CN1796555A - Small interference RNA molecule for restraining protein expression of DNA-PