CN105256006A - Method and kit used for determining human TERF1 gene rs201882345 site polymorphism - Google Patents

Abstract

The invention discloses a method and a kit used for determining human TERF1 gene rs201882345 site polymorphism. The method comprises following steps: human genome DNA to be determined is provided; upstream primers and downstream primers used for amplification of sequences near human TERF1 gene rs201882345 site are provided, wherein the upstream primers possess mismatched base G; the human genome DNA to be determined is taken as a template, and the upstream primers and the downstream primers are used for PCR amplification so as to obtain amplification products containing GATTM segments, wherein M is used for representing base A or C to be determined on human TERF1 gene rs201882345 site; a restriction enzyme is provided; the restriction enzyme is used for enzyme digestion of the amplification products so as to obtain corresponding enzyme-digested products; and it is determined that M is used for representing base A or C based on the enzyme-digested products. The restriction enzyme is a restriction enzyme only used for realizing restriction digestion of one segment of GATTA or GATTC. The method is rapid and reliable, and determination cost is reduced greatly.

Description

Measure method and the test kit of people TERF1 gene rs201882345 loci polymorphism

Technical field

The present invention relates to the method measuring single nucleotide polymorphism.

Background technology

SNP (single nucleotide polymorphism) refers to and comprises the forms such as the displacement of single base, insertion and disappearance by the mutant dna sequence that the change of single core thuja acid causes.Gene pleiomorphism is individual inherent hereditary feature, does not change with environment, neither the special or non-specific clinical manifestation of certain disease, and therefore its application does not exist Diagnosis and Treat effect.

Genetic polymorphism detection is widely used in genetic arts and medical field, is exemplified below: 1. study the genetics such as the origin of species and evolution phenomenon.According to genovariation situation, obtain the information of biomacromolecule, infer organic evolution history, illustrate spore relation.Be applied in archeology to determine the sibship of ancient human's heritable variation feature and different population.2. research polymorphic with population genetics etc. genetics research.Polymorphic also closely related with various characteristics of human body, comprise height, body weight, the colour of skin, Facial Features etc.3. may be used for prophylaxis in preventive medicine field.By the tolerance of researching human body to poisonous substance, find to be easy to, to the individuality of certain poisonous substance generation toxic action, avoid this individuality and toxicant exposure in time, protect this Susceptible population.Such as, carry out polymorphic detection to the crowd preparing to be engaged in the organic solvents such as Contact benzene, examination goes out easily to occur the individuality that hematotoxicity, neurotoxicity etc. are reacted, and makes it away from organic solvents such as benzene, protects this type of Susceptible population to encroach on from poisonous substance.4. may be used for medicament selection in pharmacology and dosage is determined.Can judge that diseased individuals is responsive to certain poisonous side effect of medicine by polymorphic detection, thus avoid using this kind of medicine to exempt its toxic action.By judging the individual level of response determination drug dose to effect of drugs, reduce drug dose and side effect thereof.

Telomere genes involved plays an important role in the integrity of protection telomere structure.Telomeric repeat binding factor 1 (telomericrepeatbindingfactor1, TERF1) primary responsibility regulates the length of telomere, is the cis acting negative regulatory factor of Telomerase, controls the extension of telomere.TERF1 gene rs201882345 site is polymorphic, there are two kinds of allelotrope A and C in crowd, form the genotype of three kinds of TERF1 genes: AA type (two allelotrope bases of human genome rs201882345 polymorphic site are A), AC type (two allelotrope bases of human genome rs201882345 polymorphic site are respectively A and C) and CC type (two allelotrope bases of human genome rs201882345 polymorphic site are C).

Polymerase chain reaction-restriction fragment length polymorphic (PCR-RFLP) technology is a kind of quick, easy, accurate, low cost mensuration SNP (single nucleotide polymorphism) genotypic classical way.The method carries out amplified reaction by primer to template, forms sufficient amount and stable amplified production, by cutting and detect the fragment length of digestion products to the enzyme of amplified production, finally determines SNP.TERF1 gene rs201882345 polymorphic site takes PCR-RFLP technology to detect, and required restriction endonuclease is ApoI restriction endonuclease, and its price costly, needs to develop new detection technique.

