CN1880330A - siRNA double-chain for suppressing bc1-2 gene expression - Google Patents
siRNA double-chain for suppressing bc1-2 gene expression Download PDFInfo
- Publication number
- CN1880330A CN1880330A CNA2006100913960A CN200610091396A CN1880330A CN 1880330 A CN1880330 A CN 1880330A CN A2006100913960 A CNA2006100913960 A CN A2006100913960A CN 200610091396 A CN200610091396 A CN 200610091396A CN 1880330 A CN1880330 A CN 1880330A
- Authority
- CN
- China
- Prior art keywords
- bcl
- group
- sirna
- cell
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
This invention discloses four groups of siRNA double-strand sequences, which can inhibit the expression of bcl-2 anti-apoptosis gene, and the Bcl-2 protein expression and translation, thereby reduce the Bcl2 protein synthesis, so as to restore the normal apoptosis regulating ability of the cells and ultimately achieve the objective of postponing the tumor growth. The four groups of siRNA double-strand sequences are very good small molecular double-strand nucleotide pharmaceuticals for antifleukemia and drug tolerance of tumor cells.
Description
Patent application of the present invention is that application number is dividing an application of " 2004100511978 ", the applying date of original application is " on August 24th, 2004 ", application number is " 2004100511978 ", and denomination of invention is " suppressing the double-stranded and application of siRNA of bcl-2 genetic expression ".
Technical field
The present invention relates to the double-stranded sequence of siRNA, especially suppress the siRNA two strands of bcl-2 genetic expression.
Background technology
RNAi be double chain RNA mediate PTGS (Post-transcriptional gene silencing, PTGS), promotor is enlivened in the case, target gene can be transcribed, but can not normally accumulate mRNA.Various experiment in vivo and vitro confirm the short dsrna of 21-23 nt, be siRNA (short interference RNA, siRNA), can in the mammalian cell tissue, cause the gene sealing process, its Stability Analysis of Structures need not be carried out chemically modified widely improving its transformation period as antisense nucleotide, and can be under the concentration that is lower than the antisense nucleotide several magnitude, make target gene reduce to extremely low-level even complete " knocking out ", thereby produce the deletion mutantion phenotype.The intervention effect key of siRNA depends on the selection of its target-gene sequence, the mistake of arbitrary nt all can cause the forfeiture of RNAi effect, and it is inserted point mutation, sequence this height sequence-specific and selected gene of disappearance is silent that very important pharmacological action arranged.Prove, the siRNA technology can be separately or together be used to suddenly change with other existing treatment means due to disease, as virus infection, SBMA, also can be used for treating tumour.
Bcl-2 is a proto-oncogene, can suppress apoptosis, and is in close relations with the generation and the chemical sproof formation of tumour.Gene therapy can increase the susceptibility of mdr cell to medicine, and has stronger specificity and nontoxicity, has opened up brand-new approach for the reverse of tumour MDR, has optimized chemotherapy, thereby has had broad application prospects.
Summary of the invention
The object of the present invention is to provide the double-stranded sequence of the siRNA that suppresses bcl-2 genetic expression, and this application of siRNA two strands in pharmacy further is provided.
For reaching above-mentioned purpose, four pairs of the present invention is that the sequence of the siRNA of target is respectively with the bcl-2 gene:
SiRNA2: antisense strand 5 '-AAG CCG GCG ACG ACT TCT CCC CCT GTC TC-3 ',
Positive-sense strand 5 '-AAG GGA GAA GTC GTC GCC GGC CCT GTC TC-3 ';
SIRNA3: antisense strand 5 '-AAC ATC GCC CTG TGG ATG ACT CCT GTC TC-3,
Positive-sense strand 5 '-AAA GTC ATC CAC AGG GCG ATG CCT GTC TC-3 ';
SIRNA5: antisense strand 5 '-AAA GCG TTC ACT CCC AAC CTG CCT GTC TC-3 ',
Positive-sense strand 5 '-AAC AGG TTG GGA GTG AAC GCT CCT GTC TC-3 ';
SIRNA6: antisense strand 5 '-AAG AAT GCA AAG CAC ATC CAA CCT GTC TC-3 ',
Positive-sense strand 5 '-AAT TGG ATG TGC TTT GCA TTC CCT GTC TC-3 '.
Above-mentioned each the siRNA sequence be can be used for preparation treatment tumour and leukemic medicine.
The present invention provides design tool software on the net according to Ambion company, design is synthetic to be 6 couples of siRNA of target with the bcl-2 gene, change synthetic siRNA over to the U251 cell strain by liposome, antisense drug G3139 with non-transfected cells and bcl-2 is contrast, detect the inhibition of siRNA cell growth and the change that flow cytometer detects the cell cycle through mtt assay, detect the restraining effect that siRNA expresses bcl-2 with RT-PCR and immunohistochemical method.The result shows: MTT shows the growth of each time point cell and survival rate, siRNA2,3,5,6 and siRNA1,4 groups and control group and liposome group between significant difference (P＜0.05) is all arranged.SiRNA1,4 groups and control group and liposome group also variant (P＜0.05).SiRNA1-6 group and antisense group all variant at 24 and 48 hours (P＜0.05) were at 72 hours indifferences (P＞0.05).RT-PCR and immunohistochemical method show, siRNA2,3,5,6 groups of obviously low control groups of bcl-2 genetic expression the liposome group antisense group and siRNA1,4 (P＜0.05).The flow cytometer result shows that siRNA1-6 group and antisense group cell block the phase in S.Conclusion: in-vitro transcription synthetic siRNA2,3,5,6 can suppress U251 cell bcl-2 expression of gene, and efficient can reach more than 50%.
RNAi is the PTGS of double chain RNA mediate, and RNAi has powerful cell-penetrating ability, can transmit and keep in the long distance of different iuntercellulars.The siRNA of 21-23 nt, can in the mammalian cell tissue, cause the gene sealing process, the intervention effect key of siRNA depends on the selection of its target-gene sequence, the mistake of arbitrary nt all can cause the forfeiture of RNAi effect, and it is inserted point mutation, sequence this height sequence-specific and selected gene of disappearance is silent that very important pharmacological action arranged.The siRNA Stability Analysis of Structures need not be carried out chemically modified widely improving its transformation period as antisense nucleotide, and can make target gene reduce to extremely low-level even complete " knocking out " under the concentration that is lower than the antisense nucleotide several magnitude.SiRNA mainly changes over to by liposome transfection, electroporation, microinjection and plasmid.
The generation of the transposition of bcl-2 gene and high expression level and tumour is closely related.Have now found that substantial connection is arranged at the generation and the poor prognosis of blood, lymphoid multiple malignant tumour, prostate cancer, colorectal carcinoma, ovarian cancer and neuroblastoma.The homeostasis of the high expression level of apoptosis suppressors such as bcl-2 and tumour escape body is closely related.Bcl-2 can suppress the factor inductive apoptosis that withers of causing under the multiple physiological condition, provides condition thereby can survive for the tumour cell after shifting.Other discovers that the oncocyte of high expression level Bcl-2 increases the chemotherapeutics resistance.Therefore, reduce or the overexpression of elimination Bcl-2 gene in tumour cell, can remove the restraining effect of Bcl-2, promote death of neoplastic cells and strengthen the susceptibility of tumour cell chemotherapeutics to apoptosis of tumor cells.The present invention is directed to synthetic 6 siRNA of bcl-2 gene design, change neurospongioma U-251 over to, compare with G3139 and estimate the effect that it suppresses bcl-2 by liposome.MTT, RT-PCR result show that all siRNA2,3,5,6 has the obvious suppression effect, compare bcl-2 with the blank group and express reduction more than 50%, and flow cytometer showed cell is as a result stagnated the phase in S.Experimental result prompting antisense nucleotide mostly occurs after 48h to the restraining effect of bcl-2, and siRNA 12h after medication promptly has obvious retarding effect, but the MTT results suggest suppresses efficient and decreases along with time lengthening.The present invention uses brand-new the means---siRNA of gene therapy in recent years, suppress the expression of this anti-apoptotic genes expression of bcl-2, can suppress Bcl-2 protein expression and translation effectively, thereby it is synthetic to reduce Bc 12 albumen, in the hope of recovering the normal apoptotic ability of regulation and control of cell, finally reach the purpose that delays tumor growth, and then it is applied in the pharmacy of tumour medicine.
Description of drawings
Fig. 1～Fig. 9 is that microscopically is observed when detecting with immunohistochemical method that bcl-2 is proteic to express respectively organizes U251 cell bcl-2 protein expression aspect graph.
Figure 10 is that RT-PCR detects the electrophorogram of respectively organizing transfectional cell bcl-2mRNA expression level.
Figure 11～Figure 19 is a cycle change curve behind the cell transfecting observed of flow cytometer.
Figure 20 respectively organizes hundred parts of rate comparison diagrams of cell S phase cell.
Embodiment
Embodiment 1:siRNA's is synthetic.
About the siRNA sequences Design, Ambion company all provides design tool software (referring to www.ambion.com/techlib/misc/siRNA finder.html) on the net and synthesizes following six couples of siRNA according to test kit (U.S. Ambion company):
| siRNA1 | Positive-sense strand | 5’-AAC AGC TTA TAA TGG ATG TAC CCT GTC TC-3’ |
| Antisense strand | 5’-AAG TAC ATC CAT TAT AAG CTG CCT GTC TC-3’ | |
| siRNA2 | Positive-sense strand | 5’-AAG CCG GCG ACG ACT TCT CCC CCT GTC TC-3’ |
| Antisense strand | 5’-AAG GGA GAA GTC GTC GCC GGC CCT GTC TC-3’ | |
| siRNA3 | Positive-sense strand | 5’-AAA GTC ATC CAC AGG GCG ATG CCT GTC TC-3’ |
| Antisense strand | 5’-AAC ATC GCC CTG TGG ATG ACT CCT GTC TC-3 | |
| siRNA4 | Positive-sense strand | 5’-AAC CAG GTG TGC AGG TGC CGG CCT GTC TC-3’ |
| Antisense strand | 5’-AAC CGG CAC CTG CAC ACC TGG CCT GTC TC-3 | |
| siRNA5 | Positive-sense strand | 5’-AAC AGG TTG GGA GTG AAC GCT CCT GTC TC-3’ |
| Antisense strand | 5’-AAA GCG TTC ACT CCC AAC CTG CCT GTC TC-3’ | |
| siRNA6 | Positive-sense strand | 5’-AAT TGG ATG TGC TTT GCA TTC CCT GTC TC-3’ |
| Antisense strand | 5’-AAG AAT GCA AAG CAC ATC CAA CCT GTC TC-3’ |
Table 1, according to six pairs of siRNA sequences of Ambion company design software design synthetic
Embodiment 2:MTT detects cell to each susceptibility to siRNA.
The U251 cell in vegetative period of taking the logarithm, preparation 1.5 * 105/mL initial concentration cell suspension is added to (U.S. Corning company production in 96 well culture plates,), every hole adds 100 μ L, establishes blank group, liposome (American I nvitrogen company) control group, antisense group (15 μ mol/L) and siRNA 1-6 group (1 μ mol/L).Every group 5 hole, by dividing into groups behind inoculation 24h, abandon or adopt supernatant, add siRNA1-6 or G3139, put 37 ℃, saturated humidity, serum-free continue to be cultivated 6h in the 5%CO2 incubator, respectively adds the unparalleled anti-1,640 100 μ L that contain 10% foetal calf serum again, respectively at 24,48,72h adds MTT 20 μ L, the centrifugal supernatant of abandoning adds DMSO 150 μ L behind the 4h, reads absorbancy under the microplate reader.Cell survival rate=experimental group absorbance value/control group absorbance value * 100%.
Surface as a result, siRNA2,3,5,6 and control group and liposome group at each time point significant difference (P＜0.001) is arranged all; In each time point siRNA1,4 groups and siRNA2,3,5,6 variant (P＜0.05) and control group and liposome group also variant (P＜0.05).SiRNA1-6 group and antisense group are in 72 hours indifferences (P=0.073,0.133,0.239,0.054,0.225,0.137), all variant at 24 and 48 hours (P＜0.05).See Table 2, table 3.
| Group | 24 hours | 48 is little 0 o'clock | 72 hours |
| Blank group antisense group liposome control group SiRNA1 group SiRNA2 group SiRNA3 group SiRNA4 group SiRNA5 group SiRNA6 group | 0.439±0.017 0.390±0.040 ★ 0.412±0.039 0.334±0.031 ★ 0.148±0.011 0.184±0.044 * 0.320±0.033 ★ 0.192±0.044 * 0.209±0.026 * | 0.651±0.029 0.609±0.034 ★ 0.624±0.030 0.529±0.017 ★ 0.356±0.033 * 0.371±0.009 * 0.526±0.031 ★ 0.380±0.057 * 0.351±0.036 * | 0.968±0.072 0.701±0.064 ★ 0.928±0.013 0.751±0.043 ★ 0.660±0.009 * 0.669±0.030 * 0.755±0.035 ★* 0.668±0.040 * 0.660±0.033 * |
※ represents respectively to organize the result after the OD value is the blank substratum background of deduction
★ represent and control group between variant (P＜0.05) * represent and to notable difference (P＜0.001) being arranged according to group
Each time point mtt assay detects cell-proliferation activity OD value behind table 2, the transfection siRNA
*
| Group | 24 hours | 48 hours | 72 hours |
| Blank group antisense group liposome control group SiRNA1 group SiRNA2 group SiRNA3 group SiRNA4 group SiRNA5 group SiRNA6 group | 100％ 88.8％ ★ 93.8％ 76.1％ ★ 33.7％ * 41.9％ * 72.9％ ★ 43.7％ * 47.6％ * | 100％ 93.5％ ★ 95.9％ 81.3％ ★ 54.7％ * 56.9％ * 80.7％ ★ 58.4％ * 53.9％ * | 100％ 72.4％ ★ 95.9％ 77.6％ ★ 68.2％ * 69.1％ * 78.0％ ★ 69.1％ * 68.2％ * |
★ represent and control group between variant (P＜0.05) * represent and control group between notable difference (P＜0.01) is arranged
Each time point mtt assay detects cell survival rate behind table 3, the transfection siRNA
Embodiment 3: immunohistochemical method detects the expression of bcl-2 albumen (the Wuhan doctor gets company and produces).
Each organizes cell with 1.5 * 105/mL, and initial concentration is inoculated in 6 orifice plates, and the cover glass of built-in one 1.5 * 1.5cm by continuing to cultivate 48h after the above-mentioned cultural method transfection, discards supernatant.Decided cover glass 15 seconds, the PBS rinsing with 3: 1 methanol acetic acids are liquid-solid; 4 ℃ of 1%Tris-Triton 100 penetrating 5min, the PBS rinsing; Peroxidase sealing 10 seconds, the PBS rinsing; Non-immune serum sealing 10 seconds discards and drips bcl-2 one and resists in 4 ℃ and hatch 12h, the PBS rinsing; Add two anti-, biotin labeling antibody successively, and the PBS rinsing, the DAB colour developing, Hematorylin is redyed nuclear.Each batch experiment is equipped with blank and replaces one to resist with PBS.
Fig. 1～Fig. 9 detects the proteic expression of bcl-2 with immunohistochemical method, and microscopically is observed respectively organizes U251 cell bcl-2 protein expression aspect graph.Table 4 has shown the difference of respectively organizing expression of cellular proteins.
| Group | Positive rate (%) |
| Control group antisense group liposome group SiRNA1 group SiRNA2 group SiRNA3 group | 39.63±7.52 27.14±5.87★ 35.42±8.07 23.26±4.09★ 11.32±2.27* 15.44±3.31* |
| SiRNA4 group SiRNA5 group SiRNA6 group | 25.61±4.16★ 16.56±1.79* 13.81±2.23* |
★ represent and control group between variant (P＜0.05); * between expression and control group notable difference (P＜0.01) is arranged
Table 4 is respectively organized the protein expression of immunohistochemical methods bcl-2
Embodiment 4:RT-PCR (Shen, Shanghai energy betting office) detects transfectional cell bcl-2mRNA expression level.
Each is organized cell and is inoculated in 6 orifice plates with 1.5 * 105/L initial concentration, presses and continues to cultivate 12h, the centrifugal collection of trysinization after the embodiment 2 described cultural method transfections.The horizontal bcl-2 primer sequence of using Shen, Shanghai energy lottery industry company limited's cell total rna extracting and purifying reagent and RT-PCR kit measurement bcl-2mRNA is as follows: 5` holds primer: CGACGACTTCTCCCGCCGCTACCGC, and 3` holds primer: the CCGCATGCTGGGGCCGTACAGTTCC amplified production is 318bp.RNA extracts: successively use RNA extracting solution (Life Technologies, Inc.), chloroform, Virahol, 75% ethanol, and the precipitation separation washing, concrete steps are undertaken by its specification sheets.Last RNA precipitation, aseptic deionized water with an amount of DEPC processing, 56 ℃ of water-bath hydrotropies, the RNA that takes a morsel surveys OD value quantitative (OD260/OD280 ratio＞1.8) and with 1% sepharose (containing 0.5 μ g/mlEB) electrophoresis observation 28S and two clear bands of 18SrRNA, to guarantee to extract purity and the integrity of RNA.(2) the synthetic and pcr amplification of cDNA, strictness is undertaken by reverse transcription test kit specification sheets.With β-actin is internal reference, 94 ℃ of sex change 30 seconds; Annealed 1 minute for 60 ℃; 72 ℃ were extended 1 minute.Circulate after 30 times, 72 ℃ were extended 5 minutes.The electrophoresis product is observed on 2% agarose gel electrophoresis and is taken a picture, and observes on Gel-Doc1000 type ultraviolet gel images analyser, analyzes, and calculates the ratio of Bcl-2 and β-actin amplified band, and takes the photograph sheet, sees Figure 10.Get RT-PCR product 5 μ l electrophoresis on 2% sepharose, found that blank and clear band is seen at liposome control group, antisense group 318bp place, siRNA respectively organizes band all to be had and weakens, obvious with 2,3,5,6 groups.Each organizes internal reference β-actin band unanimity.The expression that suppresses cell bcl-2 after the siRNA transfection is described.
The cycle changes after embodiment 5, the transfection of flow cytometer observation of cell
Each is organized cell and is inoculated in 25cm with 1.5 * 105/L initial concentration
2Culturing bottle, continue to cultivate 48h after pressing embodiment 2 described cultural method transfections, the centrifugal collection of trysinization also is suspended among the PBS, 4 ℃ with the fixing 30min of 70% ethanol, with the staining fluid dyeing 30min that contains RNase and iodate third ingot, flow cytometer (EPICS-ELITE-ESP) is measured the variation of dna content, with MULTICYCLE software processes result.The result shows that siRNA2,3,5,6 groups of cell retarded growths are seen Figure 11～Figure 19 and Figure 20 in the S phase.
Embodiment 6, the siRNA application in preparation medicine for treating tumor thing.
Gained siRNA2 of the present invention, siRNA3, siRNA5, siRNA6 are used for preparation treatment tumour or leukemic medicine.Be used for human vivo medicine-feeding, can use separately or unite use with other medicines.
SEQUENCE LISTING
＜110〉Ji'nan University
＜120〉the siRNA two strands of inhibition bcl-2 genetic expression
<130>
<160>12
<170>PatentIn version 3.2
<210>1
<211>29
<212>DNA
<213>Artificial sequence
<220>
＜223〉synthetic according to the design software design of Ambion company is the positive-sense strand of the siRNA1 sequence of target with the bcl-2 gene
<400>1
aacagcttat aatggatgta ccctgtctc 29
<210>2
<211>29
<212>DNA
<213>Artificial sequence
<220>
＜223〉synthetic according to the design software design of Ambion company is the antisense strand of the siRNA1 sequence of target with the bcl-2 gene
<400>2
aagtacatcc attataagct gcctgtctc 29
<210>3
<211>29
<212>DNA
<213>Artificial sequence
<220>
＜223〉synthetic according to the design software design of Ambion company is the positive-sense strand of the siRNA2 sequence of target with the bcl-2 gene
<400>3
aagggagaag tcgtcgccgg ccctgtctc 29
<210>4
<211>29
<212>DNA
<213>Artificial sequence
<220>
＜223〉synthetic according to the design software design of Ambion company is the antisense strand of the siRNA2 sequence of target with the bcl-2 gene
<400>4
aagccggcga cgacttctcc ccctgtctc 29
<210>5
<211>29
<212>DNA
<213>Artificial sequence
<220>
＜223〉synthetic according to the design software design of Ambion company is the positive-sense strand of the siRNA3 sequence of target with the bcl-2 gene
<400>5
aaagtcatcc acagggcgat gcctgtctc 29
<210>6
<211>29
<212>DNA
<213>Artificial sequence
<220>
＜223〉synthetic according to the design software design of Ambion company is the antisense strand of the siRNA3 sequence of target with the bcl-2 gene
<400>6
aacatcgccc tgtggatgac tcctgtctc 29
<210>7
<211>29
<212>DNA
<213>Artificial sequence
<220>
＜223〉synthetic according to the design software design of Ambion company is the positive-sense strand of the siRNA4 sequence of target with the bcl-2 gene
<400>7
aaccaggtgt gcaggtgccg gcctgtctc 29
<210>8
<211>29
<212>DNA
<213>Artificial sequence
<220>
＜223〉synthetic according to the design software design of Ambion company is the antisense strand of the siRNA4 sequence of target with the bcl-2 gene
<400>8
aaccggcacc tgcacacctg gcctgtctc 29
<210>9
<211>29
<212>DNA
<213>Artificial sequence
<220>
＜223〉synthetic according to the design software design of Ambion company is the positive-sense strand of the siRNA5 sequence of target with the bcl-2 gene
<400>9
aacaggttgg gagtgaacgc tcctgtctc 29
<210>10
<211>29
<212>DNA
<213>Artificial sequence
<220>
＜223〉synthetic according to the design software design of Ambion company is the antisense strand of the siRNA5 sequence of target with the bcl-2 gene
<400>10
aaagcgttca ctcccaacct gcctgtctc 29
<210>11
<211>29
<212>DNA
<213>Artificial sequence
<220>
＜223〉synthetic according to the design software design of Ambion company is the positive-sense strand of the siRNA6 sequence of target with the bcl-2 gene
<400>11
aattggatgt gctttgcatt ccctgtctc 29
<210>12
<211>29
<212>DNA
<213>Artificial sequence
<220>
＜223〉synthetic according to the design software design of Ambion company is the antisense strand of the siRNA6 sequence of target with the bcl-2 gene
<400>12
aagaatgcaa agcacatcca acctgtctc 29
Claims (1)
1, a kind of siRNA two strands (siRNA6) that suppresses bcl-2 genetic expression, its sequence is:
Antisense strand 5 '-AAG AAT GCA AAG CAC ATC CAA CCT GTC TC-3 ',
Positive-sense strand 5 '-AAT TGG ATG TGC TTT GCA TTC CCT GTC TC-3 '.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100913960A CN100410373C (en) | 2004-08-24 | 2004-08-24 | siRNA double-chain for suppressing bc1-2 gene expression |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100913960A CN100410373C (en) | 2004-08-24 | 2004-08-24 | siRNA double-chain for suppressing bc1-2 gene expression |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2004100511978A Division CN1324136C (en) | 2004-08-24 | 2004-08-24 | SiRNA double chain for inhibiting bc 1-2 gen expression and use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1880330A true CN1880330A (en) | 2006-12-20 |
| CN100410373C CN100410373C (en) | 2008-08-13 |
Family
ID=37518708
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2006100913960A Expired - Fee Related CN100410373C (en) | 2004-08-24 | 2004-08-24 | siRNA double-chain for suppressing bc1-2 gene expression |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100410373C (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009071681A2 (en) * | 2007-12-07 | 2009-06-11 | Santaris Pharma A/S | Rna antagonist compounds for the modulation of bcl-2 |
| CN101974533A (en) * | 2010-10-28 | 2011-02-16 | 百奥迈科生物技术有限公司 | siRNA molecule inhibiting Bc1-2 gene expression and application thereof |
| CN102703452A (en) * | 2012-06-21 | 2012-10-03 | 浙江省医学科学院 | siRNA double-strand for inhibiting Bcl2 gene expression and application thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2305812A3 (en) * | 2002-11-14 | 2012-06-06 | Dharmacon, Inc. | Fuctional and hyperfunctional sirna |
| CN1176937C (en) * | 2003-02-21 | 2004-11-24 | 复旦大学附属中山医院 | Dowble-stranded RNA and use thereof |
| CN1458281A (en) * | 2003-06-18 | 2003-11-26 | 天津环球中加生物科技有限公司 | Coronary virus RNA interference preparation for severe acute respiratory syndrome pathogen |
| CN1276086C (en) * | 2003-08-13 | 2006-09-20 | 复旦大学 | A double-stranded DNA molecule and its use in preparing medicine for inhibiting hepatitis B virus replication |
-
2004
- 2004-08-24 CN CNB2006100913960A patent/CN100410373C/en not_active Expired - Fee Related
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009071681A2 (en) * | 2007-12-07 | 2009-06-11 | Santaris Pharma A/S | Rna antagonist compounds for the modulation of bcl-2 |
| WO2009071681A3 (en) * | 2007-12-07 | 2009-12-23 | Santaris Pharma A/S | Rna antagonist compounds for the modulation of bcl-2 |
| CN101974533A (en) * | 2010-10-28 | 2011-02-16 | 百奥迈科生物技术有限公司 | siRNA molecule inhibiting Bc1-2 gene expression and application thereof |
| CN101974533B (en) * | 2010-10-28 | 2017-09-15 | 百奥迈科生物技术有限公司 | A kind of siRNA molecule of suppression gene expressions of Bcl 2 and its application |
| CN102703452A (en) * | 2012-06-21 | 2012-10-03 | 浙江省医学科学院 | siRNA double-strand for inhibiting Bcl2 gene expression and application thereof |
| CN102703452B (en) * | 2012-06-21 | 2013-06-05 | 浙江省医学科学院 | siRNA double-strand for inhibiting Bcl2 gene expression and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100410373C (en) | 2008-08-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2023115983A1 (en) | SIRNA FOR SPECIFICALLY KNOCKING DOWN TNF-α GENE EXPRESSION AND APPLICATION THEREOF | |
| CN1324136C (en) | SiRNA double chain for inhibiting bc 1-2 gen expression and use | |
| CN106244593B (en) | It is a kind of adjust pilose antler young pilose antler skin fast-growth microRNA and its application | |
| CN110317878B (en) | Long-chain non-coding RNA for diagnosis and treatment monitoring of bladder cancer and application thereof | |
| CN103146689B (en) | Short hairpin ribonucleic acid (shRNA) and shRNA application to preparation of medicines for curing colorectal cancer | |
| CN1880330A (en) | siRNA double-chain for suppressing bc1-2 gene expression | |
| CN1880332A (en) | siRNA double-chain for suppressing bc1-2 gene expression | |
| CN1940074A (en) | Construction, screen and use for stomach cancer target AFP gene siRNAs expression carrier | |
| CN1880331A (en) | siRNA double-chain for suppressing bc1-2 gene expression | |
| CN1249243C (en) | Targetted liver cancer AFP gene siRNAs expression carrier and its constructing method and use | |
| CN116286824A (en) | Application of gene inhibitor in preparation of breast cancer angiogenesis inhibition drugs | |
| CN108096580B (en) | Target for inhibiting neuroblastoma SH-SY5Y and application thereof | |
| CN1807631A (en) | Method for promoting terpene indole alkaloid content of Vinca rosea hairly root by transcription factor | |
| CN1884526A (en) | RNA interference method for specificly and high effectively treating CSFV infection and biological formulation | |
| CN106801057A (en) | A kind of siRNA of long-chain non-coding RNA PCGEM1 related to oophoroma and carcinoma of endometrium and application | |
| CN101921763B (en) | siRNA capable of inhibiting expression of PAR-1 gene and application thereof | |
| CN113789340B (en) | Expression vector of circular RNA hsa_circ_0001741, recombinant engineering bacterium and application thereof | |
| CN111349704B (en) | Diagnostic product and therapeutic composition for liver cancer | |
| CN1247608C (en) | Gene therapeutic drug hdm2-siRNA for breast cancer | |
| CN1800387A (en) | Small interfering RNA for suppressing multiple effect growth factor expression and its uses | |
| CN112941183B (en) | Application of non-coding gene miR-187-5p in primary liver cancer diagnosis and treatment | |
| CN113368242B (en) | Application of non-small cell lung cancer inhibition target | |
| CN1796555A (en) | Small interference RNA molecule for restraining protein expression of DNA-PKCS, and encoding gene and application | |
| CN1962863A (en) | PEG10-siRNA inhibiting gene expression of human PEG10 and its pharmaceutical use | |
| CN104726456A (en) | siRNA for inhibiting human malignant melanoma RNF11 gene expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080813 Termination date: 20110824 |