CN105256007A - Genotyping method of human PLIN1 gene rs2289487 site polymorphism - Google Patents

Abstract

The invention discloses a genotyping method of human PLIN1 gene rs2289487 site polymorphism. The genotyping method comprises following steps: human genome DNA to be determined is provided; upstream primers and downstream primers used for amplification of sequences near human PLIN1 gene rs2289487 site are provided, wherein the downstream primers possess mismatched base T; the human genome DNA to be determined is taken as a template, and the upstream primers and the downstream primers are used for PCR amplification so as to obtain amplification products containing RTAC segments, wherein R is used for representing base A or G to be determined on human PLIN1 gene rs2289487 site; a restriction enzyme is provided; the restriction enzyme is used for enzyme digestion of the amplification products so as to obtain corresponding enzyme-digested products; and it is determined that R is used for representing base A or G based on the enzyme-digested products. The restriction enzyme is a restriction enzyme only used for realizing restriction digestion of one segment selected from GTAC and ATAC. The genotyping method is rapid and reliable; and determination cost is reduced greatly.

Description

People PLIN1 gene rs2289487 loci polymorphism genotyping technique

Technical field

The present invention relates to the method measuring single nucleotide polymorphism.

Background technology

SNP (single nucleotide polymorphism) refers to and comprises the forms such as the displacement of single base, insertion and disappearance by the mutant dna sequence that the change of single core thuja acid causes.Gene pleiomorphism is individual inherent hereditary feature, does not change with environment, neither the special or non-specific clinical manifestation of certain disease, and therefore its application does not exist Diagnosis and Treat effect.

Genetic polymorphism detection is widely used in genetic arts and medical field, is exemplified below: 1. study the genetics such as the origin of species and evolution phenomenon.According to genovariation situation, obtain the information of biomacromolecule, infer organic evolution history, illustrate spore relation.Be applied in archeology to determine the sibship of ancient human's heritable variation feature and different population.2. research polymorphic with population genetics etc. genetics research.Polymorphic also closely related with various characteristics of human body, comprise height, body weight, the colour of skin, Facial Features etc.3. may be used for prophylaxis in preventive medicine field.By the tolerance of researching human body to poisonous substance, find to be easy to, to the individuality of certain poisonous substance generation toxic action, avoid this individuality and toxicant exposure in time, protect this Susceptible population.Such as, carry out polymorphic detection to the crowd preparing to be engaged in the organic solvents such as Contact benzene, examination goes out easily to occur the individuality that hematotoxicity, neurotoxicity etc. are reacted, and makes it away from organic solvents such as benzene, protects this type of Susceptible population to encroach on from poisonous substance.4. may be used for medicament selection in pharmacology and dosage is determined.Can judge that diseased individuals is responsive to certain poisonous side effect of medicine by polymorphic detection, thus avoid using this kind of medicine to exempt its toxic action.By judging the individual level of response determination drug dose to effect of drugs, reduce drug dose and side effect thereof.

PLIN1 gene is positioned at karyomit(e) 15q26.1, and the perilipin albumen of coding plays an important role in fat metabolic process.PLIN1 gene rs2289487 site is polymorphic, there are two kinds of allelotrope A and G in crowd, form the genotype of three kinds of PLIN1 genes: AA type (two allelotrope bases of human genome rs2289487 polymorphic site are A), AG type (two allelotrope bases of human genome rs2289487 polymorphic site are respectively A and G) and GG type (two allelotrope bases of human genome rs2289487 polymorphic site are G).

Polymerase chain reaction-restriction fragment length polymorphic (PCR-RFLP) technology is a kind of quick, easy, accurate, low cost mensuration SNP (single nucleotide polymorphism) genotypic classical way.The method carries out amplified reaction by primer to template, forms sufficient amount and stable amplified production, by cutting and detect the fragment length of digestion products to the enzyme of amplified production, finally determines SNP.PLIN1 gene rs2289487 polymorphic site takes PCR-RFLP technology to detect, and required restriction endonuclease is BsmI restriction endonuclease, and its price costly, needs to develop new detection technique.

Summary of the invention

The object of this invention is to provide the reliable means of the mensuration people PLIN1 gene rs2289487 loci polymorphism of the diagnosis of a kind of non-diseases or therapeutic purpose.