Summary of the invention

The object of this invention is to provide the reliable means of the mensuration people TERF1 gene rs201882345 loci polymorphism of the diagnosis of a kind of non-diseases or therapeutic purpose.

According to a first aspect of the invention, provide a kind of method measuring people TERF1 gene rs201882345 loci polymorphism, comprising:

Human gene group DNA to be measured is provided;

There is provided upstream primer and the downstream primer of amplification people TERF1 gene rs201882345 location proximate sequence, wherein upstream primer has base mismatch G;

With described human gene group DNA to be measured for template, utilize upstream primer and downstream primer to carry out pcr amplification reaction to obtain containing the amplified production of GATTM fragment, wherein M is base A undetermined on people TERF1 gene rs201882345 site or C;

Restriction enzyme is provided;

Utilize restriction enzyme to carry out enzyme to gained amplified production and cut (reaction) to obtain corresponding digestion products; And

Determine that the base M undetermined on people TERF1 gene rs201882345 site is A or C according to gained digestion products,

Wherein, restriction enzyme is the restriction enzyme that only can cut one of GATTA fragment and GATTC fragment.

According to embodiments of the invention, on gained amplified production, three base ATT of being separated by between base mismatch G and the M of upstream primer.Surprisingly, so arrange base mismatch endonuclease reaction will be made to carry out extremely smooth, there will not be enzyme to cut the phenomenons such as insufficient.Further, so arrange upstream primer base mismatch and PCR reaction is well on, improve sensitivity and the specific degree of PCR, this may be relevant with making the secondary structural change of extension increasing sequence after base mismatch.

In an alternate embodiment of the present invention where, on gained amplified production, upstream primer terminal bases is adjacent with polymorphic site M.

In a preferred embodiment of the invention, on gained amplified production, upstream primer terminal bases is not adjacent with polymorphic site M.Such as, upstream primer end can be ... GAT ... the structures such as GA.Be difficult to the imagination, the upstream primer with this design can promote endonuclease reaction unexpectedly further greatly, and this may have certain to associate with amplification bonding force.

In a preferred embodiment of the invention, restriction enzyme can adopt the HinfI or its isoschizomers that only can cut GATTC fragment.This kind of HinfI enzyme is cheap, greatly can reduce cost of determination.

According to embodiments of the invention, gained digestion products comprises three kinds of clip types: have total fragment length do not cut off amplified production, cut off after have compared with the amplified production of long segment and after cutting off, there is amplified production (usually can not effectively observe) compared with short-movie section.The clip types comprised by observation (judgement) digestion products determines that the base undetermined on people TERF1 gene rs201882345 site is A or C.Such as, when adopting HinfI enzyme, judge compared with the observations of these two fragments of long segment according to total fragment with after cutting off: if observe digestion products only have a kind of there is total fragment length do not cut off amplified production, then base undetermined is A; If observe digestion products to only have a kind of cut-out product (being less than total fragment length) had compared with long segment, then base undetermined is C; If observe said two devices, then base undetermined not only comprises A but also comprise C.

In one embodiment of the invention, the clip types that judgement (or observation) digestion products comprises is schemed to contrast to carry out with reference after being taken pictures by gel electrophoresis associating ultraviolet lamp.In this case, preferably reference figure is that amplified production obtains and only has first with reference to picture position and second with reference to picture position after the gel electrophoresis standard setting time after ultraviolet lamp is taken pictures, wherein first with reference to picture position for be the amplified production of the total fragment length do not cut off, second with reference to picture position then for be cut off after there is amplified production compared with long segment.Such as, the present invention adopt with reference to figure be by 189bp and 136bp synthesized two base fragments simultaneously after gel electrophoresis same time ultraviolet lamp take pictures and form.Compared with the compound reference figure of conventional DNAladder, owing to have employed, only there are two specific reference figure with reference to picture position, this method of the present invention intuitively can be observed rapidly or judge the clip types that digestion products comprises, and avoids erroneous judgement to greatest extent simultaneously.Preferably carry out electrophoresis by after concentrated for digestion products 1 ~ 2 times of concentration after endonuclease reaction, increase brightness of image, improve judgment accuracy.

