 11482G/A, PLIN5 13041A/G, PLIN614995A/T locus from the biological sample that this individuality obtains; B) based on the definite PLIN genotype generation unit type of step (a); With c) ethnic background that described haplotype and this is individual is related, wherein relevant with this individual ethnic background PLIN5-G/PLIN6T that is selected from, PLIN5-A/PLIN6-T, PLIN1-T/PLIN4-G/PLIN5-G/PLIN6-T, PLIN1-T/PLIN4-G, PLIN1-T/PLIN4-G/PLIN5-A/PLIN6-A, PLIN1-T/PLIN3-A/PLIN4-APLIN5-A/PLIN6-T, PLIN1-T/PLIN3-A/PLIN/4-A/PLIN5-G/PLIN6-T, PLIN4-A/PLIN5-A/PLIN6-T, PLIN4-A/PLIN5-G/PLIN6-T, PLIN4-G/PLIN5-G/PLIN6-A, the haplotype of PLIN1-T/PLIN3-A shows the danger of the increase of obesity and obesity relative disease in this individuality.
In one embodiment, the method of the danger of the increase of obesity and obesity relative disease in definite Caucasian blood lineage individuality is provided, and it comprises step: the genotype of a) determining PLIN1 6209T/C, PLIN4 11482G/A, PLIN5 13041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains; B) based on the definite PLIN genotype generation unit type of step (a); With c) ethnic background that described haplotype and this is individual is related, and the haplotype that wherein is selected from PLIN5-G/PLIN6T, PLIN5-A/PLIN6-T and PLIN1-T/PLIN4-G/PLIN5-G/PLIN6-T shows the danger of the increase of obesity and obesity relative disease in this Caucasian blood lineage individuality.
In one embodiment, the method of the danger of the increase of obesity and obesity relative disease in the blood lineage individuality of definite people from Mediterranean Sea is provided, and it comprises step: the genotype of a) determining PLIN1 6209T/C, PLIN4 11482G/A, PLIN5 13041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains; B) based on the definite PLIN genotype generation unit type of step (a); With c) ethnic background that described haplotype and this is individual is related, and the haplotype that wherein is selected from PLIN1-T/PLIN4-G, PLIN1-T/PLIN4-G/PLIN5-A/PLIN6-A, PLIN1-T/PLIN4-G/PLIN5-G/PLIN6-T shows the danger of the increase of obesity and obesity relative disease in the blood lineage individuality of this people from Mediterranean Sea.
In one embodiment, the method of the danger of the increase of obesity and obesity relative disease in definite Malaysian blood lineage individuality is provided, and it comprises step: the genotype of a) determining PLIN1 6209T/C, PLIN3 10171A/T, PLIN4 11482G/A, PLIN5 13041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains; B) based on the definite PLIN genotype generation unit type of step (a); With c) ethnic background that described haplotype and this is individual is related, and the haplotype that wherein is selected from PLIN1-T/PLIN3-A/PLIN4-A/PLIN5-A/PLIN6-T, PLIN1-T/PLIN3-A/PLIN/4-A/PLIN5-G/PLIN6-T, PLIN4-A/PLIN5-A/PLIN6-T, PLIN4-A/PLIN5-G/PLIN6-T, PLIN4-G/PLIN5-G/PLIN6-A, PLIN1-T/PLIN3-A shows the danger of the increase of obesity and obesity relative disease in this Malaysian blood lineage individuality.
In one embodiment, the method of the danger of the increase of obesity and obesity relative disease in definite Indian blood lineage individuality is provided, and it comprises step: the genotype of a) determining PLIN1 6209T/C, PLIN3 10171A/T, PLIN4 11482G/A, PLIN5 13041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains; B) based on the definite PLIN genotype generation unit type of step (a); With c) ethnic background that described haplotype and this is individual is related, and the haplotype that wherein is selected from PLIN1-T/PLIN3-A/PLIN4-A/PLIN5-A/PLIN6-T, PLIN4-A/PLIN5-A/PLIN6-T, PLIN4-G/PLIN5-G/PLIN6-T and PLIN1-T/PLIN3-A shows the danger of the increase of obesity and obesity relative disease in this Indian blood lineage individuality.
In one embodiment, the method of the danger of the increase of obesity and obesity relative disease in definite Caucasian blood lineage individuality is provided, it comprises the genotype of determining PLIN5 13041A/G and PLIN6 14995A/T locus from the biological sample that this individuality obtains, wherein in the PLIN5 locus in the homozygosity of allelotrope G or the PLIN6 locus homozygosity of allelotrope T show the danger of the increase of obesity and obesity relative disease in this Caucasian blood lineage individuality.
In one embodiment, the method of the danger of the increase of obesity and obesity relative disease in definite Malaysian or the Indian blood lineage individuality is provided, it comprises the genotype of determining PLIN6 14995A/T locus from the biological sample that this individuality obtains, and wherein the homozygosity of allelotrope T shows the danger of the increase of obesity and obesity relative disease in this Malaysian or the Indian blood lineage individuality in the PLIN6 locus.
In one embodiment, the method of the danger of the increase of obesity and obesity relative disease in definite Malaysian or the Indian blood lineage individuality is provided, it comprises the genotype of determining PLIN4 11482G/A locus from the biological sample that this individuality obtains, and wherein the homozygosity of equipotential gene A shows the danger of the increase of obesity and obesity relative disease in this Malaysian or the Indian blood lineage individuality in the PLIN4 locus.
In one embodiment, the method of the danger of the increase of obesity and obesity relative disease in definite Malaysian or the Indian blood lineage individuality is provided, it comprises the genotype of determining PLIN5 13041A/G locus from the biological sample that this individuality obtains, and wherein the homozygosity of allelotrope G shows the danger of the increase of obesity and obesity relative disease in this Malaysian or the Indian blood lineage individuality in the PLIN5 locus.
In one embodiment, the individuality of danger of assessing the increase of its obesity and obesity relative disease is the woman.
In one embodiment, the individuality of danger of assessing the increase of its obesity and obesity relative disease has been accepted the diet that loses weight.
In one embodiment, the obesity relative disease is a cardiovascular disorder.
In one embodiment, the obesity relative disease is a metabolism syndrome.
In another embodiment, the method of the danger that reduces of obesity and obesity relative disease in definite individuality is provided, and it comprises step: the genotype of a) determining PLIN1 6209T/C, PLIN3 10171A/T, PLIN4 11482G/A, PLIN513041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains; B) based on the definite PLIN genotype generation unit type of step (a); With c) ethnic background that described haplotype and this is individual is related, and wherein relevant with this individual ethnic background haplotype that is selected from PLIN5-A/PLIN6-A, PLIN1-C/PLIN4-G/PLIN5-A/PLIN6-A, PLIN1-C/PLIN4-A, PLIN1-C/PLIN4-A/PLIN5-A/PLIN6-A, PLIN1-T/PLIN3-T/PLIN4-G/PLIN5-A/PLIN6-A, PLIN1-C/PLIN3-A/PLIN/4-G/PLIN5-A/PLIN6-A and PLIN1-C/PLIN3-T shows the danger that reduces of obesity and obesity relative disease.
In one embodiment, the method of the danger that reduces of obesity and obesity relative disease in definite Caucasian blood lineage individuality is provided, and it comprises step: the genotype of a) determining PLIN1 6209T/C, PLIN4 11482G/A, PLIN4 13041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains; B) based on the definite PLIN genotype generation unit type of step (a); With c) ethnic background that described haplotype and this is individual is related, and the haplotype that wherein is selected from PLIN5-A/PLIN6-A and PLIN1-C/PLIN4-G/PLIN5-A/PLIN6-A shows the danger that reduces of obesity and obesity relative disease in this Caucasian blood lineage individuality.
In one embodiment, the method of the danger that reduces of obesity and obesity relative disease in the blood lineage individuality of definite people from Mediterranean Sea is provided, and it comprises step: the genotype of a) determining PLIN1 6209T/C, PLIN4 11482G/A, PLIN5 13041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains; B) based on the definite PLIN genotype generation unit type of step (a); With c) ethnic background that described haplotype and this is individual is related, and the haplotype that wherein is selected from PLIN1-C/PLIN4-A and PLIN1-C/PLIN4-A/PLIN5-A/PLIN6-A shows the danger that reduces of obesity and obesity relative disease in the blood lineage individuality of this people from Mediterranean Sea.
In one embodiment, the method of the danger that reduces of obesity and obesity relative disease in definite Malaysian blood lineage individuality is provided, and it comprises step: the genotype of a) determining PLIN1 6209T/C, PLIN3 10171A/T, PLIN4 11482G/A, PLIN5 13041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains; B) based on the definite PLIN genotype generation unit type of step (a); With c) ethnic background that described haplotype and this is individual is related, and the haplotype that wherein is selected from PLIN1-T/PLIN3-T/PLIN4-G/PLIN5-A/PLIN6-A, PLIN1-C/PLIN3-A/PLIN4-G/PLIN5-A/PLIN6-A and PLIN1-C/PLIN3-T shows the danger that reduces of obesity and obesity relative disease in this Malaysian blood lineage individuality.
In one embodiment, the method of the danger that reduces of obesity and obesity relative disease in definite Indian blood lineage individuality is provided, and it comprises step: the genotype of a) determining PLIN1 6209T/C, PLIN3 10171A/T, PLIN4 11482G/A, PLIN5 13041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains; B) based on the definite PLIN genotype generation unit type of step (a); With c) ethnic background that described haplotype and this is individual is related, and the haplotype that wherein is selected from PLIN1-C/PLIN3-A/PLIN4-G/PLIN5-A/PLIN6A, PLIN1-C/PLIN3-A/PLIN4-G/PLIN5-A/PLIN6-A and PLIN1-C/PLIN3-C shows the danger that reduces of obesity and obesity relative disease in this Indian blood lineage individuality.
In one embodiment, the individuality of assessing the danger that reduces of its obesity and obesity relative disease is the woman.
The present invention also provides test kit, its primer that comprises the nucleic acid region that covers PLIN1 6209T/C, PLIN3 10171A/T, PLIN4 11482G/A, PLIN5 13041A/G and PLIN6 14995A/T polymorphism of being used to increase is right, and specification sheets, it comprises the related of the haplotype relevant with obesity danger that increase or that reduce and they and ethnic group.
In one embodiment, it is right that described test kit comprises the SEQ ID NO:1 and the SEQ ID NO:2 primer of the nucleic acid region that covers the PLIN1 polymorphism of being used to increase; The SEQ ID NO:7 and the SEQ ID NO:8 primer of the nucleic acid region that covers the PLIN3 polymorphism of being used to increase is right; The SEQ ID NO:10 and the SEQ ID NO:11 primer of the nucleic acid region that covers the PLIN4 polymorphism of being used to increase is right; The SEQ ID NO:13 and the SEQ ID NO:14 primer of the nucleic acid region that covers the PLIN5 polymorphism of being used to increase is right; Right with the SEQ ID NO:16 and the SEQ ID NO:17 primer of the nucleic acid region that covers the PLIN6 polymorphism of being used to increase; And specification sheets, it comprises the related of the haplotype relevant with obesity danger that increase or that reduce and they and ethnic group.
The accompanying drawing summary
Fig. 1 has shown the name of PLIN polymorphism.The location tables of the polymorphism of checking in this research is shown vertical short-term, is title below it.Square frame above the gene map has shown the sequence that is expressed as the Nucleotide of "+1 " in the name that comprises us.The A of initial methionine codon ATG is expressed as the bold Italic letter, marks its genome position on reference sequences (GenBank searching number GI21431190) above it.Also illustrated corresponding amino acid.Has the zone that alternative splicing may take place for the box indicating of slash line.
Fig. 2 has shown the BMI to the combination gene type of adjusting back PLIN1 and PLIN4 SNP from PLIN5 and PLIN6 among the woman of sample 1.The age-mean value of adjusting; Error bars: SEM.
Fig. 3 has shown the BMI to the combination gene type of adjusting back PLIN5 and PLIN6 SNP from PLIN1 and PLIN4 among the woman of sample 1.The age-mean value of adjusting; Error bars: SEM.
Fig. 4 A and 4B have shown that the carrier of woman with PLIN4 wild-type allele 1 and PLIN4 allelotrope 2 is at the figure as a result that goes on a diet the back weight increase or alleviate.If clearly illustrating that the woman with heterozygosis PLIN4 allelotrope 2, this figure do not continue to go on a diet with easier weightening finish.
Fig. 5 has shown the chart of LD matrix in the research colony.The PLINSNPs of four kinds of gene type assays (show above diagonal lines by LD being measured (D ') between 6209C＞T, 11482G＞A, 13041A＞G and the 14995A＞T), and corresponding P value provides below diagonal lines.
Fig. 6 has illustrated difference and the standard error that body fat between the genotype of PLIN 13041A＞G and 14995A＞T SNP place among the woman is measured (BMI, percentage ratio body fat and waist).For PLIN 13041A＞G SNP, 11=AA, 12=AG and 22=GG.For 14995A＞T SNP, 11=AA, 12=AT and 22=TT.
Fig. 7 has shown the LD matrix chart of ethnic group in the Singapore, the PLINSNPs of five kinds of gene type assays (above diagonal lines, showing between 6209C＞T, 10171A＞T, 11482G＞A, 13041A＞G and the 14995A＞T) by LD being measured (D '), and corresponding P value provides below diagonal lines.
Fig. 8 has shown that the odds ratio (odds ratio) of multiple PLINS (OR) schemes.The obesity of PLIN 11482G＞A, 13041A＞G and 14995A＞T among Malaysian and the Indian (multivariate OR and the 95%CI of BMI 〉=30kg/m2).For every kind of SNP, the genotype group that will have wild-type homozygote and heterozygote is as reference.Variation obtains OR with reference by relatively isozygotying.
Detailed Description Of The Invention
The present invention relates to enclose fat and drip upward new genetic variant or polymorphism of protein gene seat (PLIN), comprise PLIN1:6209T (allelotrope 1)＞C (allelotrope 2); PLIN310171 (allelotrope 1) A＞T (allelotrope 2); PLIN4:11482G (allelotrope 1)＞A (allelotrope 2); PLIN5:13041A (allelotrope 1)＞G (allelotrope 2) and PLIN6:14995A (allelotrope 1)＞T (allelotrope 2) and they are in the diagnosis of obesity and associated metabolic disease and purposes and their purposes in treatment of obesity and associated metabolic disease in the prognosis application.Mentioned sequence numbering is according to GenBank serial ID No.gi21431190.
The present invention relates to new PLIN haplotype; its relevant with lower weight index (BMI) and therefore protection avoid obesity and associated metabolic disease; as cardiovascular disorder; and PLIN haplotype; its relevant with the BMI that raises and so be obesity and associated metabolic disease, as the Hazard Factor of cardiovascular disorder and metabolism syndrome.
" Mediterranean Sea blood lineage's individuality " refers to have the people from the ancestors of Mediterranean Sea geographic region as used herein, and described geographic region includes but not limited to, Spain, France, Italy and Portugal.Preferably, at least one ancestors is from Mediterranean geographic region.
" Caucasian blood lineage's individuality " refers to have the people from the ancestors of Northern Europe, Eastern Europe or Central European geographic region as used herein.Usually, these individualities have the light skin color and from including but not limited to North America, Britain, Russia and German zone.Preferably, at least one ancestors is from Northern Europe, Eastern Europe or Central Europe.
" Malaysian blood lineage's individuality " refers to have the people from the ancestors of the geographic region of Malay Archipelago and peripheral region as used herein, and described geographic region includes, but are not limited to Malaysia, Indonesia, Brunei and Singapore.Preferably, at least one ancestors is from Malay Archipelago or peripheral region.
" Indian blood lineage's individuality " refers to have the people from the ancestors of the geographic region of India and peripheral region as used herein, and described geographic region includes, but are not limited to India, Pakistan, Nepal and Bangladesh.Preferably, at least one ancestors is from India or peripheral region.
The disease representative of the cardiovascular disorder (CVD) or the recycle system is because the various clinical situation that the atherosclerotic lesions of coronary artery, cerebral arteries or peripheral arterial causes.Think that CVD is the men and women's of developed country a underlying cause of death now.The detailed epidemic data of CVD can obtain from " the 2002 Heart andStatistical Update " of american heart association (American Heart Association), and it has summarized Hazard Factor.61,800,000 American suffers from CVD (the Rational diagnosis ofcardiovascular disease of one or more types, M ü ller M M, Griesmacher A, eJIFCC Vol14no2:http: //www.ifcc.org/ejifcc/vol14no2/1402062003012n.htm).Current have several marks can the diagnosing acute cardiovascular disorder, comprises " in early days " and " late period " mark that discharges from the myocardial cell that use is called under the local asphyxia situation, as have a liking for flesh element (myotropin) and myocardium calcium protein (Id.).
The feature of metabolism syndrome is one group of metabolic risk factors of a philtrum.These factors comprise a) central obesity (too much fatty tissue around the belly neutralization), b) atherogenic dyslipidemias mass formed by blood stasis (blood fat, it promotes that patch is assembled in the arterial wall), c) elevated blood pressure (130/85mmHg or higher), d) insulin resistant or glucose intolerance, e) (prothrombotic) state is (for example before the thrombosis, high fibrinogen or Type 1 plasminogen activator inhibitor and f in the blood) short scorching state (the hypersensitivity c reactive protein matter that for example, raises in the blood).This syndromic basic cause of disease is overweight/obesity, health outage and inherited genetic factors.People with metabolism syndrome suffer from coronary heart disease, with arterial wall in patch assemble the danger increase of relevant other diseases (for example, apoplexy and peripheral vascular disease) and diabetes B.
In one embodiment, the invention provides novel method by the susceptibility of measuring assessment cardiovascular disorder of PLIN haplotype in the individuality and metabolism syndrome.
Enclosing fat, to drip albumen (PLIN) be the phosphorprotein of hormone regulation, and it is around lipid storage droplet (Greenberg, A.S. in the adipocyte; Egan, J.J.; Wek, S.A.; Takeda, T.; Londos, C.; Kimmel, A.K. (Abstract) Clin, Res.39:287A only, 1991).It is a cell A-kinase substrate main in the adipocyte, its coated cell inner lipid droplet and adjusting adipocyte lipolytic activity.People such as Nishiu from fatty tissue cDNA library clone the coding people enclose fat and drip proteic cDNA (Genomics 48:254-257,1998; GenBank Nucleic Acid ID No.gi:3041770).522 amino acid whose polypeptide of this people's gene coding, the isolating rat homologues of people (Proc.Nat.Acad.Sci.90:12035-12039,1993) such as itself and Greenberg have 79% identity.
The present invention is based on and enclose fat and drip evaluation and the assessment that protein gene seat (PLIN) is gone up the relation of several new genetic variants and obesity and relevant metabolic trouble and cardiovascular disorder, described modification comprises PLIN1:6209T＞C; PLIN3:10171A＞T; PLIN4:11482G＞A; PLIN5:13041A＞G and PLIN6:14995A＞T.
PLIN polymorphism and haplotype is related 788 male sex that we have determined to select at random from Mediterranean Sea people colony and 801 women (sample 1) and 157 obese subjects of being in hospital (sample 2).Astoundingly, in whole colony, enclose fat and drip proteic more uncommon allelotrope, the dangerous significant correlation that reduces that is obesity among PLIN1 allelotrope 2 and PLIN4 allelotrope 2 and the woman (is respectively OR=0.65,95%CI:0.48-0.88 and OR=0.60,95%CI:0.44-0.83).We also are surprised to find in the woman from sample 1, and with wild-type, promptly allelotrope 1 is compared, the more uncommon allelotrope of PLIN1 and PLIN4 and lower BMI significant correlation.In these woman, PLIN4 is also relevant with blood plasma triacylglycerol concentration with lower waist-stern ratio, fasting glucose.The haplotype analysis has confirmed these results and has been disclosed among all woman PLIN1 and PLIN4 to the synergy of BMI.Do not find that in from the man of sample 1 statistics is significantly related.Yet in fat man, the carrier of the more not common allele 2 of PLIN4 has significantly lower BMI than non-carrier.Among both, the more not common allele of PLIN1 and the PLIN4 all plasma glucose with higher is relevant fat men and women, and with sample 1 different (interactional P＜0.05).Therefore, our data show that the PLIN-2/PLIN4-2 haplotype is protectiveness obesity-susceptibility haplotype, and relevant with the development of metabolism syndrome and cardiovascular disorder.
Therefore, in one embodiment, the invention provides the obesity of assessment in the individuality and the method for the individual procatarxis of obesity relative disease.This method comprises to be identified and the PLIN polymorphism of analysis from the isolating nucleic acid samples that this individuality obtains, wherein PLIN1 allelotrope 1 and PLIN4 allelotrope 1 exist (for example, PLIN1-1/PLIN4-1 haplotype) to show the genetic factor of obesity and associated metabolic disease in this individuality together on the identical chromatid in described nucleic acid samples.Preferably, described individuality is people from Mediterranean Sea or Caucasian blood lineage.
In one embodiment, the invention provides the method for assessment individuality to the procatarxis of cardiovascular disorder, wherein this method comprises evaluation and the PLIN polymorphism of analysis from the isolating nucleic acid samples of this individuality gained, wherein PLIN1 allelotrope 1 exists (for example, PLIN1-1/PLIN4-1 haplotype) to show the procatarxis to cardiovascular disorder with PLIN4 allelotrope 1 together on the identical chromatid in described nucleic acid samples.Preferably, described individuality is people from Mediterranean Sea or Caucasian blood lineage.
Alternatively, in one embodiment, the invention provides and identify that the back of can not increase weight and go on a diet expects the method for individuality of the body weight that maintenance is better reduced.This method comprises the PLIN allelotrope of analysis from the isolating nucleic acid of individuality, and wherein the existence of the allelotrope 2 of PLIN1 and PLIN4 shows have obesity protective gene type in this individuality.Preferably, described individuality is people from Mediterranean Sea or Caucasian blood lineage.
The present invention also provides and has been used for diagnosis and is in and suffers from obesity and/or obesity relative disease, includes, but are not limited to the haplotype of the individuality in the danger of cardiovascular disorder.One of these haplotypes are made up of the polymorphism that comprises PLIN1, PLIN4, PLIN5 and PLIN6.Therefore, haplotype 1111 is made up of the allelotrope 1 of genes identified seat above all, and haplotype 2222 is made up of the allelotrope 2 of genes identified seat above all.From individuality, the haplotype 2211 in preferred woman's the nucleic acid samples shows that the danger of this individuality trouble obesity and/or cardiovascular disorder reduces.On the contrary, the individuality with haplotype 1122 or 1111 has the danger of the increase of suffering from obesity and/or cardiovascular disorder.Preferably, when using these haplotypes to carry out prognosis and/or diagnosis, described individuality is Caucasian or people from Mediterranean Sea blood lineage.
In a further embodiment, the invention provides the method that the dangerous individuality of weightening finish is once more arranged after evaluation is gone on a diet.This method comprises analysis from the PLIN4 locus in this individual nucleic acid samples, and wherein the existence of allelotrope 2 shows that the danger of weightening finish once more increases in one or two allelotrope of PLIN4 locus.
We have also determined in the colony of many ethnic groups Asia the related of polymorphism independent in the multiple PLIN locus and PLIN haplotype.We have checked that enclosing fat drips albumen (PLIN) locus PLIN1, PLIN3, PLIN4, PLIN5 and the last 5 kinds of common single nucleotide polymorphism of PLIN6 (SNP), and wherein said polymorphism is respectively: PLIN 6209C＞T, 10171A＞T, 11482G＞A, 13041A＞G and 14995A＞T.We have studied, and they are dangerous with obesity and relevant its dependent variable with metabolism syndrome related.Research colony comprises 4,131 experimenters from three ethnic groups (Chinese, Malaysian and Indian) of Singapore.Analysis revealed haplotype 11212 by Malaysian and Indian total and compare with modal haplotype 21111 with the dangerous significant correlation of the obesity that increases (for Malaysian, OR=1.65,95%CI 1.11-2.46, for Indian OR=1.94,95%CI 1.06-3.53).In positive LD, use subgroup (the haplotype analysis revealed of 11482G＞A, 13041A＞G and 14995A＞T) carry out mutually of SNP, after regulating concomitant variable, haplotype 212 (OR=2.04,95%CI 1.28-3.25) and 222 (OR=2.05,95%CI 1.35-3.12) with Malaysian in the obesity that increases dangerous relevant, and haplotype 212 (OR=2.16,95%CI 1.10-4.26) with the Indian in the dangerous significant correlation of the obesity that increases, described concomitant variable comprises age, sex, smoking, alcohol consumption, exercise and diabetic disease states.After independent snp analysis proof is regulated concomitant variable, the dangerous significant correlation of the obesity that increases among PLIN14995A＞T SNP and Malaysian (OR=2.28,95%CI 1.45-3.57) and the Indian (OR=2.04,95%CI 1.08-3.84).And PLIN11482G＞A ((OR=1.94,95%CI 1.22-3.08) and PLIN 13041A＞G (OR=1.87,95%CI 1.08-3.25) only with Malaysian in the obesity that increases dangerous relevant.
Therefore, in one embodiment, the invention provides the method for the danger of the increase of suffering from the obesity relative disease in assessment Malaysian or the Indian blood lineage individuality.This method comprises to be identified and the PLIN polymorphism of analysis from the isolating nucleic acid samples that this individuality obtains, haplotype PLIN4-2/PLIN6-2 wherein, promptly PLIN4 allelotrope 2 and PLIN6 allelotrope 2 are present in together on the identical chromatid in the nucleic acid samples and show the danger of suffering from obesity and relative disease in this individuality.
In one embodiment, the invention provides the method for the procatarxis of the individual central vessel disease of assessment Malaysian or Indian blood lineage, wherein this method comprises evaluation and analyzes PLIN polymorphism and haplotype from the isolating nucleic acid samples that this individuality obtains, haplotype PLIN4-2/PLIN6-2 wherein, promptly PLIN4 allelotrope 2 and PLIN6 allelotrope 2 are present in the procatarxis that shows cardiovascular disorder on the identical chromatid in the nucleic acid samples together.
In another embodiment, the invention provides the method for the procatarxis of obesity and obesity relative disease in arbitrary individuality of assessment Malaysian or Indian blood lineage, wherein this method comprises the genotype of identifying and determining PLIN6 locus from the isolating nucleic acid samples that this individuality obtains, and wherein exists the homozygosity of T allelotrope (allelotrope 2) to show the danger of the increase of obesity and relative disease in this Malaysian or the Indian blood lineage individuality at PLIN6.
In another embodiment, the invention provides the method for the procatarxis of obesity and obesity relative disease in arbitrary individuality of assessment Malaysian or Indian blood lineage, wherein this method comprises the genotype of identifying and determining PLIN4 locus from the isolating nucleic acid samples that this individuality obtains, and wherein exists the homozygosity of A allelotrope (rare allele) to show the danger of the increase of obesity and relative disease in this Malaysian or the Indian blood lineage individuality at PLIN4.
In another embodiment, the invention provides the method for the procatarxis of obesity and obesity relative disease in arbitrary individuality of assessment Malaysian or Indian blood lineage, wherein this method comprises the genotype of identifying and determining PLIN5 locus from the isolating nucleic acid samples that this individuality obtains, and wherein exists the homozygosity of G allelotrope (rare allele) to show the danger of the increase of obesity and relative disease in this Malaysian or the Indian blood lineage individuality at PLIN5.
The present invention also provides Malaysian or the Hindoo haplotype that is used to diagnose the danger increase of suffering from obesity and/or obesity relative disease.A kind of haplotype is made up of the polymorphism that comprises PLIN1, PLIN3, PLIN4, PLIN5 and PLIN6.Therefore, haplotype 11111 is made up of the allelotrope 1 of genes identified seat above all, and haplotype 22222 is made up of the allelotrope 2 of genes identified seat above all.The danger that shows this individuality trouble obesity and/or cardiovascular disorder from haplotype 11212 or 11222 in the nucleic acid samples of Malaysian blood lineage individuality increases.The danger that shows this individuality trouble obesity and/or cardiovascular disorder from haplotype 11212 in the nucleic acid samples of Indian blood lineage individuality increases.From haplotype 12111 in the Nucleotide sample of Malaysian blood lineage individuality or 21111 relevant with the danger that reduces of obesity.In addition, relevant from haplotype 21111 in the Hindoo Nucleotide sample with the danger that reduces of obesity.
Be used to diagnose the another kind of haplotype of Malaysian and Indian blood lineage individuality to form by the polymorphism that comprises PLIN4, PLIN5 and PLIN6.Therefore, haplotype 111 is made up of the allelotrope 1 of genes identified seat above all, and haplotype 222 is made up of the allelotrope 2 of genes identified seat above all, and wherein the haplotype 212,222 or 121 from Malaysian blood lineage individuality shows that the danger of this individuality trouble obesity and/or cardiovascular disorder increases.Existence from haplotype 212 in the nucleic acid samples of Indian blood lineage individuality or 122 shows that the danger of this individuality trouble obesity and/or cardiovascular disorder increases.
In another embodiment, the invention provides the method for suffering from the procatarxis of obesity and obesity relative disease in assessment Malaysian or the Indian blood lineage individuality, wherein this method comprises the genotype of determining PLIN1 and PLIN3 locus from the isolating nucleic acid of individuality and produces the phenotype that comprises these two kinds of locus, haplotype PLIN1-1/PLIN-3/1 wherein, promptly PLIN1 allelotrope 1 is present in the danger that shows the increase of suffering from obesity and/or cardiovascular disorder in the identical chromatid together with PLIN3 allelotrope 1.
In another embodiment, the present invention also provides the back of can not increasing weight and go on a diet of identifying Malaysian or Indian blood lineage to estimate the method for the individuality of the body weight that maintenance better alleviates.This method comprises the genotype of determining PLIN1 and PLIN3 locus from the isolating nucleic acid that individuality obtains and produces the allelic haplotype of PLIN; haplotype PLIN1-1/PLIN3-2 wherein, promptly PLIN1 allelotrope 1 and PLIN3 allelotrope 2 are present in together and show in the identical chromatid and have obesity protective gene type in this individuality.
We have also carried out research to determine related from PLIN polymorphism and haplotype in the Caucasian blood lineage individuality of the U.S..734 white man experimenters (373 men and 361 woman) of the mode intervention plan that participates in living have been determined four kinds of PLIN SNP (genotype of PLIN 6209T＞C, 11482G＞A, 13041A＞G and 14995A＞T).Multivariate analysis proof in the woman, two kinds of SNP (13041A＞G and 14995A＞T) and percentage ratio body fat (for 13041A＞G, P=0.016, for 14995A＞T, P=0.010) and the waistline significant correlation (for 13041A＞G, P=0.020, for 14995A＞T, P=0.045).And, use haplotype analysis revealed haplotype PLIN5-A/PLIN6-T that these two kinds of SNP carry out and PLIN5-G/PLIN6-T when dangerous relevant (for haplotype PLIN5-A/PLIN6-T with the haplotype PLIN5-A/PLIN6-A obesity that Shi Douyu significantly increases of comparing, OR=1.76,95%CI 1.07-2.90, and, for haplotype PLIN5-G/PLIN6-T, OR=1.73,95%CI 1.06-2.82).In the man, do not find the significant correlation between PLIN variation and the obesity.Thereby PLIN is the important genetic determinant of obesity danger among the Caucasian, and the woman to drip proteic hereditary effect more responsive to enclosing fat than the man.
Therefore, in one embodiment, the invention provides the method for the individual procatarxis of the obesity of assessment Caucasian blood lineage individuality and obesity relative disease.This method comprises genotype and the haplotype of determining PLIN polymorphism from the isolating nucleic acid samples that Caucasian blood lineage individuality obtains, and wherein haplotype PLIN5-2/PLIN6-2 or the PLIN5-1/PLIN6-2 existence in described nucleic acid samples shows that the danger of suffering from obesity and relative disease in this individuality increases.Preferably, described individuality is the woman.
In one embodiment, the invention provides the method for assessment Caucasian blood lineage individuality to the cardiovascular disorder procatarxis, wherein this method comprises genotype and the haplotype of determining PLIN polymorphism from the isolating nucleic acid samples that Caucasian blood lineage individuality obtains, and wherein haplotype PLIN5-2/PLIN6-2 or the PLIN5-1/PLIN6-2 existence in described nucleic acid samples shows that the danger of suffering from cardiovascular disorder increases.Preferably, described individuality is the woman.
Alternatively, in one embodiment, the invention provides the method that the individuality of the body weight that maintenance better alleviates is estimated in the back of can not increasing weight and go on a diet of identifying the Caucasian blood lineage.This method comprises from individual isolating nucleic acid, determines the genotype of PLIN locus, and wherein the existence of the allelotrope 1 of PLIN5 and PLIN6 shows and has obesity protective gene type in this individuality and show that this individuality more may not increase weight after going on a diet.Preferably, described individuality is the woman.
The present invention also provides and has been used for diagnosis and is in and suffers from obesity and/or obesity relative disease, includes, but are not limited to the haplotype of the Caucasian blood lineage individuality in the danger of cardiovascular disorder.One of these haplotypes are by equipotential genomic constitution among locus PLIN1, PLIN4, PLIN5 and the PLIN6.Therefore, haplotype 1111 is made up of the allelotrope 1 of genes identified seat above all, and haplotype 22222 is made up of the allelotrope 2 of genes identified seat above all, wherein show this individuality to obesity and/or cardiovascular disorder susceptible more, and the Caucasian who wherein has a haplotype 2111 is to suffering from more not susceptible (seeing Table 15) of obesity and/or cardiovascular disorder from haplotype 1122 in the nucleic acid samples of Caucasian blood lineage individuality.
The present invention also provides new PLIN polymorphism and has been used for increasing and analyzing the oligonucleotide of this new PLIN polymorphism by striding mononucleotide polymorphism site of the present invention.The present invention also provides the oligonucleotide that is used for the sequence order-checking of described amplification.
In one embodiment, be used for the increasing primer of PLIN1, PLIN2, PLIN3, PLIN4, PLIN5 and PLIN6 is respectively SEQ ID NO:1 and 2, SEQ ID NO:4 and 5, SEQ ID NO:7 and 8, SEQ ID NO:10 and 11, SEQ ID NO:13 and 14 and SEQ ID NO:16 and 17 nucleotide sequences of describing.
New polymorphism below the present invention also provides: PLIN1:6209 T (allelotrope 1)＞6209 C (allelotrope 2); PLIN 310171 (allelotrope 1) A＞T (allelotrope 2); PLIN4:11482 G (allelotrope 1)＞11482 A (allelotrope 2); PLIN5:13041 A＞13041 G (allelotrope 2) and PLIN6:14995 A (allelotrope 1)＞14995 T (allelotrope 2).See the following form.
Locus Allelotrope 1 Allelotrope 2
PLIN1 ?T ?C
PLIN3 ?A ?T
PLIN4 ?G ?A
PLIN5 ?A ?G
PLIN6 ?A ?T
Therefore, in one embodiment, the invention provides polymorphism, it is the Hazard Factor tendency of weight increase and/or cardiovascular disorder in the individual human of Mediterranean Sea.In one embodiment, described polymorphism is the allelotrope 1 (6209 T) of PLIN1.In another embodiment, described polymorphism is the allelotrope 1 (11482 G) of PLIN4.
In another embodiment, the invention provides polymorphism, it is the Hazard Factor tendency of weight increase and/or cardiovascular disorder in the Caucasian blood lineage individuality.During homozygote, they are relevant with the danger of the increase of weight increase in being accredited as the PLIN locus.In one embodiment, described polymorphism is the allelotrope G (13041 G) of PLIN5.In another embodiment, described polymorphism is the allelotrope T (14995 T) of PLIN6.
In another embodiment, the invention provides polymorphism, it is when as isozygotying allelotrope when existing, and is the Hazard Factor tendency of weight increase and/or cardiovascular disorder in Malaysian or the Indian blood lineage individuality.Described polymorphism is the allelotrope 2 of PLIN6 (14995 T) locus, and promptly T/T is Hazard Factor among the PLIN6.
In another embodiment, the invention provides polymorphism, it is the Hazard Factor tendency of weight increase and/or cardiovascular disorder in the Malaysian blood lineage individuality.In one embodiment, described polymorphism is the allelotrope 2 (13041 G) of PLIN5.In another embodiment, described polymorphism is the allelotrope 2 (11482 A) of PLIN4.
The present invention also provides the diagnostic method that is used to identify the individuality that is not easy to suffer from obesity and obesity relative disease, it comprises step: obtain nucleic acid samples from individuality, analyze isolating nucleic acid, determine the genotype of allele variant described in the sample and from this genotype generation unit type.Table 15 has been illustrated such haplotype, if it is present in the individuality of pointed ethnic group, shows that then this individuality is not easy to suffer from obesity and obesity relative disease.Haplotype vertical read in the table 15, for example, haplotype (a) is PLIN5-A/PLIN6-A, and haplotype (h) is PLIN1-C/PLIN3-A/PLIN4-G/PLIN5A/PLIN6A.
The present invention also provides and has been used to identify obesity and obesity relative disease, the diagnostic method of the individuality that increases as the danger of cardiovascular disorder.Described method comprises step: obtain nucleic acid samples from individuality, analyze isolating nucleic acid, determine the genotype of allele variant described in the sample and from this genotype generation unit type.Table 16 has been illustrated such haplotype, if it is present in the individuality of pointed ethnic group, shows that then the danger of this individuality trouble obesity and obesity relative disease increases.Haplotype vertical read in the table 16, for example, haplotype (k) is that PLIN5-G/PLIN6-T and haplotype (w) are PLIN1-T/PLIN3-A/PLIN4-A/PLIN5A/PLIN6T.
In another embodiment, the invention provides evaluation and be in trouble obesity and obesity relative disease, diagnostic method as the women in the cardiovascular disorder danger, it comprises step: obtain nucleic acid samples from female individual, use is used to stride the suitable PLIN-PCR primer amplification sequence of pleomorphism site amplification, detect the allele variant in the described sample, and analytical results.
Biological sample as the source material that separates amplifying nucleic acid of the present invention comprises solid material (for example, tissue, cell precipitation thing, examination of living tissue) and biofluid (for example, blood, saliva, amniotic fluid, collutory, urine).Nucleic acid molecule of the present invention comprise DNA and RNA and can use many methods well known in the art any from the particular organisms sample separation, selected described particular separation method is suitable for this particular organisms sample.As the method for above-mentioned separation and analysis of nucleic acids variant is to well known to a person skilled in the art and can see for example Molecular Cloning:ALaboratory Manual, 3rd Ed., Sambrook and Russel, Cold SpringHarbor Laboratory Press, 2001.
Use the following technology can be from isolating detection of nucleic acids PLIN polymorphism of the present invention, described technology comprises the isolating nucleic acid of direct analysis, as southern blotting technique hybridization (DNA) or direct nucleic acid sequencing (Molecular Cloning:A Laboratory Manual, 3rd Ed., Sambrook and Russel, Cold Spring Harbor Laboratory Press, 2001).
The alternative approach that is used for direct analysis PLIN polymorphism according to the present invention is INVADER Measure (Third Wave Technologies, Inc (Madison, WI)).This is measured usually based on the structure specific nucleic acid enzymic activity of plurality of enzymes, and described enzyme is used to cut the cutting structure that relies on target, thereby shows and have specific nucleic acid sequence or its specific variation (see, for example, U.S. Patent number 6,458,535) in the sample.
Preferably, use the technology of PCR-based.Behind the PCR, can identify polymorphic nucleic acid, wherein use the primer for example use through mark, the direct order-checking of carrying out as radioactivity or fluorescently-labeled primer; Single-strand conformation polymorphism analysis (SSCP), denaturing gradient gel electrophoresis (DGGE); With the chemical chop analysis, they are all for example at Molecular Cloning:A LaboratoryManual, 3rd Ed., and Sambrook and Russel, Cold Spring HarborLaboratory Press explains in 2001 in detail.
The preferred use is easy to automated method, as is used for the different methods analysis polymorphism of primer extension analysis.Can use any means well known by persons skilled in the art to carry out primer extension analysis, described method comprises PYROSEQUENCING TM(Uppsala, Sweden); Mass spectrometry comprises MALDI-TOF, and is perhaps substance assistant laser desorpted ionized-flight time; The genomic nucleic acids array (people such as Shalon, Genome Research 6 (7): 639-45,1996; People such as Bernard, Nucleic Acids Research 24 (8): 1435-42,1996); The miniature sequencing technologies of solid phase (U.S. Patent number 6,013,431, people such as Suomalainen, Mol.Biotechnol.Jun; 15 (2): 123-31,2000); Ion pair high performance liquid chromatography (people such as Doris, J.Chromatogr.A May 8; 806 (1): 47-60,1998); Measure with 5 ' nuclease or real-time RT-PCR people such as (, Proc Natl Acad SciUSA 88:7276-7280,1991) Holland, perhaps U.S. Patent number 6,355, the primer extension method of describing in 433.Nucleic acid sequencing for example uses any automatization sequencing system and labeled primer or can be used to detect polymorphism through the nucleic acid sequencing of the termination di-deoxynucleoside acid of mark.The system that is used for the automatization sequential analysis comprises, for example, and Hitachi FMBIO And HitachiFMBIO II fluorescent scanning instrument (Fluorescent Scanners) (Hitachi GeneticSystems, Alameda, CA); Spectrumedix SCE 9610 full-automatic 96-capillary electrophoresis genetic analysis systems (Fully Automated 96-CapillaryElectrophoresis Genetic Analysis System) (SpectruMedix LLC, State College, PA); ABI PRISM 377 dna sequencing instrument; ABI 373 dna sequencing instrument; ABI PRISM 310 Genetic Analyzer; ABI PRISM 3100 GeneticAnalyzer; ABI PRISM 3700 DNA Analyzer (Applied Biosystems, Headquarters, Foster City, CA); Molecular DynamicsFluorImager TM575 and SI fluorescent scanning instrument and Molecular DynamicsFluorImager TM595 fluorescent scanning instrument (Amersham Biosciences UK Limited, Little Chalfont, Buckinghamshire, Britain); GenomyxSC TMDna sequencing system (Genomyx Corporation (Foster City, Calif.); Pharmacia ALF TMDna sequencing instrument and Pharmacia ALFexpress TM(Amersham Biosciences UKLimited, Little Chalfont, Buckinghamshire, Britain).
Use is designed for amplification and detects the primer of polymorphism PLIN Nucleotide can be identical or carry out a kind of PCR, nucleic acid sequencing and primer extension reaction of nucleic acid samples separately in the reaction.
In one embodiment; the invention provides nucleic acid chip; it comprises polymorphism PLIN1, PLIN3, PLIN4, PLIN5 and PLIN6 allelotrope; described nucleic acid chip is used to screen and has PLIN relevant obesity and/or obesity relative disease; the individuality that comprises the danger of cardiovascular disorder; perhaps have the obesity of avoiding and/or obesity relative disease, as the individuality of the relevant protection of the PLIN of cardiovascular disorder.This type of chip can comprise the relevant sudden change and the polymorphism of other obesity of arbitrary number, includes but not limited to RMETHU LEPTIN, RMETHU LEPTIN acceptor, MC4R etc.The tabulation of obesity genes involved and polymorphism can be seen for example Chagnon, Y.C., P é russe, L., Weisnagel, S.J., Rankinen, T. and Bouchard, C.The Human Obesity Gene Map:The 1999 Update.Obesity Research8 (1): 89-117,2000 and website http://www.obesity.chair.ulaval.ca/genemap.html.
The method and the technology that can be used for array analysis have been described in U.S.S.N 09/536,841, WO00/58516, U.S. Patent number 412,087,6,147,205,6,262,216,6,310,189,5,889,165 and 5,959,098,5,143,854,5,242,974,5,252,743,5,324,633,5,384,261,5,405,783,5,424,186,5,451,683,5,482,867,5,491,074,5,527,681,5,550,215,5,571,639,5,578,832,5,593,839,5,599,695,5,624,711,5,631,734,5,795,716,5,831,070,5,837,832,5,856,101,5,858,659,5,936,324,5,968,740,5,974,164,5,981,185,5,981,956,6,025,601,6,033,860,6,040,193,6,090,555,6,136,269,6,269,846 and 6,428,752, PCT application number PCT/US99/00730 (international publication number W099/36760) and PCT/US01/04285 are incorporated herein by reference these documents for all purposes are complete.The additive method of specimen preparation and being used to reduces the technical description of complicacy of nucleic acid samples in for example, people such as Dong, Genome Research 11,1418 (2001), U.S. Patent number 6,361,947,6,391,592 and Application No. 09/916,135,09/920,491,09/910,292 and 10/013,598.
Carrying out the multi-nucleotide hybrid method for measuring on chip is sophisticated in the art.Hybridization assays step and condition will depend on application, and select according to general combining method, the known method that relates in the following document that comprises of described general combining method: people Molecular Cloning:A Laboratory Manual such as Maniatis (2nd Ed.Cold SpringHarbor, N.Y, 1989); Berger and Kimmel Methods in Enzymology, Vol.152, Guideto Molecular Cloning Techniques (Academic Press, Inc., San Diego, CA, 1987); Young and Davism, P.N.A.S, 80:1194 (1983).The method and apparatus that is used to carry out repetition and in check hybridization has been described in for example United States Patent (USP) 5,871,928,5,874,219,6,045,996 and 6,386,749,6,391,623, and each all is incorporated herein by reference with described document.
The case description that is used for the method and apparatus that signal detection and intensity data handle is in for example, U.S. Patent number 5,143,854,5,547,839,5,578,832,5,631,734,5,800,992,5,834,758,5,856,092,5,902,723,5,936,324,5,981,956,6,025,601,6,090,555,6,141,096,6,185,030,6,201,639,6,218,803 and 6,225,625, U.S. Patent application 60/364,731 and PCT application PCT/US99/06097 (being disclosed as WO99/47964) are incorporated herein by reference described document for all purposes are complete.
Practice of the present invention can also be used conventional biological method, software and system.Computer software product of the present invention generally includes computer-readable medium, and it has the computer executable instructions of the logic step that is used to carry out the inventive method.Suitable computer-readable medium comprises floppy disk, CD-ROM/DVD/DVD-ROM, hard disk drive, flash memory (flash memory), ROM/RAM, tape or the like.The executable instruction of described computer can be write with the suitable machine language or the combination of several language.The basic calculating biological method for example is described in, people such as Setubal and Meidanis, Introduction to Computational BiologyMethods (PWS Publishing Company, Boston, 1997); Salzberg, Searles, Kasif, (Ed.), Computational Methods in MolecularBiology, (Elsevier, Amsterdam, 1998); Rashidi and Buehler, Bioinformatics Basics:Application in BiologicalScience and Medicine (CRC Press, London, 2000) and Ouelette and Bzevanis Bioinformatics:APractical Guide for Analysis of Geneand Proteins (Wiley ﹠amp; Sons, Inc., 2nd ed., 2001).
The present invention also utilizes multiple computer program and software to be used for multiple purpose, as probe design, data management, analysis and instrumentation.See, for example, U.S. Patent number 5,593,839,5,795,716,5,733,729,5,974,164,6,066,454,6,090,555,6,185,561,6,188,783,6,223,127,6,229,911 and 6,308,170.
In addition, the present invention can have preferred embodiment, and it comprises the method that is used for providing at network such as on the Internet genetic information.
The present invention also provides diagnostic kit.In one embodiment, the invention provides test kit, its one or more primers that comprise the PL I N nucleic acid district that comprises the relevant polymorphic Nucleotide of obesity of the present invention of can increasing are right; The damping fluid and the mixture of ribonucleotides that are used for the PCR reaction; Be used for carrying out the suitable enzyme of PCR reaction at identical or independent container, and the manual PCR condition that limits, for example, the condition described in following embodiment, and the specification sheets of listing relevant allelotrope of the obesity of describing in this specification sheets and haplotype.This test kit can also comprise nucleic acid probe, listed probe in the preferred table 1, and it is in the pipe or dried forms in the bottle or damping fluid form.In preferred embodiments, these primers are listed primer in the table 1.Primer can also provide with the dried forms in pipe or the bottle in test kit, perhaps alternatively, is dissolved in the suitable aqueous buffer solution.Test kit can also comprise the primer that is used for primer extension method, and described method is used to detect the specific PLIN polymorphism as above-mentioned.
Test kit also preferably includes the table of the dangerous haplotype of listing in the various human population of obesity, table 15 as shown here and 16.
In one embodiment, the component of test kit is the part of test kit, and it provides multiple obesity well known by persons skilled in the art relevant gene, polymorphism and sudden change.
Dna single unit type, (for example, the association of phase decision SNP) is than using only a kind of mark to determine disease association more efficient methods statistically to promptly several polymorphism marks.Definite or the method according to haplotype of the present invention of identifying comprises that by for example mouse cell lines hybrid physical sepn homologous chromosomes the computing method of being cloned into plasmid and allele specific oligonucleotide PCR and haplotype is determined.
According to the present invention, can be used for determining that the method for PLIN locus haplotype SNP comprises, but be not limited to, single strand conformation polymorphism (SSCP) is analyzed people (1989) Proc.Natl.Acad.Sci.USA 86:2766-2770 such as () Orita, heteroduple analysis people (1995) Hum.Mutat.5:263-268 such as () Prior, oligonucleotide and is connected people (1990) Proc.Natl.Acad.Sci.USA 87:8923-8927 such as () Nickerson and hybridization assays method people (1983) Proc.Natl.Acad.Sci.USA 80:278-282 such as () Conner.Strategy based on conventional Taq polysaccharase PCR, as PCR-RFLP, allele specific oligonucleotide amplification (ASA) (Ruano and Kidd (1989) Nucleic Acids Res.17:8392), unit molecule dilution (SMD) people (1990) Proc.Natl.Acad.Sci.USA 87:6296-6300 such as () Ruano and link coupled amplification and order-checking (CAS) (Ruano and Kidd (1991) Nucleic Acids Res.19:6877-6882) be carry out easily and be super-sensitive method (people (1996) Nucleic Acids Res.24:4841-4843 such as Michalatos-Beloin for definite haplotype of the present invention; Barnes (1994) Proc.Natl.Acad.Sci.USA 91:5695-5699; Ruano and Kidd (1991) NucleicAcids Res.19:6877-6882).
In one embodiment, determine the haplotype of SNP of the present invention with big scale PCR (LR-PCR).Use gene type assay method well known by persons skilled in the art to determine the SNP genotype of LR-PCR product, and with mathematical method derivation unit type (for example, Clark algorithm (Clark (1990) Mol.Biol.Evol.7:111-122)).
In one embodiment, being used for haplotype analytical procedure according to the present invention is by clone's physical sepn allelotrope, order-checking then.Be used for including, but are not limited to monoallelic mutation analysis (MAMA) (people (1995) Nature Genet.11:99-102 such as Papadopoulos) and carbon nanotube (nanotube) probe (people (2000) Nature Biotech.18:760-763 such as Woolley) according to the additive method of haplotype analysis of the present invention.Application No. US 2002/0081598 also discloses useful haplotype analytical procedure, and it comprises the use pcr amplification.
