CN105296612A - Method and kit for determining polymorphism of human TERT gene rs4975605 site - Google Patents
Method and kit for determining polymorphism of human TERT gene rs4975605 site Download PDFInfo
- Publication number
- CN105296612A CN105296612A CN201510618640.3A CN201510618640A CN105296612A CN 105296612 A CN105296612 A CN 105296612A CN 201510618640 A CN201510618640 A CN 201510618640A CN 105296612 A CN105296612 A CN 105296612A
- Authority
- CN
- China
- Prior art keywords
- amplified production
- fragment
- downstream primer
- site
- base
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method and a kit for determining polymorphism of a human TERT gene rs4975605 site. The method comprises the following steps: extracting to-be-determined human genome DNA; providing an upstream primer and a downstream primer of a nearby sequence for amplifying the human TERT gene rs4975605 site, wherein the downstream primer has a mismatched base A; implementing a PCR amplification reaction by virtue of the upstream primer and the downstream primer by taking the to-be-determined genome DNA as a template so as to obtain an amplification product containing a GMAAGCCTTC segment, wherein M is an undetermined base A or an undetermined base C on the human TERT gene rs4975605 site; providing a restriction enzyme; digesting the amplification product by virtue of the restriction enzyme so as to obtain a corresponding enzyme-digested product; and determining whether the undetermined base M on the human TERT gene rs4975605 site is A or C according to the enzyme-digested product. The restriction enzyme can only cut open either a GAAAGCCTTC segment or a GCAAGCCTTC segment. The determination means disclosed by the invention is not only rapid and reliable, but also capable of greatly reducing a determination cost.
Description
Technical field
The present invention relates to the method measuring single nucleotide polymorphism.
Background technology
SNP (single nucleotide polymorphism) refers to and comprises the forms such as the displacement of single base, insertion and disappearance by the mutant dna sequence that the change of single core thuja acid causes.Gene pleiomorphism is individual inherent hereditary feature, does not change with environment, neither the special or non-specific clinical manifestation of certain disease, and therefore its application does not exist Diagnosis and Treat effect.
Genetic polymorphism detection is widely used in genetic arts and medical field, is exemplified below: 1. study the genetics such as the origin of species and evolution phenomenon.According to genovariation situation, obtain the information of biomacromolecule, infer organic evolution history, illustrate spore relation.Be applied in archeology to determine the sibship of ancient human's heritable variation feature and different population.2. research polymorphic with population genetics etc. genetics research.Polymorphic also closely related with various characteristics of human body, comprise height, body weight, the colour of skin, Facial Features etc.3. may be used for prophylaxis in preventive medicine field.By the tolerance of researching human body to poisonous substance, find to be easy to, to the individuality of certain poisonous substance generation toxic action, avoid this individuality and toxicant exposure in time, protect this Susceptible population.Such as, carry out polymorphic detection to the crowd preparing to be engaged in the organic solvents such as Contact benzene, examination goes out easily to occur the individuality that hematotoxicity, neurotoxicity etc. are reacted, and makes it away from organic solvents such as benzene, protects this type of Susceptible population to encroach on from poisonous substance.4. may be used for medicament selection in pharmacology and dosage is determined.Can judge that diseased individuals is responsive to certain poisonous side effect of medicine by polymorphic detection, thus avoid using this kind of medicine to exempt its toxic action.By judging the individual level of response determination drug dose to effect of drugs, reduce drug dose and side effect thereof.
Telomerase (Telomerase) in most eukaryotes is a kind of reversed transcriptive enzyme, telomeric dna length can be extended specifically, thus regulate the division and proliferation of cell, Telomerase mainly comprises RNA component (TelomeraseRNAComponent, and reversed transcriptive enzyme component (TelomeraseReverseTranscriptase TERC), TERT), TERT is the speed limit composition of telomerase activation.TERT gene rs4975605 site is positioned at intron region, there are some researches show this polymorphic function that may affect TERT.
TERT gene rs4975605 site is polymorphic, there are two kinds of allelotrope A and C in crowd, form the genotype of three kinds of TERT genes: AA type (two allelotrope bases of human genome rs4975605 polymorphic site are A), AC type (two allelotrope bases of human genome rs4975605 polymorphic site are respectively A and C) and CC type (two allelotrope bases of human genome rs4975605 polymorphic site are C).
Polymerase chain reaction-restriction fragment length polymorphic (PCR-RFLP) technology is a kind of quick, easy, accurate, low cost mensuration SNP (single nucleotide polymorphism) genotypic classical way.The method carries out amplified reaction by primer to template, forms sufficient amount and stable amplified production, by cutting and detect the fragment length of digestion products to the enzyme of amplified production, finally determines SNP.TERT gene rs4975605 polymorphic site takes PCR-RFLP technology to detect, and required restriction endonuclease is Cac8I, and its price costly, therefore needs to develop new detection technique.
Summary of the invention
The object of this invention is to provide the reliable means of the mensuration people TERT gene rs4975605 loci polymorphism of the diagnosis of a kind of non-diseases or therapeutic purpose.
According to a first aspect of the invention, provide a kind of method measuring people TERT gene rs4975605 loci polymorphism, comprising:
Human gene group DNA to be measured is provided;
There is provided upstream primer and the downstream primer of amplification people TERT gene rs4975605 location proximate sequence, wherein downstream primer has base mismatch A;
With described human gene group DNA to be measured for template, utilize upstream primer and downstream primer to carry out pcr amplification reaction to obtain containing the amplified production of GMAAGCCTTC fragment, wherein M is base A undetermined on people TERT gene rs4975605 site and C;
Restriction enzyme is provided;
Utilize restriction enzyme to carry out enzyme to gained amplified production and cut (reaction) to obtain corresponding digestion products; And
Determine that the base M undetermined on people TERT gene rs4975605 site is A or C according to gained digestion products, wherein, restriction enzyme is the restriction enzyme that only can cut one of GAAAGCCTTC fragment and GCAAGCCTTC fragment.
According to embodiments of the invention, on gained amplified production, six base AGGCTT of being separated by between the base mismatch A of downstream primer and the complementary base of polymorphic site M.Surprisingly, so arrange base mismatch endonuclease reaction will be made to carry out extremely smooth, there will not be enzyme to cut the phenomenons such as insufficient.Further, so arrange upstream primer base mismatch and PCR reaction is well on, improve sensitivity and the specific degree of PCR, this may be relevant with making the secondary structural change of extension increasing sequence after base mismatch.
In an alternate embodiment of the present invention where, on gained amplified production, the complementary base of downstream primer terminal bases and polymorphic site M is adjacent.
In a preferred embodiment of the invention, on gained amplified production, downstream primer terminal bases is not adjacent with the complementary base of polymorphic site M.Such as, downstream primer end can be ... AAGGCT ... AAGGC ... AAGG ... AAG ... the structures such as AA.Be difficult to the imagination, the upstream primer with this design can promote endonuclease reaction unexpectedly further greatly, and this may have certain to associate with amplification bonding force.
In a preferred embodiment of the invention, restriction enzyme can adopt the XmnI or its isoschizomers that only can cut GAAAGCCTTC fragment.This kind of XmnI enzyme is cheap, greatly can reduce cost of determination.
According to embodiments of the invention, gained digestion products comprises three kinds of clip types: have total fragment length do not cut off amplified production, cut off after have compared with the amplified production of long segment and after cutting off, there is amplified production (comparatively short-movie section can not effectively observe usually) compared with short-movie section.The clip types comprised by observation (judgement) digestion products determines that the base undetermined on people TERT gene rs4975605 site is A or C.Such as, when adopting XmnI enzyme, judge compared with the observations of these two fragments of long segment according to total fragment with after cutting off: if observe digestion products only have a kind of there is total fragment length do not cut off amplified production, then base undetermined is C; Only have one to have the cut-out product of comparatively long segment (being less than total fragment length) if observe digestion products, then base undetermined is A; If observe said two devices, then base undetermined not only comprises A but also comprise C.
In one embodiment of the invention, the clip types that judgement (or observation) digestion products comprises is schemed to contrast to carry out with reference after being taken pictures by gel electrophoresis associating ultraviolet lamp.In this case, preferably reference figure is that amplified production obtains and only has first with reference to picture position and second with reference to picture position after the gel electrophoresis standard setting time after ultraviolet lamp is taken pictures, wherein first with reference to picture position for be the amplified production of the total fragment length do not cut off, second with reference to picture position then for be cut off after there is amplified production compared with long segment.Such as, the present invention adopt with reference to figure be by 205bp and 163bp synthesized two base fragments simultaneously after gel electrophoresis same time ultraviolet lamp take pictures and form.Compared with the compound reference figure of conventional DNAladder, owing to have employed, only there are two specific reference figure with reference to picture position, this method of the present invention intuitively can be observed rapidly or judge the clip types that digestion products comprises, and avoids erroneous judgement to greatest extent simultaneously.Preferably carry out electrophoresis by after concentrated for digestion products 1 ~ 2 times of concentration after endonuclease reaction, increase brightness of image, improve judgment accuracy.
In a preferred embodiment of the invention, make total fragment length of amplified production between 100 to 300bp by designing the length of upstream primer and downstream primer, and the fragment length of downstream primer is at least 35bp, preferred length 40 ~ 60bp (amplified reaction especially smoothly fully between this dominant area), makes enzyme fall Partial Fragment length earnestly and accounts for the per-cent of total fragment length more than 20%.This design of the present invention has the electrophoresis ultraviolet photo of the amplified production compared with long segment position after can making to have not cutting off amplified production and cutting off of total fragment length is distinguished significantly.But if total fragment is long, then electrophoretic mobility shift is by not obvious; Too short, image can thicken a slice, cannot accurately distinguish.The fragment length scope of downstream primer ensure that pcr amplification reaction can carry out smoothly, the amplification that there will be when avoiding base mismatch not foot phenomenon.
In a preferred embodiment of the invention, by controlling the scope of annealing temperature in pcr amplification program between 55 ~ 70 DEG C, preferable temperature 60 ~ 69 DEG C (this temperature can improve the specificity of amplified reaction), make the PCR primer purity of design higher.This design of the present invention can make pcr amplification product band clear, occurs, be easy to electrophoresis identification without assorted band.But if temperature is too low, then few the and assorted band of specific band is too much, is difficult to after electrophoresis distinguish and judges; If temperature is too high, then affects pcr amplification efficiency and make specific amplified production very few, affect observing effect.
In a preferred embodiment of the invention, by controlling to extend the scope of time between 10 ~ 60s in pcr amplification program, preferred time 15 ~ 30s (this time can improve the efficiency of amplified reaction and the specificity of amplified production), make the PCR reaction times of design shorter, amplified production purity is higher.This design of the present invention can make pcr amplification product band clear, occurs, be easy to electrophoresis identification, and the PCR time is shorter without assorted band.But if the time is too short, then specific band can not increase completely and make amplified production less, be difficult to after electrophoresis distinguish judgement; If overlong time, then increase the occurrence probability of non-specific band, occur that assorted band affects observing effect.
In the present invention, PCR reacted constituent can comprise DNA profiling, upstream and downstream primer, TaqDNApolymerase (archaeal dna polymerase or also can be called " Taq enzyme "), damping fluid, Mg
2+deng.In a preferred embodiment of the invention, TaqDNApolymerase and TaqAntibody can be used in pcr amplification reaction.TaqAntibody is the monoclonal antibody of TaqDNApolymerase, it suppresses DNA polymerase activity after being combined with TaqDNApolymerase, both avidity is very high, even if the activity of TaqDNApolymerase still can be closed at 65 DEG C, the non-specific amplification that therefore can effectively suppress the non-specific annealing of primer and primer dimer to cause, has high amplification sensitivity and specificity.TaqAntibody only needs to get final product complete deactivation at 95 DEG C of heating 30s, and release TaqDNApolymerase is active, ensure that subsequent PCR amplification reaction can be carried out smoothly.
The Tris-HCl damping fluid that pH value is 8.1 ~ 8.7 can be added in PCR reaction, adjust PCR solution ph when 72 DEG C of extensions between 6.8 ~ 7.8, thus make Taq enzyme play activity better in slight alkali environment.In addition, gelatin (0.01%) can also be added in PCR solution to reduce the adsorption of PCR pipe to Taq enzyme, stabilized enzyme activity and provide protection, promote PCR reaction.
In addition, Mg in PCR solution
2+when concentration is between 1.5 ~ 2.0mmol/L, can well control PCR react productive rate and specificity.
The final concentration that PCR reacts primer is generally about 0.1 ~ 1 μM, and the too high meeting of concentration causes non-specific amplification, and too low then amplified production very little.
In addition, can also add solubility promoter methyl-sulphoxide (DMSO) and ammonium sulfate to reduce base mispairing level in PCR reaction, the amplification efficiency of GC template is rich in raising.This with the secondary structure eliminating primer and template, may reduce DNA melting temperature(Tm) and makes DNA sex change completely relevant.
According to a further aspect in the invention, provide a kind of test kit for measuring people TERT gene rs4975605 loci polymorphism, it comprises:
For upstream primer and the downstream primer of pcr amplification people TERT gene rs4975605 location proximate sequence, wherein downstream primer has base mismatch A to obtain containing the amplified production of GMAAGCCTTC fragment, and wherein M is base A undetermined on people TERT gene rs4975605 site and C; And
Only can cut the restriction enzyme of one of GAAAGCCTTC fragment and GCAAGCCTTC fragment.
Can also comprise other composition in mentioned reagent box, such as PCR reacts Mix and (comprises 4 kinds of dNTP mixtures, Mg
2+, TaqDNApolymerase, TaqAntibody, damping fluid, DMSO and ammonium sulfate) and for implement measure specification sheets etc.
It will be understood by those skilled in the art that unless there are obvious conflict, the correlated characteristic of a first aspect of the present invention and second aspect can combine mutually.
Mensuration means of the present invention are not only fast and reliable, and cost of determination reduces greatly.
Accompanying drawing explanation
Fig. 1 describes the digestion products electrophoresis ultraviolet photo that method according to the present invention obtains.Wherein Marker is: standard reference position; Swimming lane 1:AC genotype; Swimming lane 2:AA genotype; Swimming lane 3:CC genotype.
Embodiment
Describe the present invention below.It will be appreciated by those skilled in the art that following detailed description only for illustration of and non-limiting the present invention.
(1) acquisition of DNA to be measured
Gather different crowd peripheral blood, after extracting genomic dna, carry out the mensuration of TERT gene rs4975605 loci polymorphism below.
For the selection of DNA to be measured, the not special restriction of the present invention.Both can be obtain in vitro sample from the body fluid of human body or tissue, the genome of degradation treatment in advance can also be through.For convenience of implementation, usually preferably in vitro sample is extracted from blood.Wherein said tissue comprises the tissue containing all or at least TERT gene in human body, and with whether express this TERT gene and have nothing to do.The method extracting DNA from body fluid and/or tissue well known to a person skilled in the art, and can with reference to conventional molecular biology manual, such as " practical flow cytometry icones ", " molecular cloning " the 2nd edition etc.
(2) design of primers and synthesis
Search Gene database and the snp database of NCBI website, obtain TERT gene complete sequence and rs4975605 polymorphic site information respectively.Rs4975605 polymorphic site m front and rear part base sequence (base sequence represents with 5' → 3', capital and small letter same meaning) following (SEQIDNO:1):
Upstream primer and the downstream primer of base mismatch is introduced according to above-mentioned sequences Design.On final gained amplified production, six base AGGCTT of being separated by between the base mismatch A of downstream primer and the complementary base of polymorphic site M.
In the present invention, downstream primer has base mismatch A, and length is 35 ~ 60bp.In one of them embodiment, primer is as follows:
Upstream primer: 5'ATTCCAGCTACTTGGGAGGCTGAGGCAAGAGAAT3'(SEQIDNO:2), downstream primer: 5'CTGGCTACGCTCCGTCCTTGGAATTCCCCTGCGAGTTG
aaGGCTT3'(SEQIDNO:3).Wherein downstream primer underscore base is base mismatch.
(3) pcr amplification product is prepared
Formulate pcr amplification program and condition according to upstream primer and downstream primer feature and PCR corresponding reagent, prepare pcr amplification product.In one of them embodiment, get genomic dna (50 ~ 80ng), upstream and downstream primer (final concentration is 0.1 ~ 1 μM), 2 × PCRMix7.5 μ L (comprise 4 kinds of dNTP mixtures, Mg
2+, TaqDNApolymerase, TaqAntibody, damping fluid, DMSO and ammonium sulfate) and distilled water jointly form 15 μ L reaction systems, adjustment pH value of solution be about 7.3.PCR reaction conditions is: 95 DEG C of denaturation 30s, and DEG C annealing 30s → 72 DEG C, 95 DEG C of sex change 30s → 65 extend 20s totally 30 circulations, and 72 DEG C extend 7min.Stable amplified production is obtained after PCR reaction.
(4) endonuclease reaction
The present invention adopts XmnI restriction endonuclease, and with base near polymorphic site without compared with restriction endonuclease Cac8I adoptable in mispairing situation, price is very cheap, as shown in table 1.
Table several endonuclease recognition sequence of 1NEB company and price thereof
Note: N is A or T or G or C.
In one of them embodiment, get PCR primer 10 μ L, add 5U restriction endonuclease XmnI, 2 μ L10 × enzyme cutting buffering liquids and 7.5 μ L distilled waters and form 20 μ L reaction systems, in 37 DEG C of water-baths, enzyme cuts 4 ~ 12h, obtain digestion products, digestion products is observed through 1 times of concentrated rear electrophoresis.
(5) electrophoresis test
In one of them embodiment, if PCR primer can not be cut after XmnI enzyme is cut, be still 205bp, if be cut open, occur 163bp and 42bp, be wherein difficult in 42bp fragment electrophoretic figure differentiate.
By digestion products in 2 ~ 4% sepharoses under 3 ~ 8V/cm condition, electrophoresis 30 ~ 80min, mensuration of taking pictures under ultraviolet lamp.Restriction enzyme digestion and electrophoresis figure is shown in Fig. 1, and the presence or absence according to 205bp and 163bp fragment judges genotype: AA type is 163bp fragment, and AC type has 205bp and 163bp two kinds of fragments, and CC type is 205bp fragment.
Here implements some embodiments of the present invention.
Embodiment 1 is extracted human peripheral leucocytes DNA and is measured rs4975605 polymorphism
1 materials and methods
1.1 main agents and instrument
Reagent: 2 × PCRMix (comprises 4 kinds of dNTP mixtures, Mg
2+, TaqDNApolymerase, TaqAntibody, damping fluid, DMSO and ammonium sulfate), restriction enzyme XmnI (NEB company), agarose (Biowest company), primer is synthesized by Shanghai Sangon company.
Instrument: 9600 type PCR instrument (PE company), miniature electrophoresis chamber (PharmaciaBiotech, EPS1000), GelDoc2000 gel imaging instrument (Bio-RAD company).
1.2 extract DNA as testing gene group DNA profiling from peripheral blood leucocyte
EDTA-K
2anticoagulant tube gathers human peripheral 1mL, white corpuscle separation is carried out with reference to leukocytic separation method in " practical flow cytometry icones ", white corpuscle genomic dna is extracted with reference to NaCl salting-out method in " molecular cloning ", and as human gene group DNA's template to be measured.1.3 sequences are searched and design of primers
TERT gene order and rs4975605 polymorphic site information is searched to design primer in NCBI website, specific as follows:
Upstream primer: 5'ATTCCAGCTACTTGGGAGGCTGAGGCAAGAGAAT3'(SEQIDNO:2),
Downstream primer: 5'CTGGCTACGCTCCGTCCTTGGAATTCCCCTGCGAGTTG
aaGGCTT3'(SEQIDNO:3).
1.4PCR amplification
Get genomic dna (50 ~ 80ng), upstream and downstream primer (final concentration is 0.1 ~ 1 μM), 2 × PCRMix7.5 μ L (comprise 4 kinds of dNTP mixtures, Mg
2+, TaqDNApolymerase, TaqAntibody, damping fluid, DMSO and ammonium sulfate), sterilizing distilled water supplies 15 μ L reaction systems, adjustment pH value of solution be about 7.3.
PCR reaction conditions is: 95 DEG C of denaturation 30s, and DEG C annealing 30s → 72 DEG C, 95 DEG C of sex change 30s → 65 extend 20s totally 30 circulations, and 72 DEG C extend 7min.Stable amplified production is obtained after PCR reaction.
1.5 enzymes cut qualification
Get PCR primer 10 μ L, add 5U restriction endonuclease XmnI, 2 μ L10 × enzyme cutting buffering liquids and 7.5 μ L distilled waters and form 20 μ L reaction systems, in 37 DEG C of water-baths, enzyme cuts 12h, obtains digestion products, and digestion products is observed through 1 times of concentrated rear electrophoresis.
Above-mentioned digestion products under 3% sepharose 5V/cm condition, electrophoresis 40min, qualification Polymorphic type of taking pictures under ultraviolet lamp.
2 results
2.1PCR amplification
Sequence (it is arranged in SEQIDNO:1 base sequence 342-546 place, altogether 205bp) after amplification, the amplified production sequence obtained following (SEQIDNO:4):
In amplification after product sequence, underscore part is respectively the sequence corresponding to upstream, downstream primer, and m represents the polymorphic i.e. SNP site rs4975605 of A/C.
2.2 enzymes cut result
Product Sequence after restriction endonuclease XmnI enzyme is cut is as follows respectively:
When this polymorphic site contains A allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 163bp sequence (SEQIDNO:5):
When this polymorphic site contains A allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 42bp sequence (SEQIDNO:6):
ccttcaactcgcaggggaattccaaggacggagcgtagccag42
Take pictures under ultraviolet lamp after digestion products electrophoresis qualification, result is shown in Figure 1.Wherein, after the amplification of rs4975605 site, there is 205bp segment (being as the criterion with upstream sequence, as follows), cut rear electrophoresis through XmnI enzyme and there will be 205bp, 163bp, 42bp tri-kinds of segments (wherein 42bp not easily differentiates in electrophorogram).
As shown in Figure 1, enzyme cuts the judgement of rear genotype: AA type is 163bp fragment, and AC type has 205bp and 163bp two kinds of fragments, and CC type is 205bp fragment.
The polymorphic result in 2.3TERT gene rs4975605 site
Detect 80 routine personnel altogether, detected result finds that AA type 2 example, AC type 18 example and CC type 60 example appear in rs4975605 site.
Embodiment 2 human peripheral whole blood sample measures TERT gene rs4975605 polymorphism
Main agents and instrument are with embodiment 1; Peripheral blood Whole Blood Genomic DNA is extracted with reference to phenol-chloroform extraction process in " molecule clone technology ", and as human gene group DNA's template to be measured.Sequence searches same embodiment 1, PCR, and to react the upstream primer adopted be SEQIDNO:7, and downstream primer is SEQIDNO:8.
Upstream primer: 5'AGGCTGAGGCAAGAGAATTGCTTGAACTCAG3'(SEQIDNO:7);
Downstream primer: 5'TGGCTACGCTCCGTCCTTGGAATTCCCCTGCGAGTTG
aaGGCT3'(SEQIDNO:8).
Get genomic dna (50 ~ 80ng), upstream and downstream primer (final concentration is 0.1 ~ 1 μM), 2 × PCRMix10 μ L (comprise 4 kinds of dNTP mixtures, Mg
2+, TaqDNApolymerase, TaqAntibody, damping fluid, DMSO and ammonium sulfate), sterilizing distilled water supplies 20 μ L reaction systems, adjustment pH value of solution be about 7.3.
PCR reaction conditions is: 95 DEG C of denaturation 3min, and DEG C annealing 30s → 72 DEG C, 95 DEG C of sex change 30s → 63 extend 20s totally 30 circulations, and 72 DEG C extend 10min.
Endonuclease reaction is with embodiment 1.After digestion products is concentrated through 1 times under 3% sepharose 5V/cm condition, electrophoresis 40min, qualification of taking pictures under ultraviolet lamp.
Result:
Sequence (it is arranged in SEQIDNO:1 base sequence 358-545 place, altogether 188bp) after amplification, the amplified production sequence obtained following (SEQIDNO:9):
In amplification after product sequence underscore part be upstream, sequence corresponding to downstream primer, m represents the polymorphic i.e. SNP site rs4975605 of A/C.
Product Sequence after restriction endonuclease XmnI enzyme is cut is as follows respectively:
When this polymorphic site contains A allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 147bp sequence (SEQIDNO:10):
When this polymorphic site contains A allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 41bp sequence (SEQIDNO:11):
ccttcaactcgcaggggaattccaaggacggagcgtagcca41
To take pictures under ultraviolet lamp after digestion products electrophoresis qualification, after the amplification of rs4975605 site, occur 188bp segment, cut rear electrophoresis through XmnI enzyme and there will be 188bp, 147bp, 41bp tri-kinds of segments (wherein 41bp not easily differentiates in electrophorogram).
Enzyme is cut rear genotype and is judged: AA type is 147bp fragment, and AC type has 188bp and 147bp two kinds of fragments, and CC type is 188bp fragment.
Detect 75 routine personnel altogether, detected result finds that AA type 2 example, AC type 16 example and CC type 57 example appear in rs4975605 site.
Embodiment 3 human peripheral blood clot sample measures TERT gene rs4975605 polymorphism
Main agents and instrument are with embodiment 1; Blood clot genomic dna is extracted with reference to phenol-chloroform extraction process in " molecule clone technology ".
It is SEQIDNO:12 that PCR reacts the upstream primer adopted, and downstream primer is SEQIDNO:13.
Upstream primer: 5'CTGAGGCAAGAGAATTGCTTGAACTCAGGA3'(SEQIDNO:12);
Downstream primer: 5'GGCTACGCTCCGTCCTTGGAATTCCCCTGCGAGTTG
aaGGC3'(SEQIDNO:13).
Pcr amplification is except annealing temperature is 66 DEG C, and remaining reaction condition is with embodiment 1; Endonuclease reaction is with embodiment 1.After digestion products is concentrated through 1 times under 2.5% sepharose 5V/cm condition, electrophoresis 45min, qualification of taking pictures under ultraviolet lamp.
Result:
Sequence (it is arranged in SEQIDNO:1 base sequence 361-544 place, altogether 184bp) after amplification, the amplified production sequence obtained following (SEQIDNO:14):
In amplification after product sequence underscore part be upstream, sequence corresponding to downstream primer, m represents the polymorphic i.e. SNP site rs4975605 of A/C.
Product Sequence after restriction endonuclease XmnI enzyme is cut is as follows respectively:
When this polymorphic site contains A allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 144bp sequence (SEQIDNO:15):
When this polymorphic site contains A allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 40bp sequence (SEQIDNO:16):
ccttcaactcgcaggggaattccaaggacggagcgtagcc40
To take pictures under ultraviolet lamp after digestion products electrophoresis qualification, after the amplification of rs4975605 site, occur 184bp segment, cut rear electrophoresis through XmnI enzyme and there will be 184bp, 144bp and 40bp (wherein 40bp not easily differentiates in electrophorogram) three kinds of segments.
Enzyme is cut rear genotype and is judged: AA type is 144bp fragment, and AC type has 184bp and 144bp two kinds of fragments, and CC type is 184bp fragment.
Polymorphic result, detects 83 routine personnel altogether, and detected result finds that AA type 2 example, AC type 19 example and CC type 62 example appear in rs4975605 site.
Embodiment 4 human oral mucosa cells measures TERT gene rs4975605 polymorphism
Main agents and instrument are with embodiment 1; Oral Mucosal Cells genomic dna is extracted with reference to phenol-chloroform extraction process in " molecule clone technology ".
It is SEQIDNO:17 that PCR reacts the upstream primer adopted, and downstream primer is SEQIDNO:18.
Upstream primer: 5'TAGTCAGCATGGTGGTGGGCGCCTATAATTCCAG3'(SEQIDNO:17);
Downstream primer: 5'ATGTGGCCCTGGCTACGCTCCGTCCTTGGAATTCCCCTGCGAGTTG
aaGG3'(SEQIDNO:18)
Pcr amplification is except annealing temperature is 68 DEG C, and remaining reaction condition is with embodiment 1; Endonuclease reaction is with embodiment 1.After digestion products is concentrated through 1 times under 2.5% sepharose 5V/cm condition, electrophoresis 45min, qualification of taking pictures under ultraviolet lamp.
Result:
Sequence (it is arranged in SEQIDNO:1 base sequence 315-554 place, altogether 240bp) after amplification, the amplified production sequence obtained following (SEQIDNO:19):
In amplification after product sequence underscore part be upstream, sequence corresponding to downstream primer, m represents the polymorphic i.e. SNP site rs4975605 of A/C.
Product Sequence after restriction endonuclease XmnI enzyme is cut is as follows respectively:
When this polymorphic site contains A allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 190bp sequence (SEQIDNO:20):
When this polymorphic site contains A allelotrope, PCR primer enzyme can be formed after cutting and cut fragment 50bp sequence (SEQIDNO:21):
ccttcaactcgcaggggaattccaaggacggagcgtagccagggccacat50
To take pictures under ultraviolet lamp after digestion products electrophoresis qualification, after the amplification of rs4975605 site, occur 240bp segment, cut rear electrophoresis through XmnI enzyme and there will be 240bp, 190bp and 50bp (wherein 50bp not easily differentiates in electrophorogram) three kinds of segments.
Enzyme is cut rear genotype and is judged: AA type is 190bp fragment, and AC type has 240bp and 190bp two kinds of fragments, and CC type is 240bp fragment.
Polymorphic result, detects 91 routine personnel altogether, and detected result finds that AA type 4 example, AC type 22 example and CC type 65 example appear in rs4975605 site.
Claims (10)
1. measure a method for people TERT gene rs4975605 loci polymorphism, comprising:
Human gene group DNA to be measured is provided;
There is provided upstream primer and the downstream primer of amplification people TERT gene rs4975605 location proximate sequence, wherein downstream primer has base mismatch A;
With described human gene group DNA to be measured for template, utilize upstream primer and downstream primer to carry out pcr amplification reaction to obtain containing the amplified production of GMAAGCCTTC fragment, wherein M is base A undetermined on people TERT gene rs4975605 site and C;
Restriction enzyme is provided;
Utilize restriction enzyme to carry out enzyme to gained amplified production to cut to obtain corresponding digestion products; And
Determine that the base M undetermined on people TERT gene rs4975605 site is A or C according to gained digestion products,
Wherein, restriction enzyme is the restriction enzyme that only can cut one of GAAAGCCTTC fragment and GCAAGCCTTC fragment.
2. method according to claim 1, wherein on gained amplified production, six base AGGCTT of being separated by between the base mismatch A of downstream primer and the complementary base of polymorphic site M.
3. method according to claim 2, wherein on gained amplified production, the complementary base of downstream primer terminal bases and polymorphic site M is adjacent.
4. method according to claim 2, wherein on gained amplified production, downstream primer terminal bases is not adjacent with the complementary base of polymorphic site M.
5. method according to claim 1, wherein restriction enzyme is XmnI or its isoschizomers that only can cut GAAAGCCTTC fragment.
6. method according to claim 1, wherein gained digestion products comprises three kinds of clip types: have total fragment length do not cut off amplified production, cut off after have compared with the amplified production of long segment and after cutting off, there is amplified production compared with short-movie section, by judging that the clip types that digestion products comprises determines that the base M undetermined on people TERT gene rs4975605 site is A or C.
7. method according to claim 6, wherein judge clip types that digestion products comprises taken pictures by gel electrophoresis associating ultraviolet lamp after with reference to scheming to contrast to carry out.
8. method according to claim 7, wherein reference figure is that amplified production obtains and only has first with reference to picture position and second with reference to picture position after the gel electrophoresis standard setting time after ultraviolet lamp is taken pictures, wherein first with reference to picture position for be the amplified production of the total fragment length do not cut off, second with reference to picture position then for be cut off after there is amplified production compared with long segment.
9. method according to claim 1, wherein make total fragment length of amplified production between 100 to 300bp by designing the length of upstream primer and downstream primer, and the fragment length of downstream primer is at least 35bp, makes enzyme fall Partial Fragment earnestly and account for the per-cent of the length of total fragment more than 20%.
10., for measuring a test kit for people TERT gene rs4975605 loci polymorphism, it comprises:
For upstream primer and the downstream primer of pcr amplification people TERT gene rs4975605 location proximate sequence, wherein downstream primer has base mismatch A to obtain containing the amplified production of GMAAGCCTTC fragment, and wherein M is base A undetermined on people TERT gene rs4975605 site and C; And
Only can identify the restriction enzyme of one of GAAAGCCTTC fragment and GCAAGCCTTC fragment.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510618640.3A CN105296612A (en) | 2015-09-24 | 2015-09-24 | Method and kit for determining polymorphism of human TERT gene rs4975605 site |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510618640.3A CN105296612A (en) | 2015-09-24 | 2015-09-24 | Method and kit for determining polymorphism of human TERT gene rs4975605 site |
Publications (1)
Publication Number | Publication Date |
---|---|
CN105296612A true CN105296612A (en) | 2016-02-03 |
Family
ID=55194431
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510618640.3A Pending CN105296612A (en) | 2015-09-24 | 2015-09-24 | Method and kit for determining polymorphism of human TERT gene rs4975605 site |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105296612A (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101532051A (en) * | 2007-12-29 | 2009-09-16 | 复旦大学 | Method for detecting the polymorphism of ADH2 genes |
-
2015
- 2015-09-24 CN CN201510618640.3A patent/CN105296612A/en active Pending
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101532051A (en) * | 2007-12-29 | 2009-09-16 | 复旦大学 | Method for detecting the polymorphism of ADH2 genes |
Non-Patent Citations (2)
Title |
---|
PHILIPP HOFER, ET AL.: "Association of Genetic Variants of Human Telomerase With Colorectal Polyps and Colorectal Cancer Risk", 《MOLECULAR CARCINOGENESIS》 * |
赵春江 等: "应用创造酶切位点法检测单碱基突变", 《遗传》 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102586408B (en) | The detection method of hypertension susceptible gene Mfn2 mononucleotide polymorphism site rs3820189 and detection kit | |
CN101892311B (en) | Detection method and kit of single nucleotide polymorphism locus rs7550536 of susceptibility gene of hypertension | |
CN101892305B (en) | Method for detecting rs2295281 locus of hypertension susceptibility gene and detection kit | |
JP5818018B2 (en) | Circular primer using nucleic acid amplification and its application | |
CN105274212A (en) | Method and kit for determination of human POT1 gene rs1034794 site polymorphism | |
CN105274204A (en) | Method and kit for determination of human PLIN1 gene rs894160 site polymorphism | |
CN107287340A (en) | A kind of composition and its application for being used to detect CYP2C9 and VKORC1 gene pleiomorphisms | |
CN105256008A (en) | Method and kit used for determining human PON1 gene rs662 site polymorphism | |
CN105274213A (en) | Method and kit for determination of human PLIN1 gene rs894160 site polymorphism | |
Havryliuk et al. | Plasmodium vivax: microsatellite analysis of multiple-clone infections | |
CN101638683A (en) | Dual-PCR method for detecting tomato TY-1 gene and Mi gene at the same time | |
JP2010068797A (en) | Method for distinguishing biotype in bemisia tabaci | |
CN105256006A (en) | Method and kit used for determining human TERF1 gene rs201882345 site polymorphism | |
CN105331682A (en) | Human PON1 gene rs854560 site polymorphism detection method and kit | |
CN105274215A (en) | Method and kit for determining rs854560 site polymorphism of PON1 gene | |
CN105296612A (en) | Method and kit for determining polymorphism of human TERT gene rs4975605 site | |
CN105296609A (en) | Method and kit for detecting polymorphism of human TERF1 gene rs201882345 site | |
CN105087818A (en) | Method and kit for determining POT1 gene rs1034794 locus polymorphism | |
CN105256011A (en) | Method and kit used for determining human POT1 gene rs10250202 site polymorphism | |
CN105316406A (en) | Method and kit for measuring human NEFM gene rs12515 site polymorphism | |
CN105420350A (en) | Detection method of human PLIN1 gene rs2289487 site polymorphism and kit | |
CN105274206A (en) | Method and kit for determination of human TERT gene rs2853669 site polymorphism | |
CN105256012A (en) | Method and kit used for determining human NEFL gene rs1059111 site polymorphism | |
CN105063234A (en) | Human TERT gene rs2853669-locus polymorphism investigation technology | |
CN105296611A (en) | Novel technology for detecting polymorphism typing of cyclin-dependent kinase inhibitor 1B gene |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160203 |
|
RJ01 | Rejection of invention patent application after publication |