According to a first aspect of the invention, provide a kind of method measuring people PLIN1 gene rs894160 loci polymorphism, comprising:

Human gene group DNA to be measured is provided;

There is provided upstream primer and the downstream primer of amplification people PLIN1 gene rs2289487 location proximate sequence, wherein downstream primer has base mismatch T;

With described human gene group DNA to be measured for template, utilize upstream primer and downstream primer to carry out pcr amplification reaction to obtain containing the amplified production of RTAC fragment, wherein R is base A undetermined on people PLIN1 gene rs2289487 site or G;

Restriction enzyme is provided;

Utilize restriction enzyme to carry out enzyme to gained amplified production and cut (reaction) to obtain corresponding digestion products; And

Determine that the base R undetermined on people PLIN1 gene rs2289487 site is A or G according to gained digestion products,

Wherein, restriction enzyme is the restriction enzyme that only can cut one of GTAC fragment and ATAC fragment.

According to embodiments of the invention, on gained amplified production, a base A of being separated by between the pairing base of base mismatch T and the R of downstream primer.Surprisingly, so arrange base mismatch endonuclease reaction will be made to carry out extremely smooth, there will not be enzyme to cut the phenomenons such as insufficient.Further, so arrange upstream primer base mismatch and PCR reaction is well on, improve sensitivity and the specific degree of PCR, this may be relevant with making the secondary structural change of extension increasing sequence after base mismatch.

In a particular embodiment of the present invention, on gained amplified production, the pairing base of downstream primer terminal bases and R is adjacent.Such as, downstream primer end can be ... the structures such as TA.

In a preferred embodiment of the invention, restriction enzyme can adopt the Cviqi or its isoschizomers, RsaI or its isoschizomers that can cut GTAC fragment.This kind of Cviqi enzyme or RsaI enzyme cheap, greatly can reduce cost of determination.

According to embodiments of the invention, gained digestion products comprises three kinds of clip types: have total fragment length do not cut off amplified production, cut off after there is amplified production (usually can not effectively observe) compared with having after the amplified production of long segment and (usually can not effectively observe) cut-out compared with short-movie section.The clip types comprised by observation (judgement) digestion products determines that the base undetermined on people PLIN1 gene rs2289487 site is A or G.Such as, when adopting Cviqi enzyme or RsaI enzyme, judge compared with the observations of these two fragments of long segment according to total fragment with after cutting off: if observe digestion products only have a kind of there is total fragment length do not cut off amplified production, then base undetermined is A; Only have one to have the cut-out product of comparatively long segment (being less than total fragment length) if observe digestion products, then base undetermined is G; If observe said two devices, then base undetermined not only comprises A but also comprise G.

In one embodiment of the invention, the clip types that judgement (or observation) digestion products comprises is schemed to contrast to carry out with reference after being taken pictures by gel electrophoresis associating ultraviolet lamp.In this case, preferably reference figure is that amplified production obtains and only has first with reference to picture position and second with reference to picture position after the gel electrophoresis standard setting time after ultraviolet lamp is taken pictures, wherein first with reference to picture position for be the amplified production of the total fragment length do not cut off, second with reference to picture position then for be cut off after there is amplified production compared with long segment.Such as, the present invention adopt with reference to figure be by 148bp and 108bp synthesized two base fragments simultaneously after gel electrophoresis same time ultraviolet lamp take pictures and form.Compared with the compound reference figure of conventional DNAladder, owing to have employed, only there are two specific reference figure with reference to picture position, this method of the present invention intuitively can be observed rapidly or judge the clip types that digestion products comprises, and avoids erroneous judgement to greatest extent simultaneously.After endonuclease reaction, preferably carry out electrophoresis by after concentrated for digestion products 1 ~ 2 times of concentration, increase brightness of image, improve judgment accuracy.

In a preferred embodiment of the invention, make total fragment length of amplified production between 100 to 300bp by designing the length of upstream primer and downstream primer, and the fragment length of upstream primer is at least 35bp, preferred length 40 ~ 60bp (amplified reaction especially smoothly fully between this dominant area), makes enzyme fall Partial Fragment length earnestly and accounts for the per-cent of total fragment length more than 20%.This design of the present invention has the electrophoresis ultraviolet photo of the amplified production compared with long segment position after can making to have not cutting off amplified production and cutting off of total fragment length is distinguished significantly.But if total fragment is long, then electrophoretic mobility shift is by not obvious; Too short, image can thicken a slice, cannot accurately distinguish.The fragment length scope of upstream primer ensure that pcr amplification reaction can carry out smoothly, the amplification that there will be when avoiding base mismatch not foot phenomenon.

In a preferred embodiment of the invention, by controlling the scope of annealing temperature in pcr amplification program between 55 ~ 70 DEG C, preferable temperature 60 ~ 69 DEG C (this temperature can improve the specificity of amplified reaction), make the PCR primer purity of design higher.This design of the present invention can make pcr amplification product band clear, occurs, be easy to electrophoresis identification without assorted band.But if temperature is too low, then few the and assorted band of specific band is too much, is difficult to after electrophoresis distinguish and judges; If temperature is too high, then affects pcr amplification efficiency and make specific amplified production very few, affect observing effect.

In a preferred embodiment of the invention, by controlling to extend the scope of time between 10 ~ 60s in pcr amplification program, preferred time 15 ~ 30s (this time can improve the efficiency of amplified reaction and the specificity of amplified production), make the PCR reaction times of design shorter, amplified production purity is higher.This design of the present invention can make pcr amplification product band clear, occurs, be easy to electrophoresis identification, and the PCR time is shorter without assorted band.But if the time is too short, then specific band can not increase completely and make amplified production less, be difficult to after electrophoresis distinguish judgement; If overlong time, then increase the occurrence probability of non-specific band, occur that assorted band affects observing effect.

In the present invention, PCR reacted constituent can comprise DNA profiling, upstream and downstream primer, TaqDNApolymerase (archaeal dna polymerase or also can be called " Taq enzyme "), damping fluid, Mg ²⁺deng.In the present invention, PCR reacted constituent can comprise DNA profiling, upstream and downstream primer, TaqDNApolymerase (archaeal dna polymerase or also can be called " Taq enzyme "), damping fluid, Mg ²⁺deng.In a preferred embodiment of the invention, TaqDNApolymerase (archaeal dna polymerase) and TaqAntibody thereof can be used in pcr amplification reaction.TaqAntibody is the monoclonal antibody of TaqDNApolymerase, it suppresses DNA polymerase activity after being combined with TaqDNApolymerase, both avidity is very high, even if the activity of TaqDNApolymerase still can be closed at 65 DEG C, the non-specific amplification that therefore can effectively suppress the non-specific annealing of primer and primer dimer to cause, has high amplification sensitivity and specificity.ChampagneTaqAntibody only needs to get final product complete deactivation at 95 DEG C of heating 30s, and release TaqDNApolymerase is active, ensure that subsequent PCR amplification reaction can be carried out smoothly.

The Tris-HCl damping fluid that pH value is 8.1 ~ 8.7 can be added in PCR reaction, adjust PCR solution ph when 72 DEG C of extensions between 6.8 ~ 7.8, thus make Taq enzyme play activity better in slight alkali environment.In addition, gelatin (0.01%) can also be added in PCR solution to reduce the adsorption of PCR pipe to Taq enzyme, stabilized enzyme activity and provide protection, promote PCR reaction.

In addition, Mg in PCR solution ²⁺when concentration is between 1.5 ~ 2.0mmol/L, can well control PCR react productive rate and specificity.

The final concentration that PCR reacts primer is generally about 0.1 ~ 1 μM, and the too high meeting of concentration causes non-specific amplification, and too low then amplified production very little.

In addition, can also add solubility promoter methyl-sulphoxide (DMSO) and ammonium sulfate to reduce base mispairing level in PCR reaction, the amplification efficiency of GC template is rich in raising.This with the secondary structure eliminating primer and template, may reduce DNA melting temperature(Tm) and makes DNA sex change completely relevant.

According to a further aspect in the invention, provide a kind of test kit for measuring people PLIN1 gene rs2289487 loci polymorphism, it comprises:

For upstream primer and the downstream primer of pcr amplification people PLIN1 gene rs2289487 location proximate sequence, wherein downstream primer has base mismatch T to obtain containing the amplified production of GTAC fragment, and wherein R is base A undetermined on people PLIN1 gene rs2289487 site or G; And

Only can cut the restriction enzyme of one of GTAC fragment and ATAC fragment.

Can also comprise other composition in mentioned reagent box, such as PCR reacts Mix and (comprises 4 kinds of dNTP mixtures, Mg ²⁺, TaqDNApolymerase, TaqAntibody, damping fluid, DMSO and ammonium sulfate) and for implement measure specification sheets etc.

It will be understood by those skilled in the art that unless there are obvious conflict, the correlated characteristic of a first aspect of the present invention and second aspect can combine mutually.

Mensuration means of the present invention are not only fast and reliable, and cost of determination reduces greatly.

Accompanying drawing explanation

Fig. 1 describes the digestion products electrophoresis ultraviolet photo that method according to the present invention obtains.Wherein Marker is: standard reference position; Swimming lane 1:GG genotype; Swimming lane 2:AG genotype; Swimming lane 3:AG genotype.

Embodiment

Describe the present invention below.It will be appreciated by those skilled in the art that following detailed description only for illustration of and non-limiting the present invention.

(1) acquisition of DNA to be measured

Gather different crowd peripheral blood, after extracting genomic dna, carry out the mensuration of PLIN1 gene rs2289487 loci polymorphism below.

For the selection of DNA to be measured, the not special restriction of the present invention.Both can be obtain in vitro sample from the body fluid of human body or tissue, the genome of degradation treatment in advance can also be through.For convenience of implementation, usually preferably in vitro sample is extracted from blood.Wherein said tissue comprises the tissue containing all or at least PLIN1 gene in human body, and with whether express this PLIN1 gene and have nothing to do.The method extracting DNA from body fluid and/or tissue well known to a person skilled in the art, and can with reference to conventional molecular biology manual, and such as " molecular cloning " the 2nd edition carries out.

(2) design of primers and synthesis

Search Gene database and the snp database of NCBI website, obtain PLIN1 gene complete sequence and rs2289487 polymorphic site information respectively.Rs2289487 polymorphic site R front and rear part base sequence (base sequence represents with 5' → 3', capital and small letter same meaning) following (SEQIDNO:1):

Carry out upstream primer and downstream primer design according to gene order, wherein, downstream primer introduces base mismatch.On final gained amplified production, a base A of being separated by between the pairing base of base mismatch T and the R of downstream primer.

In the present invention, downstream primer has base mismatch T, and length is 35 ~ 60bp.In one of them embodiment, primer is as follows, upstream primer: 5'GTGATGGAGGAGAGTCTGGAAG3'(SEQIDNO:2), downstream primer: 5'CTGCCTCCCTGCCTGTGTATCCCGACCCCACTGCCTAG ta3'(SEQIDNO:3), wherein downstream primer underscore base is base mismatch.

(3) pcr amplification product is prepared

Formulate pcr amplification program and condition according to upstream primer and downstream primer feature and PCR corresponding reagent, prepare pcr amplification product.In one of them embodiment, get genomic dna (50 ~ 80ng), upstream and downstream primer (final concentration is 0.1 ~ 1 μM), 2 × PCRMix7.5 μ L (comprise 4 kinds of dNTP mixtures, Mg ²⁺, TaqDNApolymerase, TaqAntibody, damping fluid, DMSO and ammonium sulfate) and distilled water jointly form 15 μ L reaction systems, adjustment pH value of solution be about 7.3.PCR reaction conditions is: 95 DEG C of denaturation 30s, and DEG C annealing 30s → 72 DEG C, 95 DEG C of sex change 30s → 60 extend 20s totally 30 circulations, and 72 DEG C extend 7min.Stable amplified production is obtained after PCR reaction.

(4) endonuclease reaction

The present invention can adopt Cviqi, RsaI restriction endonuclease, polymorphic qualification for PLIN1 gene rs2289487 site provides the restriction endonuclease that plurality of optional is selected, its price and base near polymorphic site are without compared with restriction endonuclease BsmI adoptable in mispairing situation, very cheap, suitable restriction endonuclease can be selected according to market value during experiment.Restriction endonuclease price is as shown in table 1.

Table several endonuclease recognition sequence of 1NEB company and price thereof

Note: N is A or T or C or G

In one of them embodiment, get PCR primer 10 μ L, add 5U restriction endonuclease Cviqi, 2 μ L10 × enzyme cutting buffering liquids and 7.5 μ L distilled waters and form 20 μ L reaction systems, in 25 DEG C of water-baths, enzyme cuts 4 ~ 12h, obtain digestion products, digestion products is observed through 1 times of concentrated rear electrophoresis.

(5) electrophoresis test

In one of them embodiment, if PCR primer can not be cut after Cviqi enzyme is cut, be still 148bp, if be cut open, occur that (cut generation sticky end due to Cviqi enzyme makes its complementary strand bases number different to 108bp with 40bp, therefore after cutting, fragment length is as the criterion with strand base number in gene order and calculates), be wherein difficult in 40bp fragment electrophoretic figure differentiate.

By digestion products in 2 ~ 4% sepharoses under 3 ~ 8V/cm condition, electrophoresis 30 ~ 80min, mensuration of taking pictures under ultraviolet lamp.Restriction enzyme digestion and electrophoresis is shown in Fig. 1, and the presence or absence according to 148bp and 108bp fragment judges genotype: AA type is 148bp fragment, and AG type has 148bp, 108bp fragment, and GG type is 108bp fragment.

Here implements some embodiments of the present invention.

Embodiment 1 is extracted human peripheral leucocytes DNA and is measured rs2289487 polymorphism

1 materials and methods

1.1 main agents and instrument

Reagent: 2 × PCRMix (comprises 4 kinds of dNTP mixtures, Mg ²⁺, TaqDNApolymerase, TaqAntibody, damping fluid, DMSO and ammonium sulfate) (Vazyme company), restriction enzyme Cviqi (NEB company), agarose (Biowest company), primer is synthesized by Shanghai Sangon company.

Instrument: 9600 type PCR instrument (PE company), miniature electrophoresis chamber (PharmaciaBiotech, EPS1000), GelDoc2000 gel imaging instrument (Bio-RAD company).

1.2 extract DNA as testing gene group DNA profiling from peripheral blood leucocyte

EDTA-K ₂anticoagulant tube gathers human peripheral 1mL, white corpuscle separation is carried out with reference to leukocytic separation method in " practical flow cytometry icones ", white corpuscle genomic dna is extracted with reference to NaCl salting-out method in " molecular cloning ", and as human gene group DNA's template to be measured.

1.3 sequences are searched and design of primers

PLIN1 gene order and rs2289487 polymorphic site information is searched to design primer in NCBI website, specific as follows:

Upstream primer: 5'GTGATGGAGGAGAGTCTGGAAG3'(SEQIDNO:2);

Downstream primer: 5'CTGCCTCCCTGCCTGTGTATCCCGACCCCACTGCCTAG ta3'(SEQIDNO:3)

1.4PCR amplification

Get genomic dna (50 ~ 80ng), upstream and downstream primer (final concentration is 0.1 ~ 1 μM), 2 × PCRMix7.5 μ L (comprise 4 kinds of dNTP mixtures, Mg ²⁺, TaqDNApolymerase, TaqAntibody, damping fluid, DMSO and ammonium sulfate), sterilizing distilled water supplies 15 μ l reaction systems, adjustment pH value of solution be about 7.3.

PCR reaction conditions is: 95 DEG C of denaturation 30s, and DEG C annealing 30s → 72 DEG C, 95 DEG C of sex change 30s → 60 extend 20s totally 30 circulations, and 72 DEG C extend 7min.Stable amplified production is obtained after PCR reaction.

1.5 enzymes cut qualification

After pcr amplification, get PCR primer 10 μ l, add 5U restriction endonuclease Cviqi and 2 μ l10 × enzyme cutting buffering liquid and sterilizing distilled water and form 20 μ l reaction systems, after enzyme cuts 4h in 25 DEG C of water-baths, obtain digestion products.

After above-mentioned digestion products is concentrated through 1 times, under 3% sepharose 5V/cm condition, electrophoresis 40min, qualification Polymorphic type of taking pictures under ultraviolet lamp.

2 results

2.1PCR amplification

Sequence (it is positioned at 394 ~ 541 places of SEQIDNO:1 base sequence, altogether 148bp) after amplification, the amplified production sequence obtained following (SEQIDNO:4):

In amplification after product sequence, underscore part is respectively the sequence corresponding to upstream, downstream primer, and R represents the polymorphic i.e. SNP site rs2289487 of A/G.

2.2 enzymes cut result

Product Sequence after restriction endonuclease Cviqi enzyme is cut is as follows respectively:

When this polymorphic site contains G allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 108bp (this fragment downstream sequence forms sticky end because enzyme is cut and increases by 2 bases than upstream sequence) sequence (SEQIDNO:5):

When this polymorphic site contains G allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 40bp (this fragment downstream sequence forms sticky end because enzyme is cut and reduces by 2 bases than upstream sequence) sequence (SEQIDNO:6):

tactaggcagtggggtcgggatacacaggcagggaggcag40

Take pictures under ultraviolet lamp after digestion products electrophoresis qualification, result is shown in Figure 1.Wherein, there is 148bp segment after the amplification of rs2289487 site.Cut rear electrophoresis through Cviqi enzyme and there will be 148bp, 108bp and 40bp tri-kinds of segments (wherein 40bp not easily differentiates in electrophorogram).

Cut rear electrophoresis through Cviqi enzyme and carry out genotype judgement: as shown in Figure 1, AA type is 148bp fragment, and AG type has 148bp and 108bp two kinds of fragments, and GG type is 108bp fragment.

The polymorphic result in 2.3PLIN1 gene rs2289487 site

Detect 88 routine personnel altogether, detected result finds that GG type 31 example, AG type 27 example and AA type 30 example appear in rs2289487 site.

Embodiment 2 human peripheral whole blood sample measures rs2289487 polymorphism

Main agents and instrument are with embodiment 1.Peripheral blood genomic dna is extracted with reference to phenol-chloroform extraction process in " molecule clone technology ", and as human gene group DNA's template to be measured.

Sequence searches same embodiment 1, and design primer sequence is as follows:

Upstream primer: 5'CGTGATGGAGGAGAGTCTGGAAGCTT3'(SEQIDNO:7);

Downstream primer: 5'ACTGCCTCCCTGCCTGTGTATCCCGACCCCACTGCCTAG ta3'(SEQIDNO:8)

Get genomic dna (50 ~ 80ng), upstream and downstream primer (final concentration is 0.1 ~ 1 μM), 2 × PCRMix10 μ L (comprise 4 kinds of dNTP mixtures, Mg ²⁺, TaqDNApolymerase, TaqAntibody, damping fluid, DMSO and ammonium sulfate), sterilizing distilled water supplies 20 μ l reaction systems, adjustment pH value of solution be about 7.3.

PCR reaction conditions is: 95 DEG C of denaturation 30s, and DEG C annealing 20s → 72 DEG C, 95 DEG C of sex change 30s → 60 extend 20s totally 30 circulations, and 72 DEG C extend 10min.

Enzyme cuts qualification: get PCR primer 10 μ l, and add 5U restriction endonuclease Cviqi, 2 μ l10 × enzyme cutting buffering liquids and sterilizing distilled water and form 20 μ l reaction systems, in 25 DEG C of water-baths, enzyme cuts 4h, obtains digestion products.After digestion products is concentrated through 1 times, under 2.5% sepharose 5V/cm condition, electrophoresis 40min, qualification of taking pictures under ultraviolet lamp.

Result:

Sequence (it is positioned at 393 ~ 542 places of SEQIDNO:1 base sequence, altogether 150bp) after amplification, the amplified production sequence obtained following (SEQIDNO:9):

In amplification after product sequence underscore part be upstream, sequence corresponding to downstream primer, R represents the polymorphic i.e. SNP site rs2289487 of A/G.

Enzyme cut after Product Sequence respectively as follows:

When this polymorphic site contains G allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 109bp (this fragment downstream sequence forms sticky end because enzyme is cut and increases by 2 bases than upstream sequence) sequence (SEQIDNO:10):

When this polymorphic site contains G allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 41bp (this fragment downstream sequence forms sticky end because enzyme is cut and reduces by 2 bases than upstream sequence) sequence (SEQIDNO:11):

tactaggcagtggggtcgggatacacaggcagggaggcagt41

To take pictures under ultraviolet lamp after digestion products electrophoresis qualification, after the amplification of rs2289487 site, occur 150bp segment.Cut rear electrophoresis through Cviqi enzyme and there will be 150bp, 109bp and 41bp tri-kinds of segments (wherein 41bp not easily differentiates in electrophorogram).

Cut rear electrophoresis through Cviqi enzyme and carry out genotype judgement: AA type is 150bp fragment, and AG type has 150bp and 109bp two kinds of fragments, GG type is 109bp fragment.

Polymorphic result: detect 96 routine personnel altogether, detected result finds that GG type 40 example, AG type 19 example and AA type 37 example appear in rs2289487 site.

Embodiment 3 human peripheral blood clot measures rs2289487 polymorphism

Blood clot genomic dna is extracted with reference to phenol-chloroform extraction process in " molecule clone technology ".

It is SEQNO:12 that PCR reacts the upstream primer adopted, and downstream primer is SEQNO:13.

Upstream primer: 5'ACGTGATGGAGGAGAGTCTGGAAGCT3'(SEQIDNO:12);

Downstream primer: 5'TACTGCCTCCCTGCCTGTGTATCCCGACCCCACTGCCTAG ta3'(SEQIDNO:13)

Pcr amplification is except annealing temperature is 59 DEG C, and remaining reaction condition is with embodiment 1; Enzyme cuts qualification with embodiment 1.

Result:

Sequence (it is positioned at 392 ~ 543 places of SEQIDNO:1 base sequence, altogether 152bp) after amplification, the amplified production sequence obtained following (SEQIDNO:14):

In amplification after product sequence underscore part be upstream, sequence corresponding to downstream primer, R represents the polymorphic i.e. SNP site rs2289487 of A/G.

Enzyme cut after Product Sequence respectively as follows:

When this polymorphic site contains G allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 110bp (this fragment downstream sequence forms sticky end because enzyme is cut and increases by 2 bases than upstream sequence) sequence (SEQIDNO:15):

When this polymorphic site contains G allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 42bp (this fragment downstream sequence forms sticky end because enzyme is cut and reduces by 2 bases than upstream sequence) sequence (SEQIDNO:16):

tactaggcagtggggtcgggatacacaggcagggaggcagta42

To take pictures under ultraviolet lamp after digestion products electrophoresis qualification, after the amplification of rs2289487 site, occur 152bp segment.Cut rear electrophoresis through Cviqi enzyme and there will be 152bp, 110bp and 42bp tri-kinds of segments (wherein 42bp not easily differentiates in electrophorogram).

Cut rear electrophoresis through Cviqi enzyme and carry out genotype judgement: AA type is 152bp fragment, and AG type has 152bp and 110bp two kinds of fragments, GG type is 110bp fragment.

Polymorphic result: detect 80 routine personnel altogether, detected result finds that GG type 33 example, AG type 16 example and AA type 31 example appear in rs2289487 site.

Embodiment 4 human oral mucosa cells measures rs2289487 polymorphism

Main agents is except restriction endonuclease is RsaI, and all the other are with embodiment 1; Instrument is with embodiment 1.Adopt minim DNA to extract test kit and extracting genome DNA is carried out to Oral Mucosal Cells.

It is SEQNO:17 that PCR reacts the upstream primer adopted, and downstream primer is SEQNO:18.

Upstream primer: 5'GACGTGATGGAGGAGAGTCTGGAAGCTTCA3'(SEQIDNO:17);

Downstream primer: 5'TGCCTCCCTGCCTGTGTATCCCGACCCCACTGCCTAG ta3'(SEQIDNO:18)

Pcr amplification is except annealing temperature is 61 DEG C, and remaining reaction condition is with embodiment 1; Enzyme cuts qualification except restriction endonuclease adopts RsaI enzyme, and all the other conditions are with embodiment 1.

Result:

Sequence (it is positioned at 391 ~ 540 places of SEQIDNO:1 base sequence, altogether 150bp) after amplification, the amplified production sequence obtained following (SEQIDNO:19):

The lower stroke of sequence be partly respectively corresponding to upstream, downstream primer in amplification after product sequence, R represents the polymorphic i.e. SNP site rs2289487 of A/G.

Enzyme cut after Product Sequence respectively as follows:

When this polymorphic site contains G allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 112bp sequence (SEQIDNO:20):

When this polymorphic site contains G allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 38bp sequence (SEQIDNO:21):

actaggcagtggggtcgggatacacaggcagggaggca38

To take pictures under ultraviolet lamp after digestion products electrophoresis qualification, after the amplification of rs2289487 site, occur 150bp segment.Cut rear electrophoresis through RsaI enzyme and there will be 150bp, 112bp and 38bp tri-kinds of segments (wherein 38bp not easily differentiates in electrophorogram).

Cut rear electrophoresis through RsaI enzyme and carry out genotype judgement: AA type is 150bp fragment, and AG type has 150bp and 112bp two kinds of fragments, GG type is 112bp fragment.

Polymorphic result: detect 122 routine personnel altogether, detected result finds that GG type 44 example, AG type 38 example and AA type 40 example appear in rs2289487 site.

Claims (9)

1. measure a method for people PLIN1 gene rs2289487 loci polymorphism, comprising:

Human gene group DNA to be measured is provided;

There is provided upstream primer and the downstream primer of amplification people PLIN1 gene rs2289487 location proximate sequence, wherein downstream primer has base mismatch T;

With described human gene group DNA to be measured for template, utilize upstream primer and downstream primer to carry out pcr amplification reaction to obtain containing the amplified production of RTAC fragment, wherein R is base A undetermined on people PLIN1 gene rs2289487 site or G;

Restriction enzyme is provided;

Utilize restriction enzyme to carry out enzyme to gained amplified production to cut to obtain corresponding digestion products;

And determine that the base R undetermined on people PLIN1 gene rs2289487 site is A or G according to gained digestion products,

Wherein, restriction enzyme is the restriction enzyme that only can cut one of GTAC fragment and ATAC fragment.

2. method according to claim 1, wherein on gained amplified production, a base A of being separated by between the pairing base of base mismatch T and the R of downstream primer.

3. method according to claim 2, wherein on gained amplified production, the pairing base of downstream primer terminal bases and R is adjacent.

4. method according to claim 1, wherein restriction enzyme is CviQI or its isoschizomers, RsaI or its isoschizomers that only can cut GTAC fragment.

5. method according to claim 1, wherein gained digestion products comprises three kinds of clip types: have total fragment length do not cut off amplified production, cut off after have compared with the amplified production of long segment and after cutting off, there is amplified production compared with short-movie section, by judging that the clip types that digestion products comprises determines that the base undetermined on people PLIN1 gene locus rs2289487 is A or G.

6. method according to claim 5, wherein judge clip types that digestion products comprises taken pictures by gel electrophoresis associating ultraviolet lamp after with reference to scheming to contrast to carry out.

7. method according to claim 6, wherein reference figure is that amplified production obtains and only has first with reference to picture position and second with reference to picture position after the gel electrophoresis standard setting time after ultraviolet lamp is taken pictures, wherein first with reference to picture position for be the amplified production of the total fragment length do not cut off, second with reference to picture position then for be cut off after there is amplified production compared with long segment.

8. method according to claim 1, wherein make total fragment length of amplified production between 100 to 300bp by designing the length of upstream primer and downstream primer, and the fragment length of downstream primer is at least 35bp, makes enzyme fall Partial Fragment earnestly and account for the per-cent of the length of total fragment more than 20%.

9., for measuring a test kit for people PLIN1 gene rs2289487 loci polymorphism, it comprises:

For upstream primer and the downstream primer of pcr amplification people PLIN1 gene rs2289487 location proximate sequence, wherein downstream primer has base mismatch T to obtain containing the amplified production of RTAC fragment, and wherein R is base A undetermined on people PLIN1 gene rs2289487 site or G; And

Only can identify the restriction enzyme of one of GTAC fragment and ATAC fragment.