Computational algorithm, as expectation-maximization (EM), subtraction and PHASE is that the process useful that the statistics of haplotype is estimated (is seen, for example, Clark, A.G.Inference of haplotypesfrom PCR-amplified samples of diploid populations.Mol BiolEvol 7,111-22. (1990); Stephens, M., Smith, N.J.﹠amp; Donnelly, P.A new statistical method for haplotype reconstruction frompopulation data.Am J Hum Genet 68,978-89. (2001); Templeton, A.R., Sing, C.F., Kessling, A.﹠amp; Humphries, S.A cladisticanalysis of phenotype associations with haplotypes inferredfrom restriction endonuclease mapping.II.The analysis ofnatural populations.Genetics 120,1145-54. (1988)).
All methods discussed above all are useful method, and it can be used for definite haplotype according to the inventive method.
Embodiment
Embodiment 1:PLIN polymorphism is to the special effect of sex from obesity correlated variables in the seashore individuality of Mediterranean Sea, Hispanic east
Material and method
Experimenter and research and design
Comprise 1746 incoherent white people experimenters in this report altogether.This research colony comprises 1589 individualities (sample 1) of being selected from seashore Valencia district, Mediterranean Sea, Hispanic east at random and 157 obese subjects (sample 2) from the general hospital polyclinic of university that is positioned at identical geographic region (UniversityGeneral Hospital).In brief, sample 1 is made up of 788 men and 801 woman, and their age is 18-85 year, and they are selected from and participate in the individuality (14,15) of research that purpose is to determine the ubiquity of the h and E cardiovascular risk factor in the Spaniard colony of Mediterranean Sea.This sample comprises the workman that computerize population registration that use to bring in constant renewal in is selected at random, and the experimenter (15,16) who selects at random from general groups.All these experimenters check in the period of 1999 and 2002.Sample 2 is that 29 men and 128 woman in 18-78 year form by the age, they are selected from the Endocrinology Department (Endocrinology Unit) of the general hospital polyclinic of university of Valencia at random, are selected from the individuality of those treatments that continue to lose weight in the period of 2001 and 2002.Baseline data is used in this research.Research approach obtains the approval of the Ethics Committee of Valencia University and general hospital polyclinic of university.For all experimenters that comprise provide the informed consent of participating in and have checked available PLIN genotype and the data of its dependent variable.The experimenter's of sample 1 mean age is 41.5 ± 13.4 years old, sample 2 be 47.0 ± 13.7 years old.Transverse section method and case-control method in statistical analysis, have been used.In the case-control method, with 438 experimenters (157 from hospital, 281 from general groups) if at their weight index (BMI) 〉=30Kg/m 2The time be categorized as fat.Remaining 1308 experimenters from general groups are categorized as NO.
Somatometry and blood pressure measurement
Use standard technique to carry out somatometry: the body weight of wearing light clothes by the digital scale measurement; Do not wear the height of footwear by the fixed stadia surveying.BMI is calculated as body weight (kg)/height (m 2).Waistline is measured in mid-way between rib lower edge and crista iliaca in a horizontal plane.Produce the point measurement hip circumference of maximum perimeter at buttocks.Mercurial sphygmomanometer with calibration is measured blood pressure according to WHO MONICA scheme, and the mean value of twice continuous-reading of the first time and the 5th Korotkoff sound is respectively applied for systolic blood pressure and diastolic blood pressure (SBP and DBP).
Biological chemistry, clinical and mode of life data
Fasting was at least 12 hours before the indication participator checked in the morning.Venous blood is collected in the Glass tubing that contains EDTA.By Technicon Chem 1 assay method (TechniconInstruments, Tarrytown, NY) determine total plasma cholesterol and TAG, contain the high density lipoprotein cholesterol of measuring behind the lipoprotein of apolipoprotein B in the supernatant liquor (HDL-C) with heparin-Manganous chloride tetrahydrate precipitation.Be lower than the sample of 400mg/dL for serum T AG concentration, calculate low density lipoprotein cholesterol (LDL-C) according to people's such as Friedewald (17) equation.With the fasting glucose in the hexokinase test kit measurement fresh sample.
By assess data as the questionnaire of self using of preceding report about sex, date of birth, ethnic division, marital status, education, medical treatment, health problem, diabetes B history, smoking, alcohol consumption and body movement.(14) current smoker is defined as the individuality of inhaling at least one cigarette every day.By about carefully estimating alcohol consumption with one group of 22 problem using alcoholic beverage weekend on weekdays.From idle time body kinematics about routine, and the problem estimation body movement that spends in every kind of active mean hours number weekly.According to type and time, the experimenter is categorized as (the no sports) of sitting, medium (a kind of motion was less than 3 hours/week) and (a kind of motion is greater than the 3 hours/week or above 2 kinds of motion/weeks) of height.(no sports) and the active (medium adds highly) that then this variable two are divided into sitting.Education is divided three classes: elementary, medium and university [comprising cycle I (3 years) and cycle II (5 years or more than)] (14,15).
DNA extraction and gene type assay
By phenol-chloroform extract and ethanol sedimentation from the white corpuscle isolation of genomic DNA.The description and the title of 6 kinds of single nucleotide polymorphism (SNP) of checking in this research provide in Fig. 1 and table 1.According to nearest recommendation name polymorphism (18).Canonical sequence is GI21431190 (GenBank).Extend the enforcement gene type assay with mononucleotide.At first, the dna fragmentation that comprises 4 polymorphisms by multiplex PCR (PCR) amplification.Used primer provides in table 1.For PLIN1, PLIN2, PLIN3, PLIN4, PLIN5 and PLIN6, the PCR product is respectively 422bp, 391bp, 318bp, 350bp, 190bp and 469bp.In the 10 μ l reaction volumes that contain every kind of dNTP of 0.2mmol/l, every kind of primer of 0.2 μ mol/l, 3.0mmol/l magnesium chloride and 0.8U Qiagen Hotstar Taq polysaccharase, carry out pcr amplification.The PCR cycling condition be 95 ℃ 10 minutes, be 95 ℃ 30 seconds, 70 ℃ of 7 round-robin 30 seconds and 72 ℃ 1 minute then, be 95 ℃ 30 seconds, 65 ℃ of 41 round-robin 30 seconds and 72 ℃ 1 minute then.When finishing, scheme comprises 72 ℃ of final extension stages of 2 minutes.With PCR product and every kind of exonuclease I of 2.5U (New England Biolabs, Inc.Beverly, MA) and calf small intestine Phosphoric acid esterase (New England Biolabs, Inc.Beverly, MA) 37 ℃ of incubations 60 minutes to remove uncorporated dNTP and primer.Then 75 ℃ of incubations 15 minutes with the described enzyme of deactivation.
Subsequently, (Applied Biosystems, Foster City CA) carry out mononucleotide and extend with ABI Prism SnaPshot multiplicated system.The probe that is used for the mononucleotide extension is listed at table 1.Containing 1.5 μ l Snapshot Ready ReactionMastermix (Applied Biosystems with the PCR thermal cycler, Foster City, CA), carry out extension in the 5 μ l reaction mixtures of 1.0 μ l water and 1.5 μ l multiple PCR products and 1.0 μ l probe mixture (be 1.5 μ mol/l and be 2.0 μ mol/l) for PLIN5 and PLIN6 for PLIN1, PLIN2, PLIN3 and PLIN4.Reaction conditions is 96 ℃ 30 seconds, 50 ℃ of 35 round-robin 30 seconds and 60 ℃ 30 seconds.With reaction product and 3U calf small intestine Phosphoric acid esterase 37 ℃ of incubations 60 minutes to remove uncorporated dNTP, then 75 ℃ of incubations 15 minutes with inactivator.((Applied Biosystems, Foster City CA) carry out gene type assay CA) to go up use Genotyper version 3 .7 for Applied Biosystems, Foster City at ABI Prism 3100 genetic analyzers with end product.
Statistical analysis
Estimate gene frequency by the gene counting, and calculate 95% fiducial interval (CI).With the difference between x2 check (Pearson, Fisher rigorous examination, perhaps Monte Carlo method) test observed frequency and the expected frequency, thus hypothesis Hardy-Weinberg balance, check linkage disequilibrium, and the difference of check percentage ratio.Estimate to pursue by the LINKAGE program to the linkage disequilibrium coefficient.Calculate (D/Dmax) coefficient of D and D '.By EH program estimation unit type, this program uses expectation-maximization algorithm to obtain the maximum likelihood estimation of haplotype frequency.Check the normal distribution of all continuous variables.Logarithm glycerine converting three esters are to improve normality.The application parameter check is to compare mean value.In addition, case load very hour is used nonparameter test (Mann-Whitney or Kruskal-Wallis) in each subgroup.Use have dummy variables for sorting item multiple linear regression analytical study genetic variant with obesity uncorrelated null hypothesis between the relevant phenotype.These statistical models allow us to regulate the back for concomitant variable to estimate the related of genetic polymorphism and each dependent variable (phenotype that obesity is relevant).Main concomitant variable is sex, age, BMI or mode of life factor (smoking, alcohol consumption, body movement and education).Estimate the adjustment mean number of regression coefficient and each predictor from described model.By in more brief linear regression model (LRM), introducing the homogeneity of interactional respective items check according to the allelotrope effect of sex or heredity or environmental factors.Guarantee the appropriateness of these models with the standard regression diagnostic method.In classification analysis, obesity two minutes is defined as BMI 〉=30kg/m 2Match logarithm regression model is to estimate danger: compare the odds ratio (OR) of the obesity relevant with the existence of every kind of genetic variant and 95% fiducial interval (CI) with wild-type.Also match have and the polylogarithm regression model that interacts so that the effect of concomitant variable and effect modifier is adjusted.The SPSS (version 10.0) that use is used for windows carries out association analysis.
The result
Identify new polymorphism, frequency and linkage disequilibrium
We use two kinds of different strategies to search polymorphism (Fig. 1) on the PLIN locus.At first, we may relate to the common mutations of the adjusting of PLIN gene with searching to 5 ' the district order-checking of PLIN gene among 40 uncorrelated experimenters.We concentrate on those districts (21) significantly conservative between people and mouse sequence.These analyze any common mutations that does not disclose in the district that is checked through.Is our second method based on common polymorphism (the http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi that seeks in the public snp database? locusId=5346).We are based on the initial target of following Standard Selection: 1) SNP in the exon is better than the SNP in the intron; 2) if several SNP clusters in stenosis area, so only select they one of.Selected the SNP (table 1) of 6 kinds of reports at first, their two kinds (PLIN2 and PLIN3) are not polymorphisms, and our analysis is based on other four kinds of SNP (PLIN1, PLIN4, PLIN5 and PLIN6).
Table 2 has shown in this research 1746 uncorrelated experimenters' that check demography, biological chemistry and mode of life feature: 1589 from general groups (sample 1), the obesity patient of 157 morbid state of being in hospital (sample 2).In sample 1, the scope of BMI is 16.2 to 52.5Kg/m 2, only 4% experimenter has BMI 〉=35Kg/m 2In sample 2, the scope of BMI is 30.1 to 79.1Kg/m 2, wherein 88% experimenter has BMI 〉=35Kg/m 2The PLIN genotype of population sample 1, gene frequency and linkage disequilibrium coefficient provide in table 3.Genotype distributes and does not depart from the Hardy-Weinberg expectation.Neutral other difference is not remarkable for arbitrary polymorphism because genotype distributes, thus men and women's data are merged, and whole sample is estimated gene frequency and by to the linkage disequilibrium parameter.The allelotrope 2 (G) of PLIN5 locus is the most general genetic mutation (gene frequency: 0.385 in sample 1; 95%CI 0.368 to 0.402); And the allelotrope 2 (A) of PLIN4 locus is more not general (gene frequency: 0.262; 95%CI 0.247 to 0.278).Between PLIN1 polymorphism and PLIN4 polymorphism, find the strongest by to linkage disequilibrium (D ': 0.958; P＜0.001).Although observed positive linkage disequilibrium is that statistics is significant between other polymorphisms, and is much lower, D ' coefficient is 0.453 to 0.149 (table 3).Ubiquity in the sample 2 between the PLIN polymorphism is not different with sample 1 with linkage disequilibrium.Similarly, genotype is distributed in and does not have difference between the men and women in the sample 2.The more uncommon gene frequency of PLIN1, PLIN4, PLIN5 and PLIN6 polymorphism is respectively 0.37 (0.32-0.43) in the sample 2; 0.24 (0.19-0.29); 0.40 (0.35-0.46) with 0.38 (0.33-0.46).Yet the small sample size of this group has influenced the random error of these estimations to a great extent.Thereby only all determine genotypic individual estimation unit type (table 4) from sample 1.Estimate that all 16 kinds four kinds of possible polymorphism haplotypes all are present in the colony of this people from Mediterranean Sea.((" 6209T/11482G/13041A/14995A " also is called " 1111 ") is the most general to the haplotype of being made up of the highest allelotrope of the frequency of every kind of polymorphism, has 0.388 relative frequency.In 15 kinds of remaining haplotypes, only 4 kinds have and are higher than 0.08 gene frequency, comprise the haplotype of being made up of the allelotrope of the frequency minimum of every kind of polymorphism (" 6209C/11482A/13041G/14995T " is also referred to as " 2222 ").
Association between the relevant phenotype of PLIN polymorphism and obesity.Single polymorphism gene type assay
We then check the association between PLIN polymorphism and the obesity correlated variables.Consider clinical difference and mode of life difference between sample 1 and the sample 2, experimenter and obesity patient from general groups are carried out association analysis separately.In order to increase the statistics detectivity, and, be homozygote or more uncommon allelic carrier (1/2+2/2) to the common allele of each polymorphism with individual segregation in confirmation and dominance or at least after the existence of the compatible allelotrope effect of codominant inheritance model.
Association in the sample 1
At first, we have assessed the homogeneity of the hereditary effect that sex produces and have proved several important interactions.Therefore, every kind of sex of our separate analysis.Table 5 has shown the carrier's state according to four kinds of PLIN polymorphisms allelotrope 2 variants in each, the mean value of regulating from the age of BMI among sample 1 man and other obesity correlated variabless.We do not find between the genotype group significant difference about BMI, body weight, waist-stern ratio, glucose, total cholesterol, HDL-C, LDL-C, TAGs and blood pressure.Yet we find in from the woman of sample 1 significantly different for BMI between the genotype of PLIN1 and PLIN4 polymorphism, wherein allelotrope 2 and lower BMI relevant (table 6).For the PLIN1 polymorphism, the mean value of BMI is 26.3 ± 0.3Kg/m in 1/1 homozygote 2, with respect to being 25.3 ± 0.2Kg/m among the woman who carries allelotrope 2 2(p=0.004); For the PLIN4 polymorphism, the mean value of BMI is 26.1 ± 0.2Kg/m in 1/1 homozygote 2, with respect to being 25.2 ± 0.3Kg/m among allelotrope 2 carrier 2(p=0.004).Similarly, the woman that the carrier's of allelotrope 2 body weight is significantly isozygotied less than (p=0.007) wild type gene type on the PLIN1 locus.For the lower allelic carrier of PLIN4 locus frequency also being (p=0.01) like this.In addition, compare with 1/1 homozygote, the woman carrier of the allelotrope 2 of PLIN4 polymorphism shows lower waist-stern than (p=0.032), lower fasting glucose (p=0.008) and lower blood plasma TAG concentration (p=0.005).Find similar difference for the PLIN1 polymorphism, wherein the boundary line P value of fasting glucose is 0.090, and TAG's is 0.099.Significant gene-sex that two kinds of SNP (PLIN1 and PLIN4) show decision BMI and body weight interacts.In addition, for the PLIN4 polymorphism, we find to determine that waist-stern interacts than the significant gene * sex of (p=0.023) and TAGs (p=0.009).All do not detect significant gene * sex interaction for PLIN5 polymorphism and PLIN6 polymorphism.
The carrier of the allelotrope 2 of every kind of polymorphism and non-carrier do not have significant difference (result does not show) for smoking among the men and women, alcohol consumption, education, body movement and diabetes.Therefore, the difference that PLIN1 and PLIN4 polymorphism are found in addition for these potential obscure also keep after factor (confounder) is regulated significance,statistical (for the PLIN1 polymorphism, for BMI and body weight, p=0.012 and p=0.020; For the PLIN4 polymorphism, be respectively p=0.014, p=0.029, p=0.046, p=0.003 and p=0.042) for BMI, body weight, waist-stern ratio, glucose and TAG.Additional adjustment to BMI and pharmacotherapy does not change significance [being 116.4 ± 1.3mg/dL among the non-carrier, with respect to being 113.7 ± 1.7mg/dL (p=0.010) among the carrier of allelotrope 2] related between fasting glucose and blood plasma lipide and the PLIN4 genotype.Yet the difference in the TAG concentration is not significant (p=0.327) on the statistics.
Association in the sample 2
When we carry out similar association analysis in morbid obesity subject group (sample 2), in the men and women, all detect reducing of the BMI relevant with allelotrope 2 in PLIN1 and the PLIN4 polymorphism.This reduces among the man of allelotrope 2 in carrying the PLIN4 polymorphism higher and be significant on the statistics.Opposite with observed result in the man from general groups, in this group that mainly is the morbid obesity man, PLIN SNP is relevant with significant difference among the BMI.Thereby for PLIN4, in non-carrier, the mean value that the age of BMI is regulated is 45.9 ± 1.9Kg/m 2, the mean value of regulating with respect to the age of BMI in 2 allelic man carrier is 35.6 ± 1.3Kg/m 2(p=0.001).Similarly, in non-carrier, the mean value of the adjusting of body weight is 141.3 ± 6.0Kg, with respect to being 107.9 ± 6.3Kg (p=0.001) in 2 allelic carrier.Although the case number is little, these results are consistent and are significant on the statistics in parameter and nonparameter test among the fat man.In fat woman from sample 2, observed BMI and body weight reduce observed result among the woman who is similar to from general groups in the carrier of the allelotrope 2 of PLIN4 polymorphism, yet, because woman's number was lower in should organizing, [the age mean value of adjusting is: the non-carrier of the allelotrope 2 of PLIN4 SNP is with respect to being respectively 43.1 ± 0.9Kg/m among the carrier so this difference does not reach significance,statistical 2With respect to 41.1 ± 6.3Kg/m 2(p=0.199) and 108.2 ± 2.1Kg with respect to 102.4 ± 2.9Kg (p=0.112)].The further multivariate of smoking, alcohol consumption, education, body movement and diabetes is regulated the significance,statistical that does not influence these results.Although the reduction of BMI is relevant with allelotrope 2 in these obese subjects, TAG concentration is remarkable difference with regard to genotype not.In addition, in these experimenters, the carrier of the allelotrope 2 of PLIN4 polymorphism demonstrates higher plasma glucose concentration than non-carrier.This influence all notices in the men and women, and with viewed different from the phase isoallele among the general groups experimenter.Thereby, in man from sample 2, PLIN4 2 allelic non-carrier with respect to the carrier in, blood plasma fasting glucose concentration is that 94.5 ± 7.9mg/dL is with respect to 117.1 ± 7.7mg/dL (interactional P:PLIN4* obesity=0.028), and in the man from sample 1, do not note the difference.On the contrary, in woman from general groups, find the reduction of the plasma glucose relevant with allelotrope 2, and in the woman from sample 2, (PLIN4 2 allelic non-carrier are with respect to being respectively 102.4 ± 3.5mg/dL among the carrier with respect to 108.2 ± 3.9mg/dL) to observe the increase of plasma glucose concentration.In measuring fasting glucose concentration, also obtained the statistics item that interacts significantly about PLIN1, the PLIN5 of obesity and PLIN6 polymorphism.
The PLIN haplotype is related with the metabolism syndrome correlated variables
We have also estimated the influence of the PLIN haplotype pair several variablees (BMI, TAG and fasting glucose) dangerous relevant with metabolism syndrome.11 kinds of 16 kinds of possible haplotypes take place with low-down relative frequency (being lower than 5%).Therefore, we have used dummy unit type method, are undertaken by the influence of the homozygosity of common haplotype and the influence of genotypic selected combination, and this depends on their frequency and the particular association analysis of being carried out.At first, mix the influence adjusting from the result in table 5 and 6 for the corresponding of other polymorphisms by in multivariate regression model, comprising these variablees factor in contrast.Consider association higher between PLIN1 and the PLIN4, do not regulate these variablees simultaneously mutually so that avoid the multicollinearity bias.Thereby, related with PLIN4 for PLIN5 with PLIN6 polymorphism adjusting PLIN1, regulate PLIN5 and regulate PLIN6 for PLIN4 and PLIN6 for PLIN4 and PLIN5.Being associated among the woman between PLIN1 polymorphism and the BMI keeps significance,statistical (p=0.002) after these are regulated.In addition, the boundary line statistics of PLIN1 polymorphism and fasting glucose reaches significance,statistical (p=0.032) after significantly being associated in and regulating for the PLIN6 polymorphism among the woman, and the decline a little after for PLIN5 (p=0.056) and PLIN6 (p=0.085) adjusting of the P value of triglyceride level.Similarly, after PLIN5 and the adjusting of PLIN6 polymorphism, the independent effect of PLIN4 polymorphism is confirmed among the woman, and the front is reported in table 6 is associated in these and regulates the back and keep that significant on statistics (after regulating for PLIN5 and PLIN6 simultaneously, BMI, fasting glucose and TAG are respectively p=0.023; P=0.015; P=0.035).In the man, after regulating for extra genetic variant, the result in the table 5 do not detect remarkable change.
We have also studied the potential collaborative association between PLIN1 and PLIN4 and the correlated variables.To be divided into three classes from the experimenter of sample 1: 1) allelotrope 1 is all isozygotied at PLIN1 and PLIN4 SNP; 2) 2 of PLIN1 or PLIN4 allelic carrier and the 3) carrier of PLIN1 and PLIN4 allelotrope 2.Fig. 2 has shown according to the genotype that makes up among the woman from sample 1, the mean value that the age of BMI is regulated.In addition, regulate model for PLIN5 and PLIN6SNP.Two kinds of SNP variablees that made up and BMI be related (p=0.007) significantly, wherein from woman's homozygote of modal haplotype " 11 " woman (25.1 ± 0.3Kg/m than at least one allelotrope 2 that carries PLIN1 and PLIN4SNP 2) demonstrate higher BMI (26.3 ± 0.3Kg/m 2P=0.002).At least one 2 allelic carrier of PLIN1 or PLIN4 SNPs have middle BMI phenotype.We also find the SNP variable that makes up and the statistics between the TAG significantly related (p=0.020) and and glucose between statistics significantly related (p=0.040), isozygoty for modal haplotype with maximum concentration.
When PLIN5 and PLIN6 polymorphism are carried out the gene type assay of this combination, after extra adjustment, do not detect from the association between this haplotype variable and any obesity correlation parameter among the man of sample 1 or the woman to PLIN1 and PLIN4.Fig. 3 has shown the genotype according to combination among woman's (sample 1), the mean value that the age of BMI is regulated.Although be not significant, the frequency carrier of isozygotying of high haplotype is compared with other haplotypes and is had minimum BMI value.
We use all four kinds of polymorphisms to carry out similar analysis.For this reason, we have considered four groups: 1) experimenter-haplotype " 1111 " of isozygotying of common allele; 2) homozygote of the common allele of PLIN1 and PLIN4 and the carrier of PLIN5 and PLIN6 place allelotrope 2; 3) homozygote of the common allele in the carrier of PLIN1 and PLIN4 place allelotrope 2 and PLIN5 and PLIN6 place; 4) PLIN1, PLIN4 and PLIN5 and the 2 allelic carrier of PLIN6 place.In analyzing, these do not comprise the experimenter who carries any other genotype combination.In order to increase the statistics detectivity, merge from the individual of sample 1 and sample 2 and analysis together.Fig. 7 has shown according to the genotype that merges, the mean value that the age of body weight and BMI is regulated among the men and women.In the woman, height statistics significant association between the genotype variable that find to merge and body weight and the BMI, wherein on PLIN1 and the PLIN4 locus on the carrier of allelotrope 2 and PLIN5 and the PLIN6 homozygote of common allele demonstrate Schwellenwert.In the man, we do not find any remarkable association between hereditary group and BMI or the body weight.
The obesity danger relevant with PLIN genovariation
At last, in order to estimate the danger of the obesity relevant, will merge from the experimenter of sample 1 and sample 2, and divide subdivision: non-obese subjects (BMI＜30kg/m according to BMI with the PLIN variant 2) and fat (BMI 〉=30kg/m 2).In the man, do not detect the significant difference in any PLIN polymorphism ubiquity between fat and the non-obesity.Yet, in the woman,, detecting with non-obese subjects and compare for the PLIN1 polymorphism, (50.2% with respect to 60.4% to carry experimenter's the lower ubiquity of allelotrope 2 in the obese subjects; P=0.004).Because be fat different, so in the logarithm regression model, the age adjusted danger estimate (OR) with the non-obese subjects age.After this was adjusted, the woman who carries PLIN1 polymorphism place allelotrope 2 compares with non-carrier had low dangerous obesity: OR:0.65; 95%CI, 0.48 to 0.88.Similarly, the ubiquity of carrying the woman of PLIN4 polymorphism place allelotrope 2 is lower than (32.5% pair 45.2% of non-fat group in the obesity group; P＜0.001).After the age adjustment, allelotrope 2 is related with the low danger of obesity among the woman all the time on the PLIN4 locus, OR:0.60; 95%CI, 0.44 to 0.83.In addition, after smoking, alcohol consumption, body movement, diabetes and education adjustment, these estimate to keep significance,statisticals.In the gene type assay of two kinds of polymorphisms combination and after the age is adjusted, the woman who carries allelotrope 2 on PLIN1 and the PLIN4 SNP has lower obesity danger and (compares (OR:0.56 with the homozygote of common allele; 95%CI 0.39 to 0.79; P=0.001), only the carrier of an allelotrope 2 compares the statistically-significant difference (OR:0.95 that does not demonstrate obesity danger with common allele homozygote and on PLIN1 or PLIN4 locus; 95%CI:0.63 to 1.43).These results are further adjusting not change of back for PLIN5 and PLIN6 polymorphism.For PLIN5 and PLIN6 locus, do not have all in the gene type assay of single polymorphism analysis and combination to find that the statistics dangerous relevant with obesity is significantly related.
Discuss
The verified fat that encloses of the research of using experimental model to carry out drips albumen by playing an important role (7 in the TAG storage of lipolysis in adipocyte of regulating basic lipolysis and hormonal stimulation; 11,12).We after deliberation in the sample of Caucasian's individuality four kinds of common new PLIN polymorphisms and obesity, lipid metabolism and insulin sensitivity measure related, and we have proved first that the variation on people PLIN locus is always relevant with the obesity correlated variables, thereby prompting is enclosed fat and dripped albumen and may and may play dependent interaction to the development of metabolism syndrome in people's obesity, hypertriglyceridemia.In addition, we have found that in general groups most associations are that sex is special, mainly influence the woman.
Association between the relevant phenotype of PLIN polymorphism and obesity.Single polymorphism gene type assay.
In our analysis, we use the association between case-control and transverse section method research PLIN polymorphism and the obesity correlated measure.In the case-control design that comprises from the obese subjects of general groups and the obese patient that is in hospital, and after potential Confounding Factor is regulated to age and other, we have found that unanimity and the lower significantly obesity danger of statistics among the woman of the allelotrope 2 that carries the PLIN1 polymorphism.Should association at PLIN4 SNP but do not found at the allelotrope 2 of PLIN5 or PLIN6 polymorphism.Low these results of chain support of strong linkage disequilibrium between PLIN1 and the PLIN4 (D '＞0.9) and they and other two kinds of SNP.In addition, the obesity of in the woman, seeing relevant with the more not common allele of PLIN4 SNP low dangerous with to drip the discovery of the invalid mouse of albumen parallel to enclosing fat with PLIN1, fat will drip proteic elimination and thin phenotype connects (11,13) thereby will enclose.In addition, the deactivation of PLIN gene also protects Lepr (db/db) mouse to avoid suffering from obesity, and Lepr (db/db) mouse is the genetic model (13) of the obesity that causes of RMETHU LEPTIN resistance.Emphasized sexual hormoue factor importance in body weight and the fat distribution in the mediator from shortage significantly related among the man of general groups.
In the sample from general groups, the more uncommon allelic woman carrier of PLIN1 and PLIN4 SNP compares the woman that common allele isozygotys and has significantly lower BMI of statistics.In addition, we find that the more uncommon allelic woman carrier of PLIN4 SNP has significantly lower plasma glucose and TAG concentration.In addition, the PLIN4 polymorphism also with the woman in waist-stern of reducing than related, prompting is to the bigger effect of belly (internal organ) fat depot.This discovery is even more important, because belly (internal organ) fat and metabolism syndrome: glucose intolerance, dyslipidemias mass formed by blood stasis, insulin resistant, hypertension and cardiovascular disorder and diabetes B height related (19).In addition, this phase isoallele is also related with lower fasting glucose level.In these are, an interesting discovery of our research be in determining plasma glucose concentration between PLIN1 polymorphism and the obesity unanimity and statistics interact significantly.On the contrary, in from the man of general groups, do not observe remarkable association.
In the fat woman from sample 2, although the allelotrope 2 of PLIN4 SNP and the consistent cognation of hanging down between the BMI, this equipotential gene is related with higher plasma glucose concentration.Yet, these results and people (11) such as Tansey enclose fat drip observation in the albumen knock-out mice consistent and with people's (13) such as Martinez-Botas discovery unanimity.The lipid acid that discharges from fatty tissue participates in the development of diabetes B, and people can expect that the invalid mouse of Peri is to the insulin resistant sensitivity.People such as Martinez-Botas (13) can not detect the glucose intolerance in their the invalid animal of Peri, and people's (11) such as Tansey more detailed research has repeated the discovery of people such as Martinez-Botas (13) in the animal of body weight less than 30g.Yet, when animal surpasses 30g, compare with wild-type, in the invalid mouse of Peri, produce significant glucose intolerance.This and following identical of views: in case that individuality becomes is fat, the fat that encloses that protection avoids obesity drips albumen and can cause more deleterious phenotype.In addition, although in man, do not find of the effect of PLIN allelotrope, in fat man to the blood plasma fasting glucose from general groups, allelotrope 2 is also relevant with higher glucose concn, has further proved the influence of obesity-interaction hypothesis.Relate to interactional another interesting discovery between obesity and the PLIN SNPs and relate to related with from low BMI among the man of sample 2 of allelotrope 2 on the PLIN4 locus.These discoveries are consistent with this equipotential gene effect in the woman, and caused following hypothesis: special higher obesity or some undetected environmental factorss causes the allelic effect of PLIN among the fat man of needs.
These related Basics of Biology are not clear.It is functional that the polymorphism of checking in our research does not have a kind of.PLIN1 and PLIN4 both are the intron sudden changes.PLIN5 is the silent mutation in the exon 8, and PLIN6 is positioned at the non-translational region of exon 9.These sudden changes not the modifying protein structure and, usually, do not consider that also they have regulatory function.Yet, some evidences show the intron polymorphism can also by influence nf in conjunction with regulatory gene expression (20).Enclose fat drip albumen be in the adipocyte bag by the rich in protein (4-6) on lipid droplet surface.Behind the nearest report, their physiology association has become obviously, and described report shows that the invalid mouse of PLIN compares with wild-type mice and have the basic lipolysis (11,13) that increases in significantly reduced fat storage and their the isolating adipocyte.Based on these data, to be PLIN1 with the PLIN4 polymorphism may express with PLIN gene low or impaired enclose fat to drip protein-active relevant in the possible explanation of our discovery.Alternative hypothesis is the LD that these polymorphisms directly relate to or participate in having the sudden change that changes the mRNA montage.PLIN4, PLIN5 and PLIN6 all with the zone that is subjected to alternative splicing near (see figure 1).All enclose fat and drip the total identical 22-kDa amino-terminal end of albumen, and they have the different C-terminal sequences (21) of different lengths.Two kinds of main splice variants of PLIN gene enclose fat and drip albumin A and enclose fat and drip protein B and demonstrate and reply the PKA activated is different, and may bring into play the difference protection to lipolysis.Textural difference between these splice variants, the length that particularly influences the C-terminal tail of droplet surface parcel can be determined their function.
The growth and the distribution of genotypic sex-specific effect of PLIN and fatty tissue, and the special difference unanimity of the sex in the danger of obesity relative disease.The steatolysis ability, i.e. one of most important determinative of fatty tissue accumulation also shows it is (22,23) of sex-dependent.Current data be can not determine the effect whether sexual hormoue can modify the PLIN gene, and does not currently have available data to come explanatory hormone and enclose fat to drip interaction between the protein function.We suppose that unknown mechanisms that oestrogenic hormon can be illustrated by needs enlarges the protection effect of PLIN variant, and testosterone does not act on the protection effect of PLIN variant or this effect is minimized.
Association between the relevant phenotype of PLIN polymorphism and obesity
Haplotype is analyzed
Our data show obesity danger lower among the woman who carries allelotrope 2 on PLIN1 and the PLIN4 SNP, point out these SNP may be with additivity or cooperative mode effect.The complex character susceptibility is subjected to the control of the compound action of several different variants in the gene usually.Therefore, our biological effect that proposes these marks be correlated with but they are not related with the identical function sudden change.
Measuring that PLIN5 is not relevant with other obesity with BMI respectively with PLIN6 SNPs is relevant.Yet the haplotype analysis has disclosed more interesting picture.We find to carry PLIN1 and PLIN4 but are not that the allelic woman of variant of PLIN5 and PLIN6 demonstrates minimum body weight and BMI (62.9Kg and 24.8kg/m 2).The allelic existence of variant of PLIN5 and PLIN6 and the highest body weight and BMI (72.2.Kg and 28.7Kg/m when on the contrary, not having the more not common allele of PLIN1 and PLIN4 2) association, this is about 15% a biology significant difference between opposite haplotype.
In a word, the association between the PLIN genotype and obesity correlated measure among the mankind is reported in our research first.This with from the recent findings of linkage analysis and from the data consistent of the continuous appearance of animal model.The associated problem of waiting until exploration relate to the potential dependent interaction between these SNP and the dietary factor.Consider that enclosing fat drips relation between protein expression and the fatty acid metabolism, this be relevant (24).
Embodiment 1 reference
1.Hager?J，Dina?C，Francke?S，Dubois?S，Houari?M，Vatin?V.，Vaillant?E，LorentzN，Basdevant?A，Clement?K，Guy-Grand?B，and?Froguel?P(1998)A?genome-wide?scan?for?human?obesity?genes?reveals?a?major?suscetptibility?locus?onchromosome?10.Nat.Genet.，20，304-308.
2.Zamani，M.，Pociot，F.，Raeymaekers，P.，Nerup，J.，and?Cassiman，J.J.(1996)Linkage?of?type?I?diabetes?to?15q26(IDDM3)in?the?Danish?population.Hum.Genet.，98，491-496.
3.Greenberg?AS，Egan?JJ，Wek?SA，Garty?NB，Blanchette-Mackie?EJ，andLondos?C(1991)Perilipin，a?major?hormonally?regulated?adipocyte-specificphosphoprotein?associated?with?the?periphery?of?lipid?storage?droplets.J.Biol.Chem.，266，11341-11346.
4.Greenberg?AS，Egan?JJ，Wek?SA，Moos?MC，Jr.，Londos?C，and?Kimmel?AR(1993)Isolation?of?cDNAs?for?perilipins?A?and?B：sequence?and?expression?oflipid?droplet-associated?proteins?of?adipocytes.Proc.Natl.Acad.Sci.U.S.A，90，12035-12039.
5.Nishiu?J，Tanaka?T，and?Nakamura?Y(1998)Isolation?and?chromosomalmapping?of?the?human?homolog?of?perilipin(PLIN)，a?rat?adipose?tissue-specific?gene，by?differential?display?method.Genomics，48，254-257.
6.Servetnick?DA，Brasaemle?DL，Gruia-Gray?J，Kimmel?AR，Wolff?J，andLondos?C(1995)Perilipins?are?associated?with?cholesteryl?ester?droplets?insteroidogenic?adrenal?cortical?and?Leydig?cells.J.Biol.Chem.，270，16970-16973.
7.Brasaemle?DL，Rubin?B，Harten?IA，Gruia-Gray?J，Kimmel?AR，and?Londos?C(2000)Perilipin?A?increases?triacylglycerol?storage?by?decreasing?the?rate?oftriacylglycerol?hydrolysis.J.Biol.Chem.，275，38486-38493.
8.Blanchette-Mackie?EJ，Dwyer?NK，Barber?T，Coxey?RA，Takeda?T，Rondinone?CM，Theodorakis?JL，Greenberg?AS，and?Londos?C(1995)Perilipin?is?located?on?the?surface?layer?of?intracellular?lipid?droplets?inadipocytes.J.Lipid?Res.，36，1211-1226.
9.Londos?C，Brasaemle?DL，Gruia-Gray?J，Servetnick?DA，Schultz?CJ，LevinDM，and?Kimmel?AR(1995)Perilipin：unique?proteins?associated?withintracellular?neutral?lipid?droplets?in?adipocytes?and?steroidogenic?cells.Biochem.Soc.Trans.，23，611-615.
10.Londos?C，Gruia-Gray?J，Brasaemle?DL，Rondinone?CM，Takeda?T，DwyerNK，Barber?T，Kimmel?AR，and?Blanchette-Mackie?EJ(1996)Perilipin：possible?roles?in?structure?and?metabolism?of?intracellular?neutral?lipids?inadipocytes?and?steroidogenic?cells.Int.J.Obes.Relat?Metab?Disord.，20?Suppl3，S97-101.
11.Tansey?JT，Sztalryd?C，Gruia-Gray?J，Roush，DL，Zee?JV，Gavrilova?O，Reitman?ML，Deng?CX，Li?C，Kimmel?AR，and?Londos?C(2001)Perilipinablation?results?in?a?lean?mouse?with?aberrant?adipocyte?lipolysis，enhancedleptin?production，and?resistance?to?diet-induced?obesity.Proc.Natl.Acad.Sci.U.S.A，98，6494-6499.
12.Tansey?JT，Huml?AM，Vogt?R，Davis?KE，Jones?JM，Fraser?KA，BrasaemleDL，Kimmel?AR，and?Londos?C(2003)Functional?studies?on?native?andmutated?forms?of?perilipins：A?role?in?protein?kinase?A-mediated?lipolysis?oftriacylglycerols?in?CHO?celis.J.Biol.Chem.，278：8401-8406.
13.Martinez-Botas?J，Anderson?JB，Tessier?D，Lapillonne?A，Chang?BH，QuastMJ，Gorenstein?D，Chen?KH，and?Chan?L(2000)Absence?of?perilipin?resultsin?leanness?and?reverses?obesity?in?Lepr(db/db)mice.Nat.Genet.，26，474-479.
14.Corella?D，Guillen?M，Saiz?C，Portoles?O，Sabater?A，Cortina?S，Folch?J，Gonzalez?JI，and?Ordovas?JM(2001)Environmental?factors?modulate?theeffect?of?the?APOE?genetic?polymorphism?on?plasma?lipid?concentrations：ecogenetic?studies?in?a?Mediterranean?Spanish?population.Metabolism，50，936-944.
15.Corella?D，Guillen?M，Saiz?C，Portoles?O，Sabater?A，Folch?J，and?Ordovas?JM(2002)Associations?of?LPL?and?APOC3?gene?polymorphisms?on?plasmalipids?in?a?Mediterranean?population：interaction?with?tobacco?smoking?and?theAPOE?locus.J.Lipid?Res.，43，416-427.
16.Sorli?JV，Velert?R，Guillen?M，Portoles?O，Ramirez?JV，Iborra?J，and?Corella?D(2002)[Effects?of?the?apolipoprotein?E?polymorphism?on?plasma?lipid?levelsand?cardiovascular?disease?risk?in?a?Mediterranean?population].Med.Clin.(Barc.)，118，569-574.
17.Friedewald?WT，Levy?RI，and?Fredrickson?DS(1972)Estimation?of?theconcentration?of?low-density?lipoprotein?cholesterol?in?plasma，without?use?ofthe?preparative?ultracentrifuge.Clin.Chem.，18，499-502.
18.Antonarakis?SE(1998)Recommendations?for?a?nomenclature?system?forhuman?gene?mutations.Nomenclature?Working?Group.Hum.Mutat.，11，1-3.
19.Gasteyger?C，Tremblay?A(2002)Metabolic?impact?of?body?fat?distribution.J.Endocrinol.Invest，25，876-883.
20.Horikawa?Y，Oda?N，Cox?NJ，Li?X，Orho-Melander?M，Hara?M，Hinokio?Y，Lindner?TH，Mashima?H，Schwarz?PE，Bosque-Plata?L，Horikawa?Y，OdaY，Yoshiuchi?I，Colilla?S，Polonsky?KS，Wei?S，Concannon?P，Iwasaki?N，SchulzeJ，Baier?LJ，Bogardus?C，Groop?L，Boerwinkle?E，Hanis?CL，and?Bell?GI(2000)Genetic?variation?in?the?gene?encoding?calpain-10?is?associated?withtype?2?diabetes?mellitus.Nat.Genet.，26，163-175，
21.Lu?X，Gruia-Gray?J，Copeland?NG，Gilbert?DJ，Jenkins?NA，Londos?C，andKimmel?AR(2001)The?murine?perilipin?gene：the?lipid?droplet-associatedperilipins?derive?from?tissue-specific，mRNA?splice?variants?and?define?a?genefamily?of?ancient?origin.Mamm.Genome，12，741-749.
22.Lofgren?P，Hoffstedt?J，Ryden?M，Thorne?A，Holm?C，Wahrenberg?H，andArner?P(2002)Major?gender?differences?in?the?lipolytic?capacity?ofabdominal?subcutaneous?fat?cells?in?obesity?observed?before?and?after?long-term?weight?reduction.J.Clin.Endocrinol.Metab，87，764-771.
23.Kolehmainen?M，Vidal?H，Ohisalo?JJ，Pirinen?E，Alhava?E，and?Uusitupa?MI(2002)Hormone?sensitive?lipase?expression?and?adipose?tissue?metabolismshow?gender?difference?in?obese?subjects?after?weight?loss.Int.J.Obes.RelatMetab?Disord.，26，6-16.
24.Brasaemle，D.L.，Barber，T.，Kimmel，A.R.，and?Londos，C.(1997)Post-translational?regulation?of?perilipin?expression.Stabilization?by?storedintracellular?neutral?lipids.J.Biol.Chem.，272，9378-9387.
Example II: enclose fat in the white man colony from the U.S. and drip special related of albumen (PLIN) genetic unit type and the sex of obesity danger
Material and method
Experimenter and research and design
Comprise in this research and participate in living mode intervention plan (The PritikinLongevity Center, Santa Monica, CA) totally 734 white man experimenters of (19), 373 male sex (58.6 years old mean age) and 361 women (56.1 years old mean age).In this colony, report when the Ex smoker be experimenter's 10.2%, and alcohol consumption person (weekly＞1 time drink) is experimenter's 46.8%.Pharmacotherapy is used as follows: 10.1% takes hypoglycemic agents, and 16.1% takes pravastatin, and 14.9% carries out the thyroid drug therapy, and 35.7% female subjects carries out Hormone Replacement Therapy.Because restriction in the DNA operability, successfully obtained the genotype of PLIN 6209T＞C and 13041A＞G from 706 experimenters, and obtained PLIN 11482G＞A and 14995A＞T genotype from 705 experimenters.Obesity is defined as BMI 〉=30kg/m2.Somatometry and biological chemistry do not have significant difference in measuring between the individuality that has or do not have genotype information.
Biological chemistry is measured
Extract blood sample (baseline) on an empty stomach from all experimenters that enter this plan.Place the pipe that contains SST clot activated gel (Becton-Dickinson vacutainer system) to be used for lipid and glucose measurement blood sample, perhaps place the pipe that contains 0.1%EDTA to be used for lipophorin and measure.The sample that allows to be used for lipid and glucose measurement condenses and by with centrifugal 15 minutes separation of serum of 2500rpm.Measure total cholesterol (TC), high density lipoprotein cholesterol (HDL-C), triglyceride level (TG) and glucose level by standard automatization enzymatic means (Smith-Kline BeechamLaboratories), and (20) calculate low density lipoprotein cholesterol (LDL-C) as described previously.
DNA separates and gene type assay
Use QIA amp Blood Kit (Qiagen) from the separation of whole blood genomic dna.At first, the dna fragmentation that contains target SNP by multiplex PCR (PCR) amplification.The primer is displayed in Table 1.In the 10 μ l reaction volumes that contain every kind of dNTP of 0.2mmol/l, every kind of primer of 0.2 μ mol/l, 3.0mmol/l magnesium chloride and 0.8U Qiagen Hotstar Taq polysaccharase, carry out the PCR reaction.The PCR cycling condition be 95 ℃ 10 minutes, be 95 ℃ 30 seconds, 70 ℃ of 7 round-robin 30 seconds and 72 ℃ 1 minute then, be 95 ℃ 30 seconds, 65 ℃ of 41 round-robin 30 seconds and 72 ℃ 1 minute then.When finishing, this scheme comprises 72 ℃ of final extension stages of 5 minutes.With PCR product and every kind of exonuclease I of 2.5U (New EnglandBiolabs., Inc.Beverly, MA) and calf small intestine Phosphoric acid esterase (New EnglandBiolabs., Inc.Beverly, MA) 37 ℃ of incubations 60 minutes to remove uncorporated dNTP and primer, came the described enzyme of deactivation in 15 minutes at 75 ℃ of incubations then.(Applied Biosystems, Foster City CA) carry out mononucleotide and extend to use ABIPrism SnaPshot system subsequently.Used probe provides in table 1.
The reaction mixture that is used for extension contains 1.5 μ l Snapshot ReadyReaction Mastermix (Applied Biosystems, Foster City, CA), 1.0 μ l water and 1.5 μ l multiple PCR products and 1.0 μ l probe mixture (every kind of probe 2 μ mol/l).Reaction conditions is 96 ℃ 30 seconds, 50 ℃ of 35 round-robin 30 seconds and 60 ℃ 30 seconds.With product and 3U calf small intestine Phosphoric acid esterase 37 ℃ of incubations 60 minutes to remove uncorporated dNTP, then 75 ℃ of incubations 15 minutes with inactivator.At last, ((Applied Biosystems, Foster City CA) carry out gene type assay CA) to use Genotyper version 3 .7 for Applied Biosystems, Foster City with ABI Prism 3100 genetic analyzers.
Statistical analysis
With uncorrelated null hypothesis between multiple linear regression analytical study genetic variant and the phenotype result, described phenotype result regulates for concomitant variable (age, BMI, smoking, alcohol consumption and pharmacotherapy state).Phenotype result with between ANCOVA (Tukey check) the icp gene type group wherein carries out multiple adjusting to concomitant variable.Use additive inheritance model (based on the allelic number grouping that makes a variation of each pleomorphism site) according to viewed allelotrope effect at last.By in this model, introducing corresponding product term check sex and the interaction between the PLIN genotype.Carry out test of hypothesis with SAS 8.0 statistical packages.Think that statistics P value is the significance border less than 0.05.Carry out statistical test after fasting glucose and triglyceride level changed into normal distribution logarithmically.Calculate gene frequency with the THESIAS program, pursue linkage disequilibrium (LD) and derivation unit type with check.This computer program is based on the Maximum Likelihood Model that people such as Tregouet (21) describe.After above-mentioned concomitant variable carried out multiple adjusting, the inspection unit type was related with obesity danger.
The result
By to the order-checking once more of conserved regions and by retrieval one of public snp database (http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi between people and the mouse among 40 uncorrelated experimenters? locusId=5346) carry out the evaluation of common polymorphism on the PLIN locus.Identify 4 kinds of common polymorphism PLIN 6209T＞C, 11482G＞A, 13041A＞G and 14995A＞T and selected to be used for this research.The numbering of these SNP has reflected the relative position of A of the initial methionine codon ATG of they and PLIN, and described A is numbered "+1 " (on reference sequences 157157, searching number GI21431190).Genotype distributes and does not depart from the Hardy-Weinberg expectation.The less important gene frequency of the SNP that is checked is 0.453 for 6209T, is 0.299 for 11482A, is 0.336 for 13041G, is 0.360 for 14995T.By the inspection of linkage disequilibrium (LD) is shown PLIN 6209T＞C and 11482G＞A both be present among the strong LD (D '=0.92, P＜0.001).Between these SNP and 13041A＞G SNP, do not detect remarkable LD (right for 6209T＞C/13041A＞G, D '=0.04, P=0.224, right for 11482G＞A/13041A＞G, D '=0.05, P=0.110).At last, as shown in Figure 5, PLIN 14995A＞T demonstrates the LD of different levels.
For outcome variable, we have found the remarkable interaction between PLIN genotype and the sex.Therefore, we analyze separately the men and women.At first, we checked for the allelotrope of every kind of SNP and body fat measure related, described body fat is measured and is comprised BMI, percentage ratio body fat and waistline.In the woman, we have found the remarkable allelotrope difference in percentage ratio body fat and the waistline.For PLIN 13041A＞G, the average percentage body fat value of AA, AG and GG group is respectively 30.6%,, 32.7% and 33.3% (P=0.0166).Average waistline is observed similar association: AA, AG and GG experimenter is respectively 95.1; 96.9; And 105.1cm (P=0.020).We observe similar association to PLIN 14995A＞TSNP.The average percentage body fat is 30.5%, 32.5% and 33.7% (P=0.0104) among AA, AT and the TT experimenter; Average waistline is respectively 95.7,98.9 and 102.6cm (P=0.0453).Carry G/A and the genotypic experimenter of G/G at PLIN 13041A＞G and have BMI value than high 1.25kg/m2 of AA experimenter and 1.60kg/m2.Similarly, for PLIN 14995A＞T SNP, AT and TT experimenter have the BMI (Fig. 6) than high 0.87kg/m2 of AA experimenter and 2.32kg/m2.Do not find significantly related between PLIN 6209T＞C and PLIN 11482G＞A genotype and body fat are measured in the women.In the man, there is not remarkable genotype relevant difference (data not shown) for any variable of being checked.
We have also checked the association between PLIN variation and the obesity danger.We have inferred from the haplotype of 4 kinds of SNP and have used these groups to be used for further hazard analysis.Contain the obesity danger that less important allelic haplotype tends to have increase at SNP13041 and/or 14995, in the woman, have the obesity danger that reduces and contain less important allelic haplotype tendency 6209 and/or 11482.In them; after regulating for concomitant variable as mentioned before, haplotype T/G/G/T dangerous relevant with the highest obesity (OR=2.09,95%CI0.83-5.23); haplotype C/G/A/A and the highest obesity protection relevant (OR=0.58,95%CI 0.25-1.34) (table 2).Yet these are related because the restriction of sample size does not all reach significance,statistical.In order to improve the research detectivity, we have also analyzed the haplotype association based on 6209T＞C/11482G＞A or 13041A＞G/14995A＞T haplotype.We do not have to find any remarkable association between the haplotype of 6209T＞C/11482G＞A inference from the men and women.When the haplotype checked from 13041A＞G/14995A＞T inference, compare with haplotype A/A among the woman, haplotype A/T (OR=1.76,95%CI1.07-2.90) and haplotype G/T (OR=1.73,95%CI 1.06-2.82) all with the dangerous significant correlation (table 8) of the increase of obesity.We do not find the remarkable association between the obesity danger among 13041A＞G/14995A＞T haplotype and the man.
Because the close relation between body fat and the energy homeostasis, so we have analyzed related between measuring of PLIN genotype and some metabolism relevant with energy homeostasis.In female subjects, although relevant with the body fat that increases, PLIN 13041A＞G does not measure remarkable related (table 9) with the metabolism of being checked with 14995A＞T.On the contrary, PLIN 6209T＞C related with 11482G＞A (for PLIN 6209T＞C, P=0.007 is for PLIN 11482G＞A, P=0.028, table 9) with the LDL-C level.In addition, PLIN 11482G＞A is also related with the TC level, has small significance (P=0.068).Additive allele effect unlike PLIN 13041A＞G/14995A＞T demonstration to body fat, only have the isozygoty carrier of variation of PLIN6209T＞C/11482G＞A and tend to have higher LDL-C and/or TC, and other genotypic carrier have suitable level in these are measured.In the male sex, the research experimenter that we find to carry PLIN 13041G with carry the homozygous experimenter of wild-type and compare and have lower TC and LDL-C level.Notice that this type of association all is that small (for TC, P=0.051 is for LDL-C, P=0.049).In addition, also observe small association (P=0.047) between PLIN 13041A＞G and the HDL-C level.As if yet the main difference of LDL-C level is between GA group and AA group.The genotype of PLIN 6209T＞C, 11482G＞A and 14995A＞T not with the man in any metabolism of checking measure relevant (table 10).
Discuss
Since first after the nineties in 20th century earlier report, enclose fat drip albumen just becoming lipolysis in the adipocyte and the crucial instrumentality in the accumulation of body fat (14-17,22-24).Recently, that reduces in the heritable variation on the PLIN locus and the people's adipocyte encloses the lipolytic activity relevant (18) that fat drips protein content and increase, has supported the role of PLIN as the candidate gene of obesity in the general groups.In this research, we have checked in the white man colony of the average BMI with rising related between the variability on the PLIN locus and anthropometric variables and metabolism variable.In this colony, identify and determine among genotypic 4 kinds of common SNP, we find to be positioned at 3 ' non-translational region two kinds of SNP (PLIN 13041A＞G and 14995A＞T) significantly related with the percentage ratio body fat and the waistline of increase, and with female subjects in the BMI that increases small related.In addition, use PLIN 13041A＞G and 14995A＞T SNPs dangerous the increasing of obesity to the analytical proof A/T and the G/T haplotype of the haplotype of inference.On the contrary, in the male sex, the PLIN polymorphism is significantly not related with the parameter of any measurement of body fat.
Enclosing fat drips albumen and mainly expresses in adipocyte and sterogenic cell.Because their physical positionings in fat depot, thus on inspection enclose fat and drip albumen and regulating mobilization that fat stocks and the effect in the accumulation of body fat, and this viewpoint (13,23,25) is supported in several in vitro study.Evidence is from knock-out mice model (15,16) in other bodies of these effects.We are also consistent with result from experimental model about the current discovery of people PLIN genetic mutation, and prompting is enclosed fat and dripped albumen conservative effect in the lipolysis between different plant species.
That has identified that alternative splicing causes severally encloses that fat drips albumen isotype (9,26) and these isotypes may be different on the function (24).PLIN 13041A＞G and 14995A＞T both is positioned at 3 ' non-translational region, and in transcribing alternative splicing takes place.Possible these polymorphisms can change transcription product by influencing montage.The mutually remarkable linkage disequilibrium of PLIN 13041A＞G and 14995A＞T.Therefore, we infer these two kinds of polymorphisms and body fat measure between viewed association can point to the sudden change of identical cause, and consider 14995T allelotrope always be present in the dangerous relevant haplotype of the obesity that increases in, we suppose this equipotential gene may with the cause more close association of suddenling change.
In our research, we have checked that several somatometrys measure (BMI, percentage ratio body fat and waistline).Although their significant correlations, these are measured is not identical in representing body fat.Thereby BMI does not distinguish fat and thin weight.And these associations are age-dependent (27,28).On the other hand, more accurate the measuring (29) that waistline is the individuality of the more high-risk that is used to identify that those have metabolism syndrome proposed.Although there are those differences, what allow the people feels at ease is to have we have found that consistent related between PLIN polymorphism and several obesity index.
Obesity measure usually with glucose and lipid metabolism in relevant unusually.Yet in our research, we do not find the remarkable association between PLIN 13041A＞G and 14995A＞T SNPs and glucose or the lipid correlated measure.In experimental model, observed similar discovery.As if thereby the PLIN knock-out mice adapts to the lipolysis of being eliminated the constitutive activation that causes by the PLIN gene by activation mechanism, to remove these steatolysis products (30) by raising the oxygenolysis pathways metabolism with downward modulation lipid/sterol route of synthesis.We propose also this type of compensation mechanism can take place when lipolysis is suppressed.
Two kinds of SNP of other that checked (PLIN 6209T＞C and 11482G＞A) not related with the body obesity in this research.People such as Mottagui-Tabar reported PLIN 11482G＞A in the past and dripped the lipolysis that increases among protein content and the fat woman relevant (18) with the fat that encloses of reduction.Therefore, we expect that PLIN 11482A will be related with the phenotype of becoming thin.Zero correlation between this polymorphism and body fat are measured in several our researchs of reason possible explanation: at first, our research colony is than the obese subjects in the general groups more (average BMI=29.6kg/m2).Possible these experimenters have genetic factor owing to the influence of other locus to obesity, and the expression of the protectiveness effect of PLIN 11482A can be suppressed under these conditions.In addition, the PLIN 11482G＞A polymorphism of Mottagui-Tabar report is intron SNP, and it may be among the LD with function mutation.Similarly, can realize association between PLIN 11482G＞A and the phenotypic variance by the special genetic construction of colony, wherein the magnitude by to LD between the variation of PLIN 11482G＞A and function can reduce in our colony.
Carry as if the genotypic woman of PLIN 11482AA has the discovery of higher TC and LDL-C and the research of Mottagui-Tabar meets, wherein AA genotype and the fatty lipolysis rate of increase related (18).The lipid acid that raises in the circulation will increase their flows to liver, thereby cause the lipid metabolism that changes and promote cholesterol to produce (31).Because PLIN 6209T＞C and 11482G＞A almost completely are in LD, so we infer the hereditary basis that association may have with PLIN 11482G＞A SNP is identical between viewed PLIN 6209 and the LDL-C concentration.
The PLIN locus is not relevant with obesity correlated measure in the male subject.Propose the men and women and may have not on the same group obesity susceptible gene (7).In addition, twin study show this obesity may be in the woman than in the man more can heredity (32).Yet, before we draw the conclusion that PLIN is not the candidate gene of the relevant phenotype of obesity among the man, need bigger research.Enclosing fat among the men and women drips proteic differentially expressed level (33) and may cause their the different susceptibility to the PLIN genetic effect.
In a word, we find in the 3 ' non-translational region of PLIN gene among the white man woman two SNP (remarkable related between PLIN 13041A＞G and 14995A＞T) and the obesity danger.The allelic carrier of the variant of these two kinds of SNP compares average body lipid content, waistline and the BMI with increase with the carrier of wild type gene type.On the contrary, do not find significantly related between PLIN polymorphism and body fat are measured in the man.The key player of PLIN as the candidate gene of obesity danger among the woman supported in our discovery.
The example II reference
1.Bouchard?C，Perusse?L.Heredity?and?body?fat.Annu?Rev?Nutr.1988；8：259-277.
2.Rajala?MW，Scherer?PE.Minireview：The?adipocyte-at?the?crossroads?ofenergy?homeostasis，inflanmation，and?atherosclerosis.Endocrinology2003；144：3765-3773.
3.Pereira?AC，Floriano?MS，Mota?GF?et?al.Beta2?adrenoceptor?functional?genevariants，obesity，and?blood?pressure?level?interactions?in?the?generalpopulation.Hypertension?2003；42：685-692.
4.Coudreau?SK，Tounian?P，Bonhomme?G?et?al.Role?of?the?DGAT?gene?C79Tsingle-nucleotide?polymorphism?in?French?obese?subjects.Obes?Res.2003；11：1163-1167.
5.Doney?A，Fischer?B，Frew?D?et?al.Haplotype?analysis?of?the?PPARgammaPro12Ala?and?C1431T?variants?reveals?opposing?associations?with?bodyweight.BMC?Genet.2002；3：21.
6.Lavebratt?C，Ryden?M，Schalling?M?et?al.The?hormone-sensitive?lipase?i6gene?polymorphism?and?body?fat?accumulation.Eur?J?Clin?Invest.2002；32：938-942.
7.Arner?P.Hunting?for?human?obesity?genes？Look?in?the?adipose?tissue！Int?JObes?Relat?Metab?Disord?2000；24?Suppl?4：S57-S62.
8.Arner?P.Obesity--a?genetic?disease?of?adipose?tissue？Br?J?Nutr.2000；83Suppl?1：S9-16.
9.Greenberg?AS，Egan?JJ，Wek?SA?et?al.Isolation?of?cDNAs?for?perilipins?Aand?B：sequence?and?expression?of?lipid?droplet-associated?proteins?ofadipocytes.Proc?Natl?Acad?Sci.U?S?A?1993；90：12035-12039.
10.Nishiu?J，Tanaka?T，Nakamura?Y.Isolation?and?chromosomal?mapping?of?thehuman?homolog?of?perilipin(PLIN)，a?rat?adipose?tissue-specific?gene，bydifferential?display?method.Genomics?1998；48：254-257.
11.Servetnick?DA，Brasaemle?DL，Gruia-Gray?J?et?al.Perilipins?are?associatedwith?cholesteryl?ester?droplets?in?steroidogenic?adrenal?cortical?and?Leydigcells.J?Biol?Chem.1995；270：16970-16973.
12.Brasaemle?DL，Barber?T，Wolins?NE?et?al.Adipose?differentiation-relatedprotein?is?an?ubiquitously?expressed?lipid?storage?droplet-associated?protein.JLipid?Res.1997；38：2249-2263.
13.Souza?SC，de?Vargas?LM，Yamamoto?MT?et?al.Overexpression?of?perilipin?Aand?B?blocks?the?ability?of?tumor?necrosis?factor?alpha?to?increase?lipolysis?in3T3-L1?adipocytes.J?Biol?Chem.1998；273：24665-24669.
14.Brasaemle?DL，Rubin?B，Harten?IA?et?al.Perilipin?A?increases?triacylglycerolstorage?by?decreasing?the?rate?of?triacylglycerol?hydrolysis.J?Biol?Chem.2000；275：38486?38493.
15.Martinez-Botas?J，Anderson?JB，Tessier?D?et?al.Absence?of?perilipin?results?inleanness?and?reverses?obesity?in?Lepr(db/db)mice.Nat?Genet.2000；26：474-479.
16.Tansey?JT，Sztalryd?C，Gruia-Gray?J?et?al.Perilipin?ablation?results?in?a?leanmouse?with?aberrant?adipocyte?lipolysis，enhanced?leptin?production，andresistance?to?diet-induced?obesity.Proc?Natl?Acad?Sci?U?S?A?2001；98：6494-6499.
17.Kern?PA，Di?Gregorio?G，Lu?T?et?al.Perilipin?expression?in?human?adiposetissue?is?elevated?with?obesity.J?Clin?Endocrinol?Metab.2004；89：1352-1358.
18.Mottagui-Tabar?S，Ryden?M，Lofgren?P?et?al.Evidence?for?an?important?roleof?perilipin?in?the?regulation?of?human?adipocyte?lipolysis.Diabetologia2003；46：789-797.
19.Barnard?RJ.Effects?of?life-style?modification?on?serum?lipids.Arch?InternMed.1991；151：1389-1394.
20.Friedewald?WT，Levy?RI，Fredrickson?DS.Estimation?of?the?concentration?oflow-density?lipoprotein?cholesterol?in?plasma，without?use?of?the?preparativeultracentrifuge.Clin?Chem.1972；18：499-502.
21.Tregouet?DA，Barbaux?S，Escolano?S?et?al.Specific?haplotypes?of?the?P-selectin?gene?are?associated?with?myocardial?infarction.Hum?Mol?Genet2002；11：2015-2023.
22.Londos?C，Gruia-Gray?J，Brasaemle?DL?et?al.Perilipin：possible?roles?instructure?and?metabolism?of?intracellular?neutral?lipids?in?adipocytes?andsteroidogenic?cells.Int?J?Obes?Relat?Metab?Disord.1996；20?Suppl?3：S97-101.
23.Sztalryd?C，Xu?G，Dorward?H?et?al.Perilipin?A?is?essential?for?thetranslocation?of?hormone-sensitive?lipase?during?lipolytic?activation.J?CellBiol.2003：161：1093-1103.
24.Tansey?JJ，Huml?AM，Vogt?R?et?al.Functional?studies?on?native?and?mutatedforms?of?perilipins：A?role?in?protein?kinase?A-mediated?lipolysis?oftriacylglycerols?in?CHO?cells.J?Biol?Chem.2002.
25.Souza?SC，Muliro?KV，Liscum?L?et?al.Modulation?of?hormone-sensitivelipase?and?protein?kinase?A-mediated?lipolysis?by?perilipin?A?in?an?adenoviralreconstituted?system.J?Biol?Chem.2002；277：8267-8272.
26.Lu?X，Gruia-Gray?J，Copeland?NG?et?al.The?murine?perilipin?gene：the?lipiddroplet-associated?perilipins?derive?from?tissue-specific，mRNA?splice?variantsand?define?a?gene?family?of?ancient?origin.Mamm?Genome?2001；12：741-749.
27?Prentice?AM，Jebb?SA.Beyond?body?mass?index.Obes?Rev.2001；2：141-147.
28.Allison?DB，Saunders?SE.Obesity?in?North?America.An?overview.Med?ClinNorth?Am.2000；84：305-32，v.
29Visscher?TL，Seidell?JC，Molarius?A?et?al.A?comparison?of?body?mass?index，waist-hip?ratio?and?waist?circumference?as?predictors?of?all-cause?mortalityamong?the?elderly：the?Rotterdam?study.Int?J?Obes?Relat?Metab?Disord.2001；25：1730-1735.
30.Castro-Chavez?F，Yechoor?VK，Saha?PK?et?al.Coordinated?Upregulation?ofOxidative?Pathways?and?Downregulation?of?Lipid?Biosynthesis?UnderlieObesity?Resistance?in?Perilipin?Knockout?Mice：A?Microarray?GeneExpression?Profile.Diabetes?2003；52：2666-2674.
31.Arner?P.Insulin?resistance?in?type?2?diabetes：role?of?fatty?acids.DiabetesMetab?Res?Rev.2002；18?Suppl?2：S5-S9.
32.Herskind?AM，McGue?M，Sorensen?TI?et?al.Sex?and?age?specific?assessmentof?genetic?and?environmental?influences?on?body?mass?index?in?twins.Int?JObes?Relat?Metab?Disord.1996；20：106-113.
33.Wang?Y，Sullivan?S，Trujillo?M?et?al.Perilipin?expression?in?human?adiposetissues：effects?of?severe?obesity，gender，and?depot.Obes?Res.2003；11：930-936.
EXAMPLE III: in the colony of many ethnic groups Asia the people enclose fat drip protein gene (PLIN) with the gene of the dangerous related haplotype of the obesity that increases in the linkage disequilibrium structure
Material and method
Experimenter and research and design
In this research, comprise 4,131 experimenters that participate in NHS 98 altogether.NHS 98 is the first steps of measuring the Hazard Factor of main Non Communicable Diseases (NCD) in the Singapore.Its detailed method (11) had been described in the past.Be used for the scheme that be used for diabetes and other Non Communicable Diseases (NCD) on the-spot investigations and the step and WHOMONICA (the Multi-national Monitoring of Trends and Determinantsin Cardiovascular Disease) scheme that be used for mass survey of the method for NHS98 based on the WHO recommendation.In brief, select 11,200 individualities from National Databaseon Dwellings, they are from the address of the whole Singapore resident population's of representative house type (representative of society-economic situation).By out-of-proportion stratification and system sampling from these individual selection random samples.Oversampled to Malaysian and Indian, estimate it is reliable with the prevalence rate of guaranteeing these minority groups.Totally 4,723 experimenters participate in this research, and ethnic group consists of 64% Chinese, 21% Malaysian and 15% Asia Indian.All participants obtain informed consent from this investigation.This research obtains the approval of the Singapore Ministry of Health (Ministry of Health in Singapore) and Ethics Committee of Singapore general hospital polyclinic (the Ethics committee of the Singapore General Hospital).
Use is applied to the data of interviewer's questionnaire collection about the mode of life factor.Use is usually used in the somatometry of extensive epidemiological study and measures the assessment body fat, and described somatometry is measured and comprised that body weight, weight index (BMI), waistline, hip circumference and waist/stern are than (WHR).In brief, use the digital scale (SECA, Hamburg, Germany) of tolerance range, measure and do not wear the body weight that footwear are only worn light indoor clothes as the calibration of 0.1kg.The stadimeter that use is installed at wall is measured the height of not wearing footwear with the Frankfurt horizontal plane, is accurate to 0.1cm.By square removing body weight (body weight (kg)/height (m2)) and calculate BMI with height.The waist measurement is accurate to 0.1cm, and the mid-way between the crista iliaca when rib lower edge and gentle expiration end is measured.Directly on skin, measure.Directly on maximum rotor on the underwear, measure hip circumference, be accurate to 0.1cm (12).Obesity two minutes is defined as BMI 〉=30kg/m2, and with the overweight 30kg/m2＞BMI 〉=25kg/m2 that is defined as.Standard above using always has 300 fat cases, and wherein 1,333 experimenter is classified as overweight.
In measuring, the experimenter's who the PLIN gene is carried out and do not carry out gene type assay main somatometry and biological chemistry do not find differences.
DNA separates and gene type assay
With mononucleotide extension carrying out gene type assay.At first, be included in the dna fragmentation of 5 new SNP that identify of PLIN locus by multiplex PCR (PCR) amplification.To SNP according to them with respect to the Position Number of the A of the ATG of the initial methionine codon of PLIN (6209 T＞C, 10171 A＞T, 11482 G＞A, 13041 A＞G, 14995A＞T), the A of described ATG is numbered "+1 " (on reference sequences 157157, searching number GI21431190).Used primer provides in table 1.In the 10 μ l reaction volumes that contain every kind of dNTP of 0.2mmol/l, every kind of primer of 0.2 μ mol/l, 3.0mmol/l magnesium chloride and 0.8U QiagenHotstar Taq polysaccharase, carry out pcr amplification.The PCR cycling condition be 95 ℃ 10 minutes, be 95 ℃ 30 seconds, 70 ℃ of 7 round-robin 30 seconds and 72 ℃ 1 minute then, be 95 ℃ 30 seconds, 65 ℃ of 41 round-robin 30 seconds and 72 ℃ 1 minute then.When finishing, this scheme comprises 72 ℃ of final extension stages of 2 minutes.With PCR product and every kind of exonuclease I of 2.5U (New England Biolabs., Inc.Beverly, MA) and calf small intestine Phosphoric acid esterase (New England Biolabs., Inc.Beverly, MA) 37 ℃ of incubations 60 minutes to remove uncorporated dNTP and primer.Came the described enzyme of deactivation in 15 minutes at 75 ℃ of incubations then.
(Applied Biosystems, Foster City CA) carry out mononucleotide and extend to use ABI Prism SnaPshot multiplicated system subsequently.The probe that is used for the mononucleotide extension is listed at table 1.Use the PCR thermal cycler in 5 μ l reaction mixtures, to carry out extension, this mixture contains 1.5 μ l Snapshot Ready Reaction Mastermix (AppliedBiosystems, Foster City, CA), (for 6209C＞T, 10171A＞T and 11482G＞A is 1.5 μ mol/l for 1.0 μ l water and 1.5 μ l multiple PCR products and 1.0 μ l probe mixture; For 13041A＞G and 14995A＞T is 2.0 μ mol/l).Reaction conditions is 96 ℃ 30 seconds, 50 ℃ of 35 round-robin 30 seconds and 60 ℃ 30 seconds.With reaction product and 3U calf small intestine Phosphoric acid esterase 37 ℃ of incubations 60 minutes to remove uncorporated dNTP, then 75 ℃ of incubations 15 minutes with inactivator.((Applied Biosystems, Foster City CA) carry out gene type assay CA) to use Genotyper version 3 .7 for Applied Biosystems, Foster City with ABI Prism 3100 genetic analyzers.Set up the quality control of gene type assay, and pass through two researchists explanation results independently.
Statistical analysis
Estimate gene frequency with Arlequin (can obtain), check genotype frequency and Hardy-Weinberg equilibrated consistence on each SNP locus at http://lgb.unige.ch/arlequin/, and pursuing LD between the SNP that estimates to be checked.Use the likelihood ratio to check the significance,statistical of LD between every couple of SNP.Can use THESIAS program (be at http://ecgene.net/genecanvas/modules/mydownloads/singlefile.php? cid=l﹠amp; Lid=1 obtains) infer haplotype, described programdesign is used for checking the effect of uncorrelated experimenter's haplotype, simultaneously concomitant variable is regulated.The Maximum Likelihood Model that this computer program is described based on people such as Tregouet (13).Analyze individual association with SAS (version of window 8.0), and on 5% level, define significance,statistical.Analyze the difference in the genotypic ubiquity of PLIN between fat case and the non-fat contrast by x2.Estimate the relative risk of obesity with the odds ratio with 95% fiducial interval (CI) (OR).With the regression analysis of multivariate logarithm the possible concomitant variable (age, sex, smoking, alcohol consumption, exercise and glycosuria morbid state) of obesity is adjusted.Check interaction between hereditary effect and the sex by in this model, introducing corresponding product term.General genetic model (to the genotype grouping of experimenter according to every kind of SNP) is used to check the allelotrope effect first, and, use suitable genetic model (dominance, recessive, perhaps additivity) according to viewed allelotrope effect at last.
The result
(6209T＞C, 10171A＞T, 11482G＞A, 13041A＞G and 14995A＞T) also carry out gene type assay to select 5 kinds of two pairs of common polymorphic alleles in Singapore NHS98 colony.These SNP lay respectively at intron 2 (6209), intron 5 (10171), intron 6 (11482), exon 8 (13041) and exon 9 (14995).Obtain the genotype information of 5 kinds of PLIN polymorphisms from 4,131 research experimenters.The participant's of gene type assay feature is displayed in Table 11.Chinese account for 67.28%, and Malaysian accounts for 18.16%, and the Indian accounts for 14.56%.Generally, the Indian is old and Chinese are young.In the man, Malaysian and Indian have suitable average BMI, and it is than the height～1.0kg/m2 among the Chinese.In the woman, Malaysian have the highest BMI (26.3 ± 5.6kg/m2), secondly be Indian (25.6 ± 5.0kg/m2) and Chinese (22.1 ± 3.6kg/m2).For the men and women, obesity (BMI 〉=30kg/m2) and overweight (secondly BMI 〉=25kg/m2) the most general in Malaysian is the Indian.Obesity and overweight ubiquity are than much higher among the Chinese in these two ethnic groups.The India men and women has the highest diabetes rate (man is 18.2%, and the woman is 17.4%), is higher than that observed among the Malaysian (man is 10.9%, the woman is 14.8%), and in Chinese, these numerals are much lower: the man is 7.2%, and the woman is 6.6%.Malaysian has the most a high proportion of Ex smoker of working as, and alcohol consuming frequency in Chinese is the highest.
In three ethnic groups, less important allelic frequency is: PLIN 6209C＞T's is 0.320 to 0.462, PLIN 10171A＞T's is 0.135 to 0.255, PLIN 11482G＞A's is 0.326 to 0.439, PLIN 13041A＞G's is 0.296 to 0.471, and PLIN 14995A＞T's is 0.361 to 0.444.For all polymorphisms in three ethnic groups, viewed genotype frequency with expection is all consistent with the Hardy-Weinberg balance.Inhomogeneity chi square test shows that genotype/allele distributions does not have significant difference between the men and women for any of the SNP of 5 kinds of inspections.On the contrary, we observe significant people's difference between species in each pleomorphism site genotype distributes.Between every couple of SNP, found significant nonrandom allelic association, indicated as pursuing among Fig. 7 to the D ' of LD.As if the LD structure in the PLIN is not uniform.PLIN 6209C＞T and 10171A＞T SNPs and every other SNP are in negative LD, and in three ethnic groups, PLIN 11482G＞A, 13041A＞G and 14995A＞T SNPs is in positive LD mutually.In positive association, between PLIN11482G＞A and 14995A＞T, find the strongest LD, wherein D ' scope is 0.76 to 0.83 in three ethnic groups.
We have checked that PLIN haplotype and the obesity inferred in three ethnic groups (are defined as BMI 〉=30kg/m2) potential association between the danger.We use THESIAS, the maximum likelihood algorithm (13) that it is rebuild based on haplotype.We do not detect significant gene-sex and interact.Therefore, the men and women is analyzed together.Use 5 kinds of SNP, we are that Chinese, Malaysian and Indian have inferred 24,18 and 18 kind of haplotype respectively.We check the association (table 12) between common haplotype (frequency is greater than～5%) and the obesity danger then.In Malaysian, we find to compare with the most general haplotype 21111, and haplotype 11222 (OR=1.64,95%CI 1.08-2.48) and 11212 (OR=1.65,95%CI1.11-2.46) remarkable related with the danger of the increase of obesity.Also find haplotype 11212 also with the Indian in obesity dangerous significantly related (OR=1.94,95%CI 1.06-3.53).On the contrary, compare with haplotype 21111, the reduction of haplotype 12111 and obesity dangerous related reaches small significance (OR=0.30,95%CI 0.09-1.06) in the Indian.Similarly, this haplotype also with Malaysian in the obesity that reduces a little dangerous related.Adjusting to relevant concomitant variable (age, sex, smoking, alcohol consumption, exercise and diabetic disease states) does not have to change observed related significance in Malaysian, but significance reduces a little in the Indian.We do not find the remarkable association between the PLIN haplotype and obesity danger among the Chinese.
We also use SNP subgroup ( PLIN 11482,13041 and 14995) to check that haplotype is related, and described each SNPs is in positive LD mutually.In these three kinds of SNP, we have inferred 8 kinds of haplotypes in everyone population.Check related between each haplotype (frequency is greater than～5%) and the obesity danger is shown, in Malaysian, to compare with modal haplotype 111, haplotype 212,222 is significantly related (for 212 with the advantage of the increase of obesity with 121, OR=2.12,95%CI 1.36-3.32, for 222, OR=2.02,95%CI1.36-3.01, and for 121, OR=1.89,95%CI 1.05-3.41).In the Indian, to compare with haplotype 111, the advantage of haplotype 212 and the increase of obesity is related (OR=2.39,95%CI 1.26-4.50) significantly.Haplotype 122 is also dangerous related with the obesity that increases, and has small significance.The adjusting of main obesity Hazard Factor (age, sex, smoking, alcohol consumption, exercise and diabetic disease states) is not changed viewed related, just among the Malaysian with related become small significantly (table 13 and the table 14) of haplotype 121.
In addition, we have checked the related of every kind of independent SNP and obesity danger.Do not find significantly related to PLIN6209C＞T with 11482G＞A.In Malaysian and Indian, PLIN 14995A＞allelic homozygosity of the T of T place is compared with the advantage of the increase of obesity significantly related (for Malaysian with other genotype, multivariate OR=2.28,95%CI1.45-3.57, for the Indian, multivariate OR=2.04,95%CI 1.08-3.84).Also find the advantage of the increase of obesity among the homozygosity of the rare allele of PLIN 11482G＞A or 13041A＞G and Indian and the Malaysian related, but only reach significance,statistical (for PLIN11482G＞A in one group in the back, multivariate OR=1.94,95%CI1.22-3.08, for PLIN 13041A＞G, multivariate OR=1.87,95%CI1.08-3.25) (see figure 8).In Chinese, do not find the remarkable association between these polymorphisms and the obesity danger.
Discuss
In this research, we have used the analysis based on SNP and haplotype, have studied the association between the PLIN genetic mutation and obesity danger among 4,131 experimenters with different ethnic background.We have carried out gene type assay (PLIN 6209C＞T, 10171A＞T, 11482G＞A, 13041A＞G and 14995A＞T) to 5 two pairs of polymorphic alleles on the candidate gene PLIN locus of obesity in the Asia colony that comprises three ethnic groups (Chinese, Malaysian and Indian).By checking the related of the haplotype inferred and obesity danger, we prove that the danger of the increase of obesity among PLIN 11212 haplotypes and Malaysian and the Indian is remarkable related.Use is in three kinds of SNP of positive linkage disequilibrium, and (the extra haplotype analysis revealed of 11482G＞A, 13041A＞G and 14995A＞T) carry out is after concomitant variable is regulated, haplotype 212 with 222 with Malaysian in the obesity that increases dangerous related, and the obesity danger that increases among haplotype 212 and the Indian is remarkable related.At last, individual snp analysis shows that obesity is dangerous significantly related among PLIN 14995A＞T and Malaysian and the Indian.
Our discovery provides the strong backing (with reference to http://obesitygene.pbrc.edu/) that PLIN is thought of as the candidate gene of obesity danger among the mankind.Enclosing fat, to drip albumen be lipid droplet related protein (2,3,14) main in the adipocyte.Have been found that enclosing fat drips albumen play an important role in the turnover of the TAG that stores of steatolysis role and influence in may the cell of PKA-mediation in regulating adipocyte (4,5,15).Experimental model has proved the product of PLIN gene play a crucial role (6,7) in definite body fat composition in the body.In the mankind, enclosing fat in the fatty tissue, to drip proteic abundance also related with lipolysis rate, and one of its genetic variant can influence and encloses fat and drip protein content and lipolysis rate (8).
Our data presentation consistent related between PLIN haplotype and the obesity danger in two ethnic groups of three ethnic groups being checked.In Malaysian and Indian, haplotype 11212 is dangerous consistent related with the obesity that increases, and points out this haplotype may contain function mutation.And using site 11482,13041 and 14995 SNP to carry out the haplotype analysis has increased related magnitude and significance,statistical.After relevant concomitant variable regulated, compare with wild-type haplotype (111) between Malaysian and the Indian, haplotype 212 (11482,13041 and 14995) is related with the obesity danger that increases.Consider in two ethnic groups consistent related with the obesity danger that increases, we suppose the haplotype 212 from 11482G＞A, 13041A＞G and 14995A＞T SNPs more may contain function mutation or with function mutation be divided into from.
The results suggest PLIN 14995A＞T that analyzes independent SNP is viewed haplotype and the related most important single hereditary contributor of obesity.Obesity among this polymorphism and Malaysian and the Indian is dangerous consistent related and have a highest odds ratio.Although also find increase dangerous related of other two kinds of SNP:PLIN 11482G＞A and 13041A＞G and obesity, the low amount utmost point of this discovery and to only limit to they related of this true prompting of a kind of ethnic group may be LD owing to them and PLIN 14995A＞T SNP.
We do not find the remarkable association between variation of PLIN among the Chinese and the obesity danger.Some researchists have proposed define with lower cutoff value the obesity (16,17) among the Aisa people.Yet, in our analysis, use low cutoff value (27kg/m2 and 25kg/m2) not change the amount utmost point (data not shown) of this discovery.Alternatively, our the difference penetrance of supposing hereditary effect may be about the basic reason of the viewed deviation that concerns between PLIN and the obesity between Chinese and other two ethnic groups.In Singapore, although live in the similar environment, Malaysian and Indian have suitable average BMI, and it is significantly higher than average BMI among the Chinese, and the prompting Chinese may have lower genetic factor to obesity.
PLIN 13041A＞G and PLIN 14995A＞T SNPs are arranged in such zone, and alternative splicing takes place during PLIN transcribes in this zone, cause several fat that enclose to drip albumen isotype (18).Recently data show that enclosing fat drips the albumen isotype and may avoid in the steatolysis of PKA mediation with different efficient performance functions (19) at the protection stored fat.Therefore, not wishing to be bound by theory, may be by influencing montage and differently enclosing the expression that fat drips the albumen isotype with the related basic hereditary effect of PLIN 13041A＞G and PLIN 14995A＞T.Also possibility PLIN11482G＞A only represents the genetic marker in these associations, rather than function mutation.We have been noted that between Aisa people and the Caucasian colony for the significant differences (data not shown) in the LD structure of PLIN gene, and we advocate that LD structure in the genes different between the different people population can drive different related in the various human population.This type of difference in the LD structure can be explained the difference between the discovery of our discovery and research more early.It is related that people such as Mottagui-Tabar report on PLIN 11482G＞A SNP A allelotrope and enhanced basis and norepinephrine inductive lipolysis recently.In addition, the lower fat that encloses drips protein content related (8) among phase isoallele and the fat woman.Find according to this, and opposite with our observation, with the negative association between expection PLIN 11482AA genotype and the body fat.Yet in people's such as Mottagui-Tabar research, the experimenter is Caucasian women.People's species diversity in the LD structure also can be explained among the Chinese on this locus related shortage between the genetic variant and obesity.
In a word, we find consistent related between the obesity danger of PLIN haplotype and increase among Singapore Malaysian and the Indian.Malaysian and Indian have common dangerous haplotype, make these ethnic groups to obesity procatarxis be arranged.Snp analysis prompting PLIN 14995A＞T may be the more relevant genetic marker of viewed haplotype association separately.
The EXAMPLE III reference
1.Greenberg?AS，Egan?JJ，Wek?SA?et?al.Perilipin，a?major?hormonally?regulatedadipocyte-specific?phosphoprotein?associated?with?the?periphery?of?lipidstorage?droplets.J?Biol?Chem?1991；266：11341-11346.
2.Greenberg?AS，Egan?JJ，Wek?SA?et?al.Isolation?of?cDNAs?for?perilipins?Aand?B：sequence?and?expression?of?lipid?droplet-associated?proteins?ofadipocytes?Proc?Natl?Acad?Sci?U?S?A?1993；90：12035-12039.
3.Servetnick?DA，Brasaemle?DL，Gruia-Gray?J?et?al.Perilipins?are?associatedwith?cholesteryl?ester?droplets?in?steroidogenie?adrenal?cortical?and?Leydigcells.J?Biol?Chem?1995；270：16970-16973.
4.Brasaemle?DL，Rubin?B，Harten?IA?et?al.Perilipin?A?increases?triacylglycerolstorage?by?decreasing?the?rate?of?triacylglycerol?hydrolysis.J?Biol?Chem?2000；275：38486-38493.
5.Souza?SC，de?Vargas?LM，Yamamoto?MT?et?al.Overexpression?of?perilipin?Aand?B?blocks?the?ability?of?tumor?necrosis?factor?alpha?to?increase?lipolysis?in3T3-L1?adipocytes.J?Biol?Chem?1998；273：24665-24669.
6.Martinez-Botas?J，Anderson?JB，Tessier?D?et?al.Absence?of?perilipin?results?inleanness?and?reverses?obesity?in?Lepr(db/db)mice.Nat?Genet?2000；26：474-479.
7.Tansey?JT，Sztalryd?C，Gruia-Gray?J?et?al.Perilipin?ablation?results?in?a?leanmouse?with?aberrant?adipocyte?lipolysis，enhanced?leptin?production，andresistance?to?diet-induced?obesity.Proc?Natl?Acad?Sci?U?S?A?2001；98：6494-6499.
8.Mottagui-Tabar?S，Ryden?M，Lofgren?P?et?al.Evidence?for?an?important?roleof?perilipin?in?the?regulation?of?human?adipocyte?lipolysis.Diabetologia?2003；46：789-797.
9.Poulsen?P，Vaag?A，Kyvik?K，Beck-Nielsen?H.Genetic?versus?environmentalaetiology?of?the?metabolic?syndrome?among?male?and?female?twins.Diabetologia?2001；44：537-43.
10.Hughes?K，Aw?TC，Kuperan?P?et?al.Central?obesity，insulin?resistance，syndrome?X，lipoprotein(a)，and?cardiovascular?risk?in?Indians，Malays，andChinese?in?Singapore.J?Epidemiol?Community?Health?1997；51：394-399.
11.Cutter?J，Tan?BY，Chew?SK.Levels?of?cardiovascular?disease?risk?factors?inSingapore?following?a?national?intervention?programme.Bull?World?HealthOrgan?2001；79：908-915.
12.Deurenberg-Yap?M，Li?T，Tan?WL?et?al.Can?dietary?factors?explaindifferences?in?serum?cholesterol?profiles?among?different?ethnic?groups(Chinese，Malays?and?Indians)in?Singapore？Asia?Pac?J?Clin?Nutr?2001；10：39-45.
13.Tregouet?DA，Barbaux?S，Escolano?S?et?al.Specific?haplotypes?of?the?P-selectin?gene?are?associated?with?myocardial?infarction.Hum?Mol?Genet?2002；11：2015-2023.
14.Nishiu?J，Tanaka?T，Nakamura?Y.Isolation?and?chromosomal?mapping?of?thehuman?homolog?of?perilipin(PLIN)，a?rat?adipose?tissue-specific?gene，bydifferential?display?method.Genomics?1998；48：254-257.
15.Sztalryd?C，Xu?G，Dorward?H?et?al.Perilipin?A?is?essential?for?thetranslocation?of?hormone-sensitive?lipase?during?lipolytic?activation.J?CellBiol?2003；161：1093-1103.
16.Chang?CJ，Wu?CH，Chang?CS?et?al.Low?body?mass?index?but?high?percentbody?fat?in?Taiwanese?subjects：implications?of?obesity?cutoffs.Int?J?ObesRelat?Metab?Disord?2003；27：253?259.
17.WHO?expert?consultation.Appropriate?body-mass?index?for?Asian?populationsand?its?implications?for?policy?and?intervention?strategies，The?Lancet?2004；363：157-163.
18.Lu?X，Gruia-Gray?J，Copeland?NG?et?al.The?murine?perilipin?gene：the?lipiddroplet-associated?perilipins?derive?from?tissue-specific，mRNA?splice?variantsand?define?a?gene?family?of?ancient?origin.Mamm?Genome?2001；12：741-749.
19.Tansey?JJ，Huml?AM，vogt?R?et?al.Functional?studies?on?native?and?mutatedforms?of?perilipins：A?role?in?protein?kinase?A-mediated?lipolysis?oftriacylglycerols?in?CHO?cells.J?Biol?Chem?2002.
With complete being incorporated herein by reference of reference of quoting with this specification herein.
Table 1
SNPs Primer and probe
PLIN1(6209 1T＞C) dbSNP?rs#2289487 2 Intron 2 contig positions: 150949 3 Forward: CTCTGTTCTCCAGGGACCAAGTCAGAT (SEQ ID NO.:1) is reverse: CCTACACTCTGGGGATGCGGAGAT (SEQ ID NO.:2) probe: GACTGACTGACTGACTGACTGACCCCACTGCCTAGAA (SEQ ID NO.:3)
PLIN2(N.D.) 4Introne 3 dbSNP rs#1561726 contig position: 149309 Forward: GAGGGAGAAGAGAGGTGTGAGAGGGA (SEQ ID NO.:4) is reverse: CATCTGGGCTCTCTGCTGCTTGAG (SEQ ID NO.:5) probe: GACTGACTGACTGACTGACTGACTGACTGTG CCCCCGGAGAG (SEQ ID NO.:6)
PLIN3(10171A＞T 5) dbSNP rs#2304794 intron 5 contig positions: 146987 Forward: TTGGCCTTGGGAGACTTCTGGG, (SEQ ID NO.:7) is reverse: TTGTCACACACACTGCCTGGGAAT, (SEQ ID NO.:8) probe: GACTGACTGACTGACTGACTGACTGACTGACT GCAGGAGGTGGCTCA, (SEQ ID NO.:9)
PLIN4 (the dbSNP rs#894160 intron 6 of 11482G＞A) Forward: AAGTGTTGCCCCTGCAGGAAT (SEQ ID NO.:10) is reverse: GAGTGGAACTGCTGGGCCATA (SEQ ID NO.:11) probe: GACTGACTGACTGACTGACTGACTGACTGACTGA
Contig position: 145676 CTTGTGGGGCTCCCTAGA(SEQ?ID?NO.：12)
PLIN5 (dbSNP rs#2304795 exon 8 (synonym) the contig position of 13041A＞G): 144116 Forward: CTCACCGGCACGTAATGCAC, (SEQ ID NO.:13) is reverse: CCCTCCAGACCACCATCTCG, (SEQ ID NO.:14) probe: GACTGACTGACTGACTGACTGACTGACTGACTGAC TGACCTTGGTTGAGGAGACAGC, (SEQ ID NO.:15)
PLIN6 (dbSNP rs#1052700 exon 9 (non-translational region) the contig position of 14995A＞T): 142163 Forward: AAGCAGCTGGCTCTACAAAGCA (SEQ ID NO.:16) is reverse: AGCATCCTTTGGGGCTTCA (SEQ ID NO.:17) probe: GACTGACTGACTGACTGACTGACTGACTGACTGACTGA CTGACTGACTGCCTGCTGGGAGCCT (SEQ ID NO.:18)
1: numbering is the base number of the A (being expressed as Nucleotide+1) of the ATG from variant to the initial methionine codon.
2: with reference to " http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi? locusId=5346 ".
3: the genome position in the reference sequences (GI21431190). 4: do not detect
5: viewed more uncommon gene frequency is less than 2%.
Table 2. depends on that sample selects: sample 1 (based on colony) and sample 2 (based on hospital), study experimenter's demography, biological chemistry and mode of life feature
Sample 1 Sample 2
Man (n=788) Woman (n=801) Man (n=29) Woman (n=128)
Mean value (SD) Mean value (SD) Mean value (SD) Mean value (SD)
Age (year) body weight (kg) height (m) 2Weight index (kg/m 2) waist (cm) stern (cm) waist-stern than fasting glucose (mg/dL) triglycerides (mg/dL) total-C (mg/dL) LDL-C (mg/dL) HDL-C (mg/dL) systolic blood pressure (mmHg) diastolic blood pressure (mmHg) obesity (BMI＞=30kg/m2) (%) overweight (BMI＞=25kg/m 2)(％) BMI＞35kg/m 2(%) take lipid lowering medicine (%) when education (%) elementary medium university (I and the II) diabetes B (%) of the activity of Ex smoker (%) alcohol user (%) sports (%) sitting 40.6(11.6) 78.9(11.1) 1.73(0.06) 26.4(3.5) 95.6(11.1) 100.8(9.9) 0.95(0.07) 92.6(24.4) 129.5(80.4) 206.4(38.8) 1347(34.8) 466(9.8) 124.7(16.1) 75.6(10.5) 15.0 617 1.6 39.5 90.6 36.3 63.7 43.7 32.3 24.0 3.8 5.7 42.4(14.8) * 64.4(12.7) * 1.59(0.06) * 25.7(5.4) * 88.3(15.4) * 102.0(13.0) 0.86(0.07) * 96.1(20.3) * 94.5(56.6) * 201.4(38.4) * 128.1(33.2) * 54.9(11.5) * 123.2(21.6) 74.6(12.5) 20.3 * 46.6 * 6.9 33.2 * 56.8 * 58.4 * 41.6 47.1 * 22.3 30.5 4.3 8.1 47.5(14.1) 125.2(29.5) 1.74(0.07) 40.9(8.9) 128.2(18.1) 126.0(21.3) 1.02(0.12) 126.2(54.2) 147.7(72.8) 187.1(30.4) 112.7(30.3) 44.7(13.1) 139.0(15.0) 83.7(11.6) 100.0 100.0 79.3 35.7 66.7 96.0 40 66.7 18.5 148 14.3 14.3 47.4(13.6) 106.8(19.1) * 1.58(0.05) * 42.7(8.2) 120.0(16.7) 132.4(11.6) 0.91(0.08) * 120.4(16.7) 148.2(83.8) 204.0(41.9) 125.2(33.7) 50.5(13.9) * 136.7(15.6) 84.9(11.1) 100.0 100.0 89.1 26.7 * 30.8 * 74.8 * 25.2 75.2 16.5 8.3 21.5 21.5
SD: standard deviation; Always-and C: total cholesterol; LDL-C: low density lipoprotein cholesterol; HLD-C: high density lipoprotein cholesterol.
*: the men and women relatively in P value＜0.05.Si Shi t check is used for mean value relatively, and chi square test is used for percentage ratio.
The I:3 of university.The II:5 of university or more than.
Table 3. genotype distribution, gene frequency and linkage disequilibrium of polymorphism genetic mutation on the PLIN locus in Mediterranean Sea Spaniard colony (sample 1).
Genotype PLIN1 PLIN4 PLIN5 PLIN6
The man The woman The man The woman The man The woman The man The woman
n(％) n(％) n(％) n?(％) n(％) n(％) n(％) n(％)
?11 ?12 ?22 309(40.8) 334(44.1) 114(15.1) 331(42.4) 342(43.8) 108(13.8) 405(52.5) 307(39.8) 60(7.8) 451(57.7) 271(34.7) 59(7.6) 282(36.2) 380(48.7) 118(15.1) 318(40.5) 345(43.9) 122(15.5) 328(44.6) 321(43.7) 86(11.7) 346(44.7) 333(43.0) 95(12.3)
Gene frequency and 95%CI
Allelotrope 2 0.364(0.347-0.381) 0.262(0.247-0.278) 0.385(0.368-0.402) 0.337(0.320-0.353)
Linkage disequilibrium between the variant: D; D ' and (p)
?PLIN1 ?PLIN4 ?PLIN5 ?PLIN6 0.159；0.958(p＜0.001) 0.033；0.149(p＜0.001) 0.031；0.191(p＜0.001) 0.085；0.394(p＜0.001) 0.078；0.453(p＜0.001) 0.066；0.320(p＜0.001)
CI: fiducial interval
The difference that sex causes between genotype is inapparent for PLIN1 (p=0.727), PLIN4 (p=0.097), PLIN5 (p=0.142) or PLIN6 (p=0.932) polymorphism.
Thereby, the men and women has been estimated gene frequency and linkage disequilibrium between the polymorphism.
D: linkage disequilibrium coefficient
D ': by the standardized linkage disequilibrium coefficient of the maximum value that can take D (D/Dmax)
Table 4: the frequency (man+woman) of the haplotype of 16 of four kinds of PLIN locus kinds of detections in the sample 1
Haplotype Frequency
PLIN1 PLIN4 PLIN5 PLIN6
1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 1 1 1 1 2 2 2 2 1 1 1 1 2 2 2 2 1 1 2 2 1 1 2 2 1 1 2 2 1 1 2 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 0.3885 0.0368 0.1250 0.0879 0.0046 0.0007 0.0001 0.0026 0.0401 0.0197 0.0184 0.0247 0.0435 0.0809 0.0459 0.0807
Table 5: according to weight index (BMI) phenotype relevant of carrier's state of each PLIN polymorphism place allelotrope 2 variant in the Mediterranean Sea Spaniard colony (sample 1) with obesity.The mean value that the age is regulated among the man.
The man
PLIN1 PLIN4 PLIN5 PLIN6
11 (n=309) mean value (SE) 12+22 (n=448) mean value (SE) P 11 (n=405) mean value (SE) 12+22 (n=367) mean value (SE) P 11 (n=282) mean value (SE) 12+22 (n=498) mean value (SE) P 11 (n=328) mean value (SE) 12+22 (n=407) mean value (SE) P
BMI (kg/m2) body weight (Kg) waist-stern than glucose (mg/dL) total-C (mg/dL) LDL-C (mg/dL) HDL-C (mg/dL) TG (mg/dL) SBP (mmHg) DBP (mmHg) 26.4(0.2) 78.8(0.6) 0.95(0.01) 94.0(1.3) 207.9(2.0) 136.9(2.0) 45.7(0.6) 130.0(4.8) 124.8(0.8) 75.5(0.6) 26.4(0.2) 78.8(0.5) 0.95(0.01) 94.3(1.1) 206.5(1.7) 134.4(1.7) 46.8(0.5) 133.7(4.5) 124.7(0.7) 75.9(0.5) 0.926 0.959 0.653 0.764 0.604 0.350 0.121 0.459 0.923 0.509 26.3(0.2) 78.6(0.5) 0.95(0.01) 94.3(1.2) 208.8(1.8) 137.1(1.8) 46.0(0.5) 130.1(4.1) 124.5(0.7) 75.1(0.5) ?26.5(0.2) ?78.9(0.5) ?0.96(0.01) ?92.8(1.2) ?204.5(1.9) ?133.0(1.9) ?46.8(0.5) ?134.8(4.4) ?124.7(0.8) ?76.2(0.5) 0.776 0.643 0.181 0.412 0.102 0.122 0.264 0.332 0.867 0.142 26.2(0.2) 78.3(0.6) 0.95(0.01) 94.3(1.4) 205.0(2.1) 133.4(2.2) 45.9(0.6) 129.2(4.9) 123.6(0.9) 74.9(0.6) 26.4(0.1) 78.9(0.4) 0.95(0.01) 93.6(1.1) 207.0(1.7) 135.5(1.7) 46.8(0.5) 133.6(4.8) 125.4(0.7) 76.0(0.5) 0.396 0.466 0.682 0.659 0.426 0.434 0.487 0.330 0.108 0.123 26.4(0.2) 78.9(0.6) 0.95(0.01) 94.4(1.3) 207.6(1.9) 135.2(2.0) 45.7(0.6) 133.1(4.7) 125.3(0.8) 75.5(0.6) 26.4(0.2) 78.8(0.5) 0.95(0.01) 94.9(1.2) 205.7(1.8) 134.6(1.8) 46.7(0.5) 133.9(4.3) 124.7(0.7) 76.0(0.5) 0.756 0.803 0.961 0.817 0.491 0.837 0.192 0.898 0.605 0.498
SE: standard error
Always-and C: total cholesterol; LDL-C: low density lipoprotein cholesterol; HLD-C: high density lipoprotein cholesterol.TG: triglyceride level, SBP: systolic blood pressure, DBP: diastolic blood pressure.Height is additionally adjusted body weight.
Table 6: according to weight index (BMI) phenotype relevant of carrier's state of each PLIN polymorphism place allelotrope 2 variant in the Mediterranean Sea Spaniard colony (sample 1) with obesity.The mean value that the age is regulated among the woman.
The woman
PLIN1 PLIN4 PLIN5 PL
11 (n=331) mean value (SE) 12+22 (n=450) mean value (SE) ?P 11 (n=451) mean value (SE) 12+22 (n=330) mean value (SE) ?P 11 (n=318) mean value (SE) 12+22 (n=467) mean value (SE) ?P 11 (n=346) mean value (SE)
BM (kg/m2) body weight (Kg) waist-stern than glucose (mg/dL) total-C (mg/dL) LDL-C (mg/dL) HDL-C (mg/dL) TG (mg/dL) SBP (mmHg) DBP (mmHg) 26.3(0.3) 65.7(0.6) 0.86(0.01) 97.8(0.9) 202.1(1.8) 127.9(1.8) 54.3(0.6) 99.5(3.0) 124.2(0.9) 75.5(0.6) 25.3(0.2) 63.5(0.5) 0.86(0.01) 95.5(0.9) 201.1(1.6) 128.6(1.5) 54.8(0.5) 95.1(2.6) 122.0(0.8) 74.1(0.5) ?0.004 ?0.007 ?0.519 ?0.090 ?0.652 ?0.761 ?0.498 ?0.099 ?0.097 ?0.105 26.1(0.2) 65.4(0.6) 0.87(0.01) 97.9(0.8) 201.3(1.6) 127.1(1.5) 54.2(0.5) 102.5(2.6) 123.5(0.8) 74.8(0.5) 25.2(0.3) 63.2(0.6) 0.85(0.01) 94.5(1.0) 201.4(1.8) 129.9(1.7) 55.0(0.6) 89.4(2.9) 121.9(0.9) 74.6(0.6) ?0.004 ?0.011 ?0.032 ?0.008 ?0.962 ?0.222 ?0.361 ?0.005 ?0.198 ?0.841 25.8(0.3) 64.5(0.6) 0.86(0.01) 96.8(0.9) 201.1(1.7) 127.8(1.8) 54.1(0.6) 102.0(3.0) 122.7(0.9) 74.4(0.6) 25.7(0.2) 64.4(0.5) 0.87(0.01) 96.6(0.8) 202.3(1.6) 128.9(1.5) 54.9(0.5) 95.4(2.6) 123.7(0.8) 75.0(0.5) ?0.965 ?0.844 ?0.172 ?0.862 ?0.645 ?0.653 ?0.245 ?0.207 ?0.433 ?0.410 25.9(0.4) 64.9(0.6) 0.87(0.01) 96.9(0.9) 200.8(1.8) 127.7(1.7) 53.8(0.6) 100.1(2.9) 123.2(0.9) 74.4(0.6)
SE: standard error
Table 7: from PLIN polymorphism among the men and women of sample 1 and sample 2 to the compound action of body weight and BMI
Group The PLIN polymorphism The woman The man
Body weight BMI Body weight BMI
PLIN1 PLIN4 PLIN5 PLIN6 n Mean value (SE) P Mean value (SE) P n Mean value (SE) P Mean value (SE) P
1 2 3 4 11 11 12 or 22 12 or 22 11 11 12 or 22 12 or 22 11 12 or 22 11 12 or 22 11 12 or 22 11 12 or 22 129 108 29 184 69.5(1.5) 72.2(1.6) 62.9(3.1) 66.1(1.3) 0.007 0.047 3 0.009 3 ＜0.05 1，2 0.003 2 27.7(0.6) 28.7(0.6) 24.8(1.2) 26.3(0.5) 0.005 0.043 3 0.006 3 ＜0.05 1，2 0.003 2 107 78 24 178 81.3(1.4) 81.9(1.7) 80.9(3.0) 81.5(1.1) 0.991 27.0(0.5) 27.2(0.5) 26.9(0.9) 27.0(0.4) 0.995
Table 8: according to the PLIN haplotype frequency of obesity/non-fat state and haplotype OR estimation among the woman
PLIN?SNP Non-obesity (n=237) Fat (n=122) OR * 95％CI
6209 11482 13041 14995 Lower limit The upper limit
The 4SNP haplotype
T T T T C C C C G G G G G A A A A G A G A A G A A A T T A A T T 0.306 0.133 0.045 0.039 0.082 0.089 0.067 0.109 0.267 0.112 0.063 0.072 0.047 0.065 0.103 0.120 1 § 0.81 1.36 2.09 0.58 0.77 1.79 1.21 0.40 0.47 0.83 0.25 0.31 0.82 0.58 1.63 3.91 5.23 1.34 1.92 3.92 2.52
2SNP haplotype (13041 and 14995)
A A G G A T A T 0.485 0.201 0.165 0.149 0.371 0.250 0.192 0.187 1 § 1.76 1.44 1.73 1.07 0.81 1.06 2.90 2.55 2.82
*: to the multiple adjusting of age, smoking, alcohol consumption and pharmacotherapy state
: likelihood ratio check global unit type effect: LRT statistical value=11.82, degree of freedom (df) is 7, P=0.107
: likelihood ratio check global unit type effect: LRT statistical value=8.60, df is 3, P=0.035
§: as haplotype with reference to processing.
Table 9: measure * according to genotypic blood plasma lipide of PLIN and glucose among the woman
Genotype P Genotype P
PLIN?6209T＞C PLIN?11482G＞A
FG(mg/dL) TG(mg/dL) TC(mg/dL) LDI?C(mg/dL) HDL-C(mg/dL) TC/HDL-C TT(n＝103) 94.2(2.7) 153.3(7.5) 215.3(3.9) 123.7(3.3) 61.0(1.4) 3.73(0.10) TC(n＝168) 97.0(2.1) 155.5(5.8) 210.8(3.0) 115.8(2.6) 63.5(1.1) 3.48(0.08) CC(n＝80) 95.8(3.1) 147.6(8.5) 219.8(4.4) 129.8(3.7) 60.7(1.6) 3.71(0.11) 0.831 0.914 0.223 0.006 0.190 0.078 GG(n＝163) 96.3(2.2) 147.9(5.9) 211.5(3.1) 121.1(2.6) 61.0(1.1) 3.63(0.08) GA(n＝154) 95.4(2.2) 159.8(6.0) 214.3(3.1) 118.6(2.7) 63.5(1.1) 3.56(0.08) AA(n＝34) 96.5(4.7) 150.6(12.9) 227.7(6.7) 136.2(5.7) 61.8(2.3) 3.69(0.17) 0.998 0.186 0.090 0.021 0.265 0.705
PLIN?13041A＞G) PLIN?14995A＞T
FG(mg/dL) TG(mg/dL) TC(mg/dL) LDL-C(mg/dL) HDL-C(mg/dL) TC/HDL-C AA(n＝151) 93.9(2.2) 147.7(6.1) 210.7(3.2) 120.4(2.7) 61.0(1.1) 3.60(0.08) AG(n＝164) 96.7(2.2) 154.5(5.9) 214.5(3.0) 120.4(2.6) 62.6(1.1) 3.57(0.08) GG(n＝36) 101.2(4.7) 170.2(12.8) 227.2(6.6) 1294(5.8) 648(2.4) 3.84(0.17) 0.410 0.172 0.081 0.342 0.298 0.333 AA(n＝138) 93.5(2.3) 145.4(6.4) 212.4(3.3) 120.2(2.9) 63.1(1.2) 3.56(0.08) AT(n＝159) 98.2(2.2) 156.3(6.0) 214.7(3.1) 121.3(2.7) 61.8(1.1) 3.65(0.08) TT(n＝55) 95.2(3.7) 164.0(10.1) 216.7(5.3) 123.7(4.6) 60.7(1.9) 3.61(0.13) 0.487 0.155 0.756 0.814 0.504 0.742
TC: total cholesterol.LDL-C: low density lipoprotein cholesterol; HLD-C: high density lipoprotein cholesterol.TG: triglyceride level; FG: fasting glucose.
*: represent with mean value (standard error).
: uniformity testing, carry out multiple adjusting to age, BMI, smoking, alcohol consumption and pharmacotherapy state.
Table 10: measure * according to genotypic blood plasma lipide of PLIN and glucose among the man
Genotype P Genotype
PLIN?6209T＞C PLIN?11482G＞A
FG(mg/dL) TG(mg/dL) TC(mg/dL) LDL-C(mg/dL) HDL-C(mg/dL) TC/HDL-C TT(n＝118) 107.4(3.2) 186.6(10.1) 211.1(4.1) 124.6(3.3) 48.0(1.1) 4.65(0.12) TC(n＝162) 1068(2.7) 189.9(8.6) 206.4(3.5) 123.5(2.8) 47.3(0.9) 4.57(0.11) CC(n＝75) 107.9(4.1) 192.5(12.9) 208.7(5.2) 125.1(4.2) 46.2(1.4) 4.77(0.16) 0.992 0.791 0.675 0.938 0.585 0.582 GG(n＝189) 109.4(2.6) 190.3(8.0) 206.7(3.2) 121.0(2.6) 47.9(0.9) 4.56(0.10) GA(n＝131) 105.3(3.1) 189.2(9.6) 210.3(3.9) 128.1(3.2) 46.0(1.1) 4.74(0.12) AA(n＝34) 103.2(6.0) 182.0(19.0) -212.1(7.6) 127.2(6.1) 49.2(2.1) 4.61(0.23)
PLIN?13041A＞G PLIN?14995A＞T
FG(mg/dL) TG(mg/dL) TC(mg/dL) LDL-C(mg/dL) HDL-C(mg/dL) TC/HDL-C AA(n＝160) 110.0(2.8) 191.3(8.6) 214.7(3.5) 129.3(2.8) 47.6(0.9) 4.75(0.11) AG(n＝151) 104.6(2.8) 196.4(8.9) 203.1(3.6) 119.7(2.9) 45.9(1.0) 4.62(0.11) GG(n＝44) 105.8(5.4) 157.8(16.7) 203.8(6.7) 120.6(5.4) 50.9(1.8) 4.30(0.21) 0.476 0.153 0.051 0.049 0.047 0.158 AA(n＝158) 109.9(2.8) 197.6(8.8) 208.7(3.5) 122.6(2.9) 46.7(1.0) 4.71(0.11) AT(n＝151) 104.8(2.9) 183.4(9.0) 207.0(3.6) 124.7(2.9) 47.5(1.0) 4.60(0.11) TT(n＝44) 106.3(5.4) 180.8(16.7) 213.8(6.7) 128.7(5.4) 49.3(1.8) 4.52(0.21)
TC: total cholesterol.LDL-C: low density lipoprotein cholesterol; HLD-C: high density lipoprotein cholesterol.TG: triglyceride level; FG: fasting glucose.
*: represent with mean value (standard error).
: uniformity testing, carry out multiple adjusting to age, BMI, smoking, alcohol consumption and pharmacotherapy state.
Table 11: Singapore's population is according to the descriptive characteristics of sex and ethnic group 1
Singapore
Chinese Malaysian The Indian
Man (n=1263) Woman (n=1500) Man (n=360) Woman (n=386) Man (n=286) Woman (n=312)
Age (year) BMI (kg/m 2) total-C (mmol/l) LDL-C (mmol/l) HDL-C (mmol/l) empty stomach TG (mmol//l) obesity (%) 2Overweight (%) 2When Ex smoker (%) alcohol user (%) diabetes (%) 38.2±12.3 23.5±3.7 5.52±1.04 3.54±0.95 1.27±0.32 1.69±1.55 54(4.28) 401(15.36) 298(23.36) 749(59.30) 40(3.17) 37.8±12.2 22.1±3.6 5.33±1.05 3.24±0.93 1.56±0.37 1.16±0.75 46(3.07) 140(9.33) 45(3.00) 494(32.93) 24(1.60) 39.6±12.7 24.7±4.0 5.88±1.13 3.95±1.02 1.15±0.28 2.00±1.59 29(8.06) 93(25.83) 162(45.00) 44(12.22) 16(4.44) 38.4±12.7 26.3±5.6 5.73±1.17 3.75±1.13 1.44±0.33 1.39±0.88 94(24.35) 152(39.38) 15(3.89) 12(3.11) 21(5.44) 41.3±12.1 24.6±4.0 5.72±1.17 3.88±1.08 1.06±0.29 2.08±1.78 22(7.69) 70(24.48) 87(30.42) 149(52.10) 27(9.44) 40.0±12.1 25.6±5.0 5.33±1.03 3.53±0.96 1.23±0.31 1.33±0.68 55(17.63) 117(37.50) 1(0.32) 55(17.63) 24(7.69)
1: continuous variable is expressed as mean value ± SD, and classified variable is expressed as case load and ubiquity percentage ratio.
2: obesity: BMI＞=30kg/m2; Overweight: BMI＞=25kg/m 2
Always-and C: total cholesterol.LDL-C: low density lipoprotein cholesterol; HLD-C: high density lipoprotein cholesterol.TG: triglyceride level.
Table 12: PLIN haplotype frequency and OR estimation in obese subjects and the non-fat contrast among the Chinese
The haplotype of inference Non-obesity (n=2663) Fat (n=100) OR(95％CI) P Adj-OR(95％CI) 1 P
Code 3 6209 10171 11482 13041 14995
The 5SNP haplotype
21111 11222 11212 12111 21121 12121 T C C C T C ?A ?A ?A ?T ?A ?T G A A G G G A G A A G G A T T A A A 0.220 0.173 0.191 0.189 0.052 0.041 0.256 0.178 0.215 0.183 0.044 0.034 1 2 1.05(0.67-1.63) 1.14(0.76-1.70) 0.99(0.62-1.58) 0.85(0.32-2.22) 0.83(0.30-2.28) 0.8387 0.5190 0.9625 0.7375 0.7204 1 2 1.02(0.65-1.60) 1.20(0.79-1.82) 1.04(0.65-1.69) 1.17(0.59-2.29) 0.83(0.31-2.24) 0.9298 0.3892 0.8586 0.6544 0.7100
The 3SNP haplotype
111 212 222 121 211 112 G A A G A G A A G G G A A T T A T T 0.414 0.192 0.174 0.108 0.036 0.035 0.270 0.249 0.227 0.129 0.043 0.048 1 2 1.07(0.74-1.56) 0.98(0.65-1.49) 0.76(0.37-1.58) 0.88(0.33-2.37) 0.76(0.37-1.56) 0.7154 0.9351 0.4619 0.8064 0.4562 1 2 1.10(0.75-1.63) 0.95(0.62-1.46) 0.75(0.34-1.62) 0.83(0.31-2.22) 0.82(0.38-1.74) 0.6230 0.8251 0.4588 0.7097 0.6006
1: to the joint of age, sex, smoking, alcohol consumption, exercise and diabetic disease states
2: as the reference unit type
3: 1 represents common allele, and the less important allelotrope of 2 representatives
Table 13: PLIN haplotype frequency and OR estimation in obese subjects and the non-fat contrast among the Malaysian
The haplotype of inference Non-obesity (n=623) Fat (n=123) OR(95％CI) P Adj-OR(95％CI) 1 P
Code 6209 10171 11482 13041 14995
The 5SNP haplotype
21111 11222 11212 12111 21121 11211 T C C C T C A A A T A A G A A G G A A G A A G G A T T A A T 0.241 0.173 0.189 0.153 0.074 0.034 0.159 0.229 0.248 0.102 0.081 0.037 1 2 1.64(1.08-2.48) 1.65(1.11-2.46) 0.80(0.44-1.44) 1.33(0.71-2.50) 1.30(0.54-3.11) 0.0197 0.0141 0.4536 0.3728 0.5561 1 2 1.67(1.07-2.60) 1.55(1.01-2.38) 0.82(0.45-1.50) 1.17(0.59-2.29) 1.23(0.52-2.93) 0.0227 0.0437 0.5316 0.6544 0.6389
The 3SNP haplotype
111 212 222 121 211 112 G A A G A G A A G G G A A T T A T T 0.414 0.192 0.174 0.108 0.036 0.035 0.270 0.249 0.227 0.129 0.043 0.048 1 2 2.12(1.36-3.32) 2.02(1.36-3.01) 1.89(1.05-3.41) 1.84(0.71-4.78) 2.30(0.97-5.30) 0.0010 0.0005 0.0332 0.2120 0.0599 1 2 2.04(1.28-3.25) 2.05(1.35-3.12) 1.59(0.87-2.90) 1.81(0.70-4.67) 2.25(0.96-5.25) 0.0029 0.0007 0.1331 0.2213 0.0610
1: to the adjusting of age, sex, smoking, alcohol consumption, exercise and diabetic disease states
2: as the reference unit type
3: 1 represents common allele, and the less important allelotrope of 2 representatives
Table 14: PLIN haplotype frequency and OR estimation in obese subjects and the non-fat contrast among the Indian
The haplotype of inference Non-obesity (n=521) Fat (n=77) OR(95％CI) P Adj-OR(95％CI) 1 P
Code 6209 10171 11482 13041 14995
The 5SNP haplotype
21111 11222 11212 12111 21121 12121 T C C C T C A A A T A T G A A G G G A G A A G G A T T A A A 0.247 0.179 0.078 0.082 0.157 0.051 0.237 0.154 0.154 0.025 0.160 0.052 1 2 0.87(0.53-1.42) 1.94(1.06-3.53) 0.30(0.09-1.06) 0.97(0.54-1.76) 1.04(0.44-2.46) ?0.5708 ?0.0305 ?0.0606 ?0.9176 ?0.9221 1 2 0.80(0.46-1.37) 1.67(0.87-3.22) 0.29(0.08-1.07) 0.91(0.49-1.70) 0.965(0.39-2.40) 0.4186 0.1234 0.0624 0.7722 0.9387
The 3SNP haplotype
111 212 222 121 211 122 G A A G A G A A G G G G A T T A T T 0.363 0.087 0.181 0.232 0.043 0.049 0.304 0.161 0.152 0.224 0.034 0.075 1 2 2.39(1.26-4.50) 0.98(0.58-1.66) 1.16(0.70-1.95) 0.77(0.19-3.17) 2.03(0.94-4.39) ?0.0073 ?0.9368 ?0.5577 ?0.7141 ?0.0714 1 2 2.16(1.10-4.26) 0.90(0.51-1.59) 1.11(0.63-1.95) 0.71(0.15-3.40) 2.08(0.93-4.67) 0.0261 0.7158 0.7147 0.6656 0.0751
1: to the adjusting of age, sex, smoking, alcohol consumption, exercise and diabetic disease states
2: as the reference unit type
3: 1 represents common allele, and the less important allelotrope of 2 representatives
Table 15: obesity protectiveness
Locus Haplotype (Caucasian) with reduction danger of obesity (people from Mediterranean Sea) (Malaysian) (Indian)
a b c d E f g h i j
PLIN1 C C C T C C C C C
PLIN3 T A T A A T
PLIN4 G A A G G G G
PLIN5 A A A A A A A
PLIN6 A A A A A A A
Table 16: the diagnosis of the danger of the increase of obesity
Locus Haplotype (Caucasian) with increase danger of obesity (people from Mediterranean Sea) (Malaysian) (Indian)
k l M n o p Q r s t u v w x y z
PLIN1 T T T T T T T T T
PLIN3 A A A A A
PLIN4 G G G G A A A A G A A G
PLIN5 G A G A G A G A G G A A G
PLIN6 T T T A T T T T T A T T T

Claims (21)

1. the method for the danger of the increase of obesity and obesity relative disease in definite individuality, it comprises step:
A) determine the genotype of PLIN1 6209T/C, PLIN310171A/T, PLIN4 11482G/A, PLIN5 13041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains;
B) based on the definite PLIN genotype generation unit type of step (a); With
C) described haplotype and this is individual ethnic background is related, wherein relevant with this individual ethnic background PLIN5-G/PLIN6T that is selected from, PLIN5-A/PLIN6-T, PLIN1-T/PLIN4-G/PLIN5-G/PLIN6-T, PLIN1-T/PLIN4-G, PLIN1-T/PLIN4-G/PLIN5-A/PLIN6-A, PLIN1-T/PLIN3-A/PLIN4-APLIN5-A/PLIN6-T, PLIN1-T/PLIN3-A/PLIN/4-A/PLIN5-G/PLIN6-T, PLIN4-A/PLIN5-A/PLIN6-T, PLIN4-A/PLIN5-G/PLIN6-T, PLIN4-G/PLIN5-G/PLIN6-A, the haplotype of PLIN1-T/PLIN3-A shows the danger of the increase of obesity and obesity relative disease in this individuality.
2. the method for the danger of the increase of obesity and obesity relative disease in definite Caucasian blood lineage individuality, it comprises step:
A) determine the genotype of PLIN1 6209T/C, PLIN411482G/A, PLIN5 13041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains;
B) based on the definite PLIN genotype generation unit type of step (a); With
C) described haplotype and this is individual ethnic background is related, and the haplotype that wherein is selected from PLIN5-G/PLIN6T, PLIN5-A/PLIN6-T and PLIN1-T/PLIN4-G/PLIN5-G/PLIN6-T shows the danger of the increase of obesity and obesity relative disease in this Caucasian blood lineage individuality.
3. the method for the danger of the increase of obesity and obesity relative disease in the blood lineage individuality of definite people from Mediterranean Sea, it comprises step:
A) determine the genotype of PLIN1 6209T/C, PLIN411482G/A, PLIN5 13041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains;
B) based on the definite PLIN genotype generation unit type of step (a); With
C) described haplotype and this is individual ethnic background is related, and the haplotype that wherein is selected from PLIN1-T/PLIN4-G, PLIN1-T/PLIN4-G/PLIN5-A/PLIN6-A, PLIN1-T/PLIN4-G/PLIN5-G/PLIN6-T shows the danger of the increase of obesity and obesity relative disease in the blood lineage individuality of this people from Mediterranean Sea.
4. the method for the danger of the increase of obesity and obesity relative disease in definite Malaysian blood lineage individuality, it comprises step:
A) determine the genotype of PLIN1 6209T/C, PLIN310171A/T, PLIN4 11482G/A, PLIN5 13041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains;
B) based on the definite PLIN genotype generation unit type of step (a); With
C) described haplotype and this is individual ethnic background is related, and the haplotype that wherein is selected from PLIN1-T/PLIN3-A/PLIN4-A/PLIN5-A/PLIN6-T, PLIN1-T/PLIN3-A/PLIN/4-A/PLIN5-G/PLIN6-T, PLIN4-A/PLIN5-A/PLIN6-T, PLIN4-A/PLIN5-G/PLIN6-T, PLIN4-G/PLIN5-G/PLIN6-A, PLIN1-T/PLIN3-A shows the danger of the increase of obesity and obesity relative disease in this Malaysian blood lineage individuality.
5. the method for the danger of the increase of obesity and obesity relative disease in definite Indian blood lineage individuality, it comprises step:
A) determine the genotype of PLIN1 6209T/C, PLIN310171A/T, PLIN4 11482G/A, PLIN5 13041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains;
B) based on the definite PLIN genotype generation unit type of step (a); With
C) described haplotype and this is individual ethnic background is related, and the haplotype that wherein is selected from PLIN1-T/PLIN3-A/PLIN4-A/PLIN5-A/PLIN6-T, PLIN4-A/PLIN5-A/PLIN6-T, PLIN4-G/PLIN5-G/PLIN6-T and PLIN1-T/PLIN3-A shows the danger of the increase of obesity and obesity relative disease in this Indian blood lineage individuality.
6. the method for the danger of the increase of obesity and obesity relative disease in definite Caucasian blood lineage individuality, it comprises the genotype of determining PLIN513041A/G and PLIN6 14995A/T locus from the biological sample that this individuality obtains, wherein in the PLIN5 locus in the homozygosity of allelotrope G or the PLIN6 locus homozygosity of allelotrope T show the danger of the increase of obesity and obesity relative disease in this Caucasian blood lineage individuality.
7. the method for the danger of the increase of obesity and obesity relative disease in definite Malaysian or the Indian blood lineage individuality, it comprises the genotype of determining PLIN6 14995A/T locus from the biological sample that this individuality obtains, and wherein the homozygosity of allelotrope T shows the danger of the increase of obesity and obesity relative disease in this Malaysian or the Indian blood lineage individuality in the PLIN6 locus.
8. the method for the danger of the increase of obesity and obesity relative disease in definite Malaysian or the Indian blood lineage individuality, it comprises the genotype of determining PLIN4 11482G/A locus from the biological sample that this individuality obtains, and wherein the homozygosity of equipotential gene A shows the danger of the increase of obesity and obesity relative disease in this Malaysian or the Indian blood lineage individuality in the PLIN4 locus.
9. the method for the danger of the increase of obesity and obesity relative disease in definite Malaysian or the Indian blood lineage individuality, it comprises the genotype of determining PLIN5 13041A/G locus from the biological sample that this individuality obtains, and wherein the homozygosity of allelotrope G shows the danger of the increase of obesity and obesity relative disease in this Malaysian or the Indian blood lineage individuality in the PLIN5 locus.
10. each method of claim 1-9, wherein said individuality is the woman.
11. each method of claim 1-9, wherein said individuality has been accepted the diet that loses weight.
12. each method of claim 1-9, wherein said obesity relative disease is a cardiovascular disorder.
13. each method of claim 1-9, wherein said obesity relative disease is a metabolism syndrome.
14. the method for the danger that reduces of obesity and obesity relative disease in definite individuality, it comprises step:
A) determine the genotype of PLIN1 6209T/C, PLIN310171A/T, PLIN4 11482G/A, PLIN5 13041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains;
B) based on the definite PLIN genotype generation unit type of step (a); With
C) described haplotype and this is individual ethnic background is related, and wherein relevant with this individual ethnic background haplotype that is selected from PI.IN5-A/PLIN6-A, PLIN1-C/PLIN4-G/PLIN5-A/PLIN6-A, PLIN1-C/PLIN4-A, PLIN1-C/PLIN4-A/PLIN5-A/PLIN6-A, PLIN1-T/PLIN3-T/PLIN4-G/PLIN5-A/PLIN6-A, PLIN1-C/PLIN3-A/PLIN/4-G/PLIN5-A/PLIN6-A and PLIN1-C/PLIN3-T shows the danger that reduces of obesity and obesity relative disease.
15. the method for the danger that reduces of obesity and obesity relative disease in definite Caucasian blood lineage individuality, it comprises step:
A) determine the genotype of PLIN1 6209T/C, PLIN411482G/A, PLIN4 13041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains;
B) based on the definite PLIN genotype generation unit type of step (a); With
C) described haplotype and this is individual ethnic background is related, and the haplotype that wherein is selected from PLIN5-A/PLIN6-A and PLIN1-C/PLIN4-G/PLIN5-A/PLIN6-A shows the danger that reduces of obesity and obesity relative disease in this Caucasian blood lineage individuality.
Go into the method for the danger that reduces of obesity and obesity relative disease in blood lineage's individuality 16. determine Mediterranean Sea, it comprises step:
A) determine the genotype of PLIN1 6209T/C, PLIN411482G/A, PLIN5 13041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains;
B) based on the definite PLIN genotype generation unit type of step (a); With
C) described haplotype and this is individual ethnic background is related, and the haplotype that wherein is selected from PLIN1-C/PLIN4-A and PLIN1-C/PLIN4-A/PLIN5-A/PLIN6-A shows the danger that reduces of obesity and obesity relative disease in the blood lineage individuality of this people from Mediterranean Sea.
17. the method for the danger that reduces of obesity and obesity relative disease in definite Malaysian blood lineage individuality, it comprises step:
A) determine the genotype of PLIN1 6209T/C, PLIN310171A/T, PLIN4 11482G/A, PLIN5 13041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains;
B) based on the definite PLIN genotype generation unit type of step (a); With
C) described haplotype and this is individual ethnic background is related, and the haplotype that wherein is selected from PLIN1-T/PLIN3-T/PLIN4-G/PLIN5-A/PLIN6-A, PLIN1-C/PLIN3-A/PLIN4-G/PLIN5-A/PLIN6-A and PLIN1-C/PLIN3-T shows the danger that reduces of obesity and obesity relative disease in this Malaysian blood lineage individuality.
18. the method for the danger that reduces of obesity and obesity relative disease in definite Indian blood lineage individuality, it comprises step:
A) determine the genotype of PLIN1 6209T/C, PLIN310171A/T, PLIN4 11482G/A, PLIN5 13041A/G, PLIN6 14995A/T locus from the biological sample that this individuality obtains;
B) based on the definite PLIN genotype generation unit type of step (a); With
C) described haplotype and this is individual ethnic background is related, and the haplotype that wherein is selected from PLIN1-C/PLIN3-A/PLIN4-G/PLlN5-A/PLIN6A, PLIN1-C/PLIN3-A/PLIN4-G/PLIN5-A/PLIN6-A and PLIN1-C/PLIN3-C shows the danger that reduces of obesity and obesity relative disease in this Indian blood lineage individuality.
19. each method of claim 14-18, wherein said individuality is the woman.
20. test kit, its primer that comprises the nucleic acid region that covers PLIN1 6209T/C, PLIN310171A/T, PLIN4 11482G/A, PLIN5 13041A/G and PLIN6 14995A/T polymorphism of being used to increase is right, and specification sheets, it comprises the related of the haplotype relevant with obesity danger that increase or that reduce and they and ethnic group.
21. test kit, its SEQ ID NO:1 and SEQ ID NO:2 primer that comprises the nucleic acid region that covers the PLIN1 polymorphism of being used to increase is right; The SEQ ID NO:7 and the SEQ ID NO:8 primer of the nucleic acid region that covers the PLIN3 polymorphism of being used to increase is right; The SEQ ID NO:10 and the SEQ ID NO:11 primer of the nucleic acid region that covers the PLIN4 polymorphism of being used to increase is right; The SEQ ID NO:13 and the SEQ IDNO:14 primer of the nucleic acid region that covers the PLIN5 polymorphism of being used to increase is right; Right with the SEQ ID NO:16 and the SEQ ID NO:17 primer of the nucleic acid region that covers the PLIN6 polymorphism of being used to increase; And specification sheets, it comprises the related of the haplotype relevant with obesity danger that increase or that reduce and they and ethnic group.
CNB2004800343025A 2003-09-22 2004-06-10 Genetic markers for obesity Expired - Fee Related CN100471863C (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US50483003P 2003-09-22 2003-09-22
US60/504,830 2003-09-22
US60/519,109 2003-11-12
US60/544,524 2004-02-13