In a preferred embodiment of the invention, make total fragment length of amplified production between 100bp to 300bp by designing the length of upstream primer and downstream primer, and the fragment length of upstream primer is at least 35bp, preferred length 40 ~ 60bp (amplified reaction especially smoothly fully between this dominant area), makes enzyme fall Partial Fragment length earnestly and accounts for the per-cent of total fragment length more than 20%.This design of the present invention has the electrophoresis ultraviolet photo of the amplified production compared with long segment position after can making to have not cutting off amplified production and cutting off of total fragment length is distinguished significantly.But if total fragment is long, then electrophoretic mobility shift is by not obvious; Too short, fuzzy a slice that image can become, cannot accurately distinguish.The fragment length scope of upstream primer ensure that pcr amplification reaction can carry out smoothly, the amplification that there will be when avoiding base mismatch not foot phenomenon.

In a preferred embodiment of the invention, by controlling the scope of annealing temperature in pcr amplification program between 55 ~ 70 DEG C, preferable temperature 60 ~ 69 DEG C (this temperature can improve the specificity of amplified reaction), make the PCR primer purity of design higher.This design of the present invention can make pcr amplification product band clear, occurs without assorted band, is easy to electrophoresis and cuts.But if temperature is too low, then few the and assorted band of specific band is too much, is difficult to after electrophoresis distinguish and judges; If temperature is too high, then affects pcr amplification efficiency and make specific amplified production very few, affect observing effect.

In a preferred embodiment of the invention, by controlling to extend the scope of time between 10 ~ 60s in pcr amplification program, preferred time 15 ~ 30s (this time can improve the efficiency of amplified reaction and the specificity of amplified production), make the PCR reaction times of design shorter, amplified production purity is higher.This design of the present invention can make pcr amplification product band clear, occurs without assorted band, be easy to electrophoresis and cut, and the PCR time is shorter.But if the time is too short, then specific band can not increase completely and make amplified production less, be difficult to after electrophoresis distinguish judgement; If overlong time, then increase the occurrence probability of non-specific band, occur that assorted band affects observing effect.

In the present invention, PCR reacted constituent can comprise DNA profiling, upstream and downstream primer, TaqDNApolymerase (archaeal dna polymerase or also can be called " Taq enzyme "), damping fluid, Mg ²⁺deng.In a preferred embodiment of the invention, TaqDNApolymerase (archaeal dna polymerase) and TaqAntibody thereof can be used in pcr amplification reaction.TaqAntibody is the monoclonal antibody of TaqDNApolymerase, it suppresses DNA polymerase activity after being combined with TaqDNApolymerase, both avidity is very high, even if the activity of TaqDNApolymerase still can be closed at 65 DEG C, the non-specific amplification that therefore can effectively suppress the non-specific annealing of primer and primer dimer to cause, has high amplification sensitivity and specificity.TaqAntibody only needs to get final product complete deactivation at 95 DEG C of heating 30s, and release TaqDNApolymerase is active, ensure that subsequent PCR amplification reaction can be carried out smoothly.

The Tris-HCL damping fluid that pH value is 8.1 ~ 8.7 can be added in PCR reaction, adjust PCR solution ph when 72 DEG C of extensions between 6.8 ~ 7.8, thus make Taq enzyme play activity better in slight alkali environment.In addition, gelatin (0.01%) can also be added in PCR solution to reduce the adsorption of PCR pipe to Taq enzyme, stabilized enzyme activity and provide protection, promote PCR reaction.

In addition, Mg in PCR solution ²⁺when concentration is between 1.5 ~ 2.0mmol/L, can well control PCR react productive rate and specificity.

The final concentration that PCR reacts primer is generally about 0.1 ~ 1 μM, and the too high meeting of concentration causes non-specific amplification, and too low then amplified production very little.

In addition, can also add solubility promoter methyl-sulphoxide (DMSO) and ammonium sulfate to reduce base mispairing level in PCR reaction, the amplification efficiency of GC template is rich in raising.This with the secondary structure eliminating primer and template, may reduce DNA melting temperature(Tm) and makes DNA sex change completely relevant.

According to a further aspect in the invention, provide a kind of test kit for measuring people TERF1 gene rs201882345 loci polymorphism, it comprises:

For upstream primer and the downstream primer of pcr amplification people TERF1 gene rs201882345 location proximate sequence, wherein upstream primer has base mismatch G to obtain containing the amplified production of GATTM fragment, and wherein M is base A undetermined on people TERF1 gene rs201882345 site or C; And

Only can cut the restriction enzyme of one of GATTA fragment and GATTC fragment.

Can also comprise other composition in mentioned reagent box, such as PCR reacts Mix and (comprises 4 kinds of dNTP mixtures, Mg ²⁺, TaqDNApolymerase, TaqAntibody, damping fluid, DMSO and ammonium sulfate) and for implement measure specification sheets etc.

It will be understood by those skilled in the art that unless there are obvious conflict, the correlated characteristic of a first aspect of the present invention and second aspect can combine mutually.

Mensuration means of the present invention are not only fast and reliable, and cost of determination reduces greatly.

Accompanying drawing explanation

Fig. 1 describes the digestion products electrophoresis ultraviolet photo that method according to the present invention obtains.Wherein Marker is: standard reference position; Swimming lane 1:AA genotype; Swimming lane 2:AC genotype; Swimming lane 3:CC genotype.

Embodiment

Describe the present invention below.It will be appreciated by those skilled in the art that following detailed description only for illustration of and non-limiting the present invention.

(1) acquisition of DNA to be measured

Gather different crowd peripheral blood, after extracting genomic dna, carry out the mensuration of TERF1 gene rs201882345 loci polymorphism below.

For the selection of DNA to be measured, the not special restriction of the present invention.Both can be obtain in vitro sample from the body fluid of human body or tissue, the genome of degradation treatment in advance can also be through.For convenience of implementation, usually preferably in vitro sample is extracted from blood.Wherein said tissue comprises the tissue containing all or at least TERF1 gene in human body, and with whether express this TERF1 gene and have nothing to do.The method extracting DNA from body fluid and/or tissue well known to a person skilled in the art, and can with reference to conventional molecular biology manual, and such as " molecular cloning " the 2nd edition carries out.

(2) design of primers and synthesis

Search Gene database and the snp database of NCBI website, obtain TERF1 gene complete sequence and rs201882345 polymorphic site information respectively.

Rs201882345 polymorphic site m front and rear part base sequence (base sequence represents with 5' → 3', capital and small letter same meaning) following (SEQIDNO:1):

Carry out upstream primer and downstream primer design according to gene order, wherein, upstream primer introduces base mismatch.On final gained amplified production, three base ATT of being separated by between base mismatch G and the M of upstream primer.

In the present invention, upstream primer has base mismatch G, and length is 35 ~ 60bp.In one of them embodiment, primer is as follows,

Upstream primer: 5'TGGCAACTTTAAAGAAGCAGAAGAAGTCTTTGAAAGAATATTTGGTGATCCA gaTT3'(SEQIDNO:2),

Downstream primer: 5'TTGCACGGTATTATTCTATACTGTTT3'(SEQIDNO:3), wherein upstream primer underscore base is base mismatch.

(3) pcr amplification product is prepared

Formulate pcr amplification program and condition according to upstream primer and downstream primer feature and PCR corresponding reagent, prepare pcr amplification product.In one of them embodiment, get genomic dna (50 ~ 80ng), upstream and downstream primer (final concentration is 0.1 ~ 1 μM), 2 × PCRMix7.5 μ L (comprise 4 kinds of dNTP mixtures, Mg ²⁺, TaqDNApolymerase, TaqAntibody, damping fluid, DMSO and ammonium sulfate) and distilled water jointly form 15 μ L reaction systems, adjustment pH value of solution be about 7.3.PCR reaction conditions is: 95 DEG C of denaturation 30s, and DEG C annealing 30s → 72 DEG C, 95 DEG C of sex change 30s → 63 extend 20s totally 30 circulations, and 72 DEG C extend 7min.Stable amplified production is obtained after PCR reaction.

(4) endonuclease reaction

The present invention can adopt HinfI and TfiI restriction endonuclease, and the polymorphic qualification for TERF1 gene rs201882345 site provides the restriction endonuclease that plurality of optional is selected, and can select suitable restriction endonuclease during experiment according to market value.Current part restriction endonuclease less expensive, as shown in table 1.

Table several endonuclease recognition sequence of 1NEB company and price thereof

In one of them embodiment, get PCR primer 10 μ L, add 5U restriction endonuclease HinfI, 2 μ L10 × enzyme cutting buffering liquids and 7.5 μ L distilled waters and form 20 μ L reaction systems, in 37 DEG C of water-baths, enzyme cuts 4 ~ 12h, obtain digestion products, digestion products is observed through 1 times of concentrated rear electrophoresis.

(5) electrophoresis test

In one of them embodiment, if PCR primer can not be cut after HinfI enzyme is cut, be still 189bp, if be cut open, occur that (cut generation sticky end due to HinfI enzyme makes its complementary strand bases number different to 136bp with 53bp, therefore after cutting, fragment length is as the criterion with strand base number in gene order and calculates), be wherein difficult in 53bp fragment electrophoretic figure differentiate.

By digestion products in 2 ~ 4% sepharoses under 3 ~ 8V/cm condition, electrophoresis 30-80min, mensuration of taking pictures under ultraviolet lamp.Restriction enzyme digestion and electrophoresis figure is shown in Fig. 1, and the presence or absence according to 189bp and 136bp fragment judges genotype: AA type is 189bp fragment, and AC type has 189bp, 136bp fragment, and CC type is 136bp fragment.

Here implements some embodiments of the present invention.

Embodiment 1 is extracted human peripheral leucocytes DNA and is measured rs201882345 polymorphism

1 materials and methods

1.1 main agents and instrument

Reagent: 2 × PCRMix (comprises 4 kinds of dNTP mixtures, Mg ²⁺, TaqDNApolymerase, TaqAntibody, damping fluid, DMSO and ammonium sulfate), restriction enzyme HinfI (NEB company), agarose (Biowest company), primer is synthesized by Shanghai Sangon company.

Instrument: 9600 type PCR instrument (PE company), miniature electrophoresis chamber (PharmaciaBiotech, EPS1000), GelDoc2000 gel imaging instrument (Bio-RAD company).

1.2 extract DNA as testing gene group DNA profiling from peripheral blood leucocyte

EDTA-K ₂anticoagulant tube gathers human peripheral 1mL, white corpuscle separation is carried out with reference to leukocytic separation method in " practical flow cytometry icones ", white corpuscle genomic dna is extracted with reference to NaCl salting-out method in " molecular cloning ", and as human gene group DNA's template to be measured.

1.3 sequences are searched and design of primers

TERF1 gene order and rs201882345 polymorphic site information is searched to design primer in NCBI website, specific as follows:

Upstream primer: 5'TGGCAACTTTAAAGAAGCAGAAGAAGTCTTTGAAAGAATATTTGGTGATCCA gaTT3'(SEQIDNO:2);

Downstream primer: 5'TTGCACGGTATTATTCTATACTGTTT3'(SEQIDNO:3)

1.4PCR amplification

Get genomic dna (50 ~ 80ng), upstream and downstream primer (final concentration is 0.1 ~ 1 μM), 2 × PCRMix7.5 μ L (comprise 4 kinds of dNTP mixtures, Mg ²⁺, TaqDNApolymerase, TaqAntibody, damping fluid, DMSO and ammonium sulfate), sterilizing distilled water supplies 15 μ L reaction systems, adjustment pH value of solution be about 7.3.

PCR reaction conditions is: 95 DEG C of denaturation 30s, and DEG C annealing 30s → 72 DEG C, 95 DEG C of sex change 30s → 63 extend 20s totally 30 circulations, and 72 DEG C extend 7min.Stable amplified production is obtained after PCR reaction.

1.5 enzymes cut qualification

Get PCR primer 10 μ L, add 5U restriction endonuclease HinfI, 2 μ L10 × enzyme cutting buffering liquids and sterilizing distilled water and form 20 μ L reaction systems, after enzyme cuts 4h in 37 DEG C of water-baths, obtain digestion products.

After above-mentioned digestion products is concentrated through 1 times under 3% sepharose 5V/cm condition, electrophoresis 45min, qualification Polymorphic type of taking pictures under ultraviolet lamp.

2 results

2.1PCR amplification

Sequence (being positioned at the 145-333 place of SEQIDNO:1 base sequence, altogether 189bp) after amplification, the amplified production sequence obtained following (SEQIDNO:4):

In amplification after product sequence, underscore part is respectively the sequence corresponding to upstream, downstream primer, and m represents the polymorphic i.e. SNP site rs201882345 of A/C.

2.2 enzymes cut result

Product Sequence after restriction endonuclease HinfI enzyme is cut is as follows respectively:

When this polymorphic site contains C allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 136bp (this fragment downstream sequence forms sticky end because enzyme is cut and reduces by 3 bases than upstream sequence) sequence (SEQIDNO:5):

When this polymorphic site contains C allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 53bp (this fragment downstream sequence forms sticky end because enzyme is cut and increases by 3 bases than upstream sequence) sequence (SEQIDNO:6):

tggcaactttaaagaagcagaagaagtctttgaaagaatatttggtgatccag53

Take pictures under ultraviolet lamp after digestion products electrophoresis qualification, result is shown in Figure 1.Wherein, there is 189bp segment after the amplification of rs201882345 site.Cut rear electrophoresis through HinfI enzyme and there will be 189bp, 136bp and 53bp tri-kinds of fragments (wherein 53bp not easily differentiates in electrophorogram).

Enzyme is cut rear electrophoresis and is carried out genotype judgement: as shown in Figure 1, and AA type is 189bp fragment, and AC type has 189bp and 136bp two kinds of fragments, and CC type is 136bp fragment.

The polymorphic result in 2.3TERF1 gene rs201882345 site

Detect 65 routine personnel altogether, detected result finds that AA type 8 example, AC type 12 example and CC type 45 example appear in rs201882345 site.

It is polymorphic that embodiment 2 human peripheral whole blood sample measures TERF1 gene rs201882345:

Main agents and instrument are with embodiment 1.Peripheral blood genomic dna is extracted with reference to phenol-chloroform extraction process in " molecule clone technology ", and as human gene group DNA's template to be measured.

Sequence searches same embodiment 1, and design primer sequence is as follows:

Upstream primer: 5'CTTTAAAGAAGCAGAAGAAGTCTTTGAAAGAATATTTGGTGATCCA gaT3'(SEQIDNO:7);

Downstream primer: 5'TCTGTTGCACGGTATTATTCTATACTGTTTAA3'(SEQIDNO:8).

Get genomic dna (50 ~ 80ng), upstream and downstream primer (final concentration is 0.1 ~ 1 μM), 2 × PCRMix10 μ L (comprise 4 kinds of dNTP mixtures, Mg ²⁺, TaqDNApolymerase, TaqAntibody, damping fluid, DMSO and ammonium sulfate), sterilizing distilled water supplies 20 μ L reaction systems, adjustment pH value of solution be about 7.3.

PCR reaction conditions is: 95 DEG C of denaturation 3min, and DEG C annealing 30s → 72 DEG C, 95 DEG C of sex change 30s → 58 extend 20s totally 30 circulations, and 72 DEG C extend 10min.

Enzyme cuts qualification with embodiment 1.

Result:

Sequence (being positioned at the 151-337 place of SEQIDNO:1 base sequence, altogether 187bp) after amplification, the amplified production sequence obtained following (SEQIDNO:9):

In amplification after product sequence, underscore part is respectively the sequence corresponding to upstream, downstream primer, and m represents the polymorphic i.e. SNP site rs201882345 of A/C.

Product Sequence after restriction endonuclease HinfI enzyme is cut is as follows respectively:

When this polymorphic site contains C allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 140bp (this fragment downstream sequence forms sticky end because enzyme is cut and reduces by 3 bases than upstream sequence) sequence (SEQIDNO:10):

When this polymorphic site contains C allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 47bp (this fragment downstream sequence forms sticky end because enzyme is cut and increases by 3 bases than upstream sequence) sequence (SEQIDNO:11):

ctttaaagaagcagaagaagtctttgaaagaatatttggtgatccag47

To take pictures under ultraviolet lamp after digestion products electrophoresis qualification, after the amplification of rs201882345 site, occur 187bp segment.Cut rear electrophoresis through HinfI enzyme and there will be 187bp, 140bp and 47bp tri-kinds of fragments (wherein 47bp not easily differentiates in electrophorogram).

Enzyme is cut rear electrophoresis and is carried out genotype judgement: AA type is 187bp fragment, and AC type has 187bp and 140bp two kinds of fragments, and CC type is 140bp fragment.

Polymorphic result, detects 56 routine personnel altogether, and detected result finds that AA type 9 example, AC type 12 example and CC type 35 example appear in rs201882345 site.

It is polymorphic that embodiment 3 human peripheral blood clot sample measures TERF1 gene rs201882345:

Main agents and instrument are with embodiment 1.Blood clot genomic dna is extracted with reference to phenol-chloroform extraction process in " molecule clone technology ".

It is SEQNO:12 that PCR reacts the upstream primer adopted, and downstream primer is SEQNO:13.

Upstream primer: 5'AAAATGGCAACTTTAAAGAAGCAGAAGAAGTCTTTGAAAGAATATTTGGTGATC CA ga3'(SEQIDNO:12);

Downstream primer: 5'GCACGGTATTATTCTATACTGTTT3'(SEQIDNO:13)

Pcr amplification is except annealing temperature is 65 DEG C, and remaining reaction condition is with embodiment 1; Endonuclease reaction condition is with embodiment 1.After digestion products is concentrated through 1 times under 2.5% sepharose 5V/cm condition, electrophoresis 35min, qualification of taking pictures under ultraviolet lamp.

Result:

Sequence (being positioned at the 141-331 place of SEQIDNO:1 base sequence, altogether 191bp) after amplification, the amplified production sequence obtained following (SEQIDNO:14):

In amplification after product sequence, underscore part is respectively the sequence corresponding to upstream, downstream primer, and m represents the polymorphic i.e. SNP site rs201882345 of A/C.

Enzyme cut after Product Sequence respectively as follows:

When this polymorphic site contains C allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 134bp (this fragment downstream sequence forms sticky end because enzyme is cut and reduces by 3 bases than upstream sequence) sequence (SEQIDNO:15):

When this polymorphic site contains C allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 57bp (this fragment downstream sequence forms sticky end because enzyme is cut and increases by 3 bases than upstream sequence) sequence (SEQIDNO:16):

aaaatggcaactttaaagaagcagaagaagtctttgaaagaatatttggtgatccag57

To take pictures under ultraviolet lamp after digestion products electrophoresis qualification, after the amplification of rs201882345 site, occur 191bp segment, cut rear electrophoresis through HinfI enzyme and there will be 191bp, 134bp, 57bp tri-kinds of segments (wherein 57bp not easily differentiates in electrophorogram).

Enzyme is cut rear genotype and is judged: AA type is 191bp fragment, and AC type has 191bp and 134bp two kinds of fragments, and CC type is 134bp fragment.

Polymorphic result, detects 48 routine personnel altogether, and detected result finds that AA type 8 example, AC type 11 example and CC type 29 example appear in rs201882345 site.

It is polymorphic that embodiment 4 human oral mucosa cells measures TERF1 gene rs201882345

Main agents and instrument are with embodiment 1, and restriction endonuclease is TfiI.Oral Mucosal Cells genomic dna is extracted with reference to phenol-chloroform extraction process in " molecule clone technology ".

It is SEQNO:17 that PCR reacts the upstream primer adopted, and downstream primer is SEQNO:18.

Upstream primer: 5'AATGGCAACTTTAAAGAAGCAGAAGAAGTCTTTGAAAGAATATTTGGTGATCCA ga3'(SEQIDNO:17);

Downstream primer: 5'CATATGTGACTTGCGTAGTTTT3'(SEQIDNO:18)

Pcr amplification is except annealing temperature is 64 DEG C, and remaining reaction condition is with embodiment 1; Endonuclease reaction adopts TfiI enzyme and temperature of reaction to be except 65 DEG C except restriction endonuclease, and remaining reaction condition is with embodiment 1.After above-mentioned digestion products is concentrated through 1 times under 3.5% sepharose 5V/cm condition, electrophoresis 50min, qualification of taking pictures under ultraviolet lamp.

Result:

Sequence (being positioned at the 143-359 place of SEQIDNO:1 base sequence, altogether 217bp) after amplification, the amplified production sequence obtained following (SEQIDNO:19):

In amplification after product sequence, underscore part is respectively the sequence corresponding to upstream, downstream primer, and m represents the polymorphic i.e. SNP site rs201882345 of A/C.

Enzyme cut after Product Sequence respectively as follows:

When this polymorphic site contains C allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 162bp (this fragment downstream sequence forms sticky end because enzyme is cut and reduces by 3 bases than upstream sequence) sequence (SEQIDNO:20):

When this polymorphic site contains C allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 55bp (this fragment downstream sequence forms sticky end because enzyme is cut and increases by 3 bases than upstream sequence) sequence (SEQIDNO:21):

aatggcaactttaaagaagcagaagaagtctttgaaagaatatttggtgatccag55

To take pictures under ultraviolet lamp after digestion products electrophoresis qualification, after the amplification of rs201882345 site, occur 217bp segment.Cut rear electrophoresis through TfiI enzyme and there will be 217bp, 162bp and 55bp tri-kinds of segments (wherein 55bp not easily differentiates in electrophorogram).

Enzyme is cut rear genotype and is judged: AA type is 217bp fragment, and AC type has 217bp and 162bp two kinds of fragments, and CC type is 162bp fragment.

Polymorphic result, detects 72 routine personnel altogether, and detected result finds that AA type 11 example, AC type 19 example and CC type 42 example appear in rs201882345 site.

Claims (10)

1. measure a method for people TERF1 gene rs201882345 loci polymorphism, comprising:

Human gene group DNA to be measured is provided;

There is provided upstream primer and the downstream primer of amplification people TERF1 gene rs201882345 location proximate sequence, wherein upstream primer has base mismatch G;

With described human gene group DNA to be measured for template, utilize upstream primer and downstream primer to carry out pcr amplification reaction to obtain containing the amplified production of GATTM fragment, wherein M is base A undetermined on people TERF1 gene rs201882345 site or C;

Restriction enzyme is provided;

Utilize restriction enzyme to carry out enzyme to gained amplified production to cut to obtain corresponding digestion products; And

Determine that the base M undetermined on people TERF1 gene rs201882345 site is A or C according to gained digestion products,

Wherein, restriction enzyme is the restriction enzyme that only can cut one of GATTA fragment and GATTC fragment.

2. method according to claim 1, wherein on gained amplified production, three base ATT of being separated by between base mismatch G and the M of upstream primer.

3. method according to claim 2, wherein on gained amplified production, upstream primer terminal bases is adjacent with M.

4. method according to claim 2, wherein on gained amplified production, upstream primer terminal bases is not adjacent with M.

5. method according to claim 1, wherein restriction enzyme is HinfI, TfiI or its isoschizomers that only can cut GATTC fragment.

6. method according to claim 1, wherein gained digestion products comprises three kinds of clip types: have total fragment length do not cut off amplified production, cut off after have compared with the amplified production of long segment and after cutting off, there is amplified production compared with short-movie section, by judging that the clip types that digestion products comprises determines that the base M undetermined on people TERF1 gene rs201882345 site is A or C.

7. method according to claim 6, wherein judge clip types that digestion products comprises taken pictures by gel electrophoresis associating ultraviolet lamp after with reference to scheming to contrast to carry out.

8. method according to claim 7, wherein reference figure is that amplified production obtains and only has first with reference to picture position and second with reference to picture position after the gel electrophoresis standard setting time after ultraviolet lamp is taken pictures, wherein first with reference to picture position for be the amplified production of the total fragment length do not cut off, second with reference to picture position then for be cut off after there is amplified production compared with long segment.

9. method according to claim 1, wherein make total fragment length of amplified production between 100bp to 300bp by designing the length of upstream primer and downstream primer, and the fragment length of upstream primer is at least 35bp, makes enzyme fall Partial Fragment earnestly and account for the per-cent of the length of total fragment more than 20%.

10., for measuring a test kit for people TERF1 gene rs201882345 loci polymorphism, it comprises:

For upstream primer and the downstream primer of pcr amplification people TERF1 gene rs201882345 location proximate sequence, wherein upstream primer has base mismatch G to obtain containing the amplified production of GATTM fragment, and wherein M is base A undetermined on people TERF1 gene rs201882345 site or C; And

Only can cut the restriction enzyme of one of GATTA fragment and GATTC fragment.