Related Child Applications (2)

Application Number Title Priority Date Filing Date
CNA2009100061019A Division CN101492737A (en) 2003-09-22 2004-06-10 Genetic markers for obesity
CNA2009100030006A Division CN101565743A (en) 2003-09-22 2004-06-10 Genetic markers for obesity

Publications (2)

Publication Number Publication Date
CN1882604A true CN1882604A (en) 2006-12-20
CN100471863C CN100471863C (en) 2009-03-25

Family

ID=37520190

Family Applications (3)

Application Number Title Priority Date Filing Date
CNA2009100030006A Pending CN101565743A (en) 2003-09-22 2004-06-10 Genetic markers for obesity
CNB2004800343025A Expired - Fee Related CN100471863C (en) 2003-09-22 2004-06-10 Genetic markers for obesity
CNA2009100061019A Pending CN101492737A (en) 2003-09-22 2004-06-10 Genetic markers for obesity

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CNA2009100030006A Pending CN101565743A (en) 2003-09-22 2004-06-10 Genetic markers for obesity

Family Applications After (1)

Application Number Title Priority Date Filing Date
CNA2009100061019A Pending CN101492737A (en) 2003-09-22 2004-06-10 Genetic markers for obesity

Country Status (1)

Country Link
CN (3) CN101565743A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105256007A (en) * 2015-09-24 2016-01-20 郑州大学 Genotyping method of human PLIN1 gene rs2289487 site polymorphism
CN105420350A (en) * 2015-09-24 2016-03-23 郑州大学 Detection method of human PLIN1 gene rs2289487 site polymorphism and kit

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101890172B (en) * 2010-07-02 2012-01-25 刘云 Application of S100A16 gene in preparing drug for treating obesity

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105256007A (en) * 2015-09-24 2016-01-20 郑州大学 Genotyping method of human PLIN1 gene rs2289487 site polymorphism
CN105420350A (en) * 2015-09-24 2016-03-23 郑州大学 Detection method of human PLIN1 gene rs2289487 site polymorphism and kit

Also Published As

Publication number Publication date
CN101492737A (en) 2009-07-29
CN100471863C (en) 2009-03-25
CN101565743A (en) 2009-10-28

Similar Documents

Publication Publication Date Title
CN1604968A (en) Methods to treat diabetes and related conditions based on polymorphisms in the TCF-1 gene
CN1547613A (en) Method of estimating the risk of expression of adverse drug reaction caused by the administration of a compound, which is either metabolized per se by UGT1A1 enzyme or whose metabolic intermediate is
CN1942480A (en) Identification of SNPs associated with hyperlipidemia, dyslipidemia and defective carbohydrate metabolism
CN1882604A (en) Genetic markers for obesity
CN1306040C (en) Quantitative diagnostic analysis of hypertonia
CN1891822A (en) PH gene with specific mononucleotide pleimorphism, and its detecting method and use
CN1503847A (en) Genetic test for the identification of carriers of complex vertebral malformations in cattle
CN1211486C (en) A DNA molecule encoding mutant prepro-neuropeptide Y, a mutant signal peptide, and uses thereof
CN1958605A (en) SPG3A gene mutation, encoded production, and application
CN1165628C (en) Diagnosis of diseases associated with coronary twitching
CN1749415A (en) Pannonit treatment acute angina pectoris curative effect detection method and test kit
CN1940086A (en) Method for determining patient's brain ictus genetic susceptibility
CN1891823A (en) CETP gene with specific mononucleotide pleiomorphism, and its detecting method and use
CN1882705A (en) Use of genetic polymorphisms to predict drug-induced hepatotoxicity
CN1311305A (en) New polypeptide-heparan sulfate 3-0-sulfotransferase 19 and polynucleotide for coding such polypeptide
CN1515686A (en) Kit for predicting susceptibility of diabetes and its primer
CN1871349A (en) Method and kit for estimating side effect by paclitaxel therapy
CN1548556A (en) Reagent kit and primer for predicting susceptibility of type-II diabetes
CN1381576A (en) Polypeptide-fructose-1,6-diphosphase-15.51 and polynucleotide for coding it
CN1515685A (en) Kit for predicting susceptibility of diabetes and its primer
CN1324947A (en) New polypeptide acid phosphatase 13 and polynucleotides for encoding same
CN1778818A (en) Pig production and immune character related protein, its coding gene and use
CN1363680A (en) Polypeptide-beta lactamase 20.24 and polynucleotide for coding it
CN1363666A (en) Polypeptide-Cu/Zn superoxide dismutase 11.22 and polynucleotide for coding it
CN1361118A (en) New polypeptide Cu/Zn SOD protein 9.9 and polynucleotides encoding this polypeptide

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C17 Cessation of patent right
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20090325

Termination date: 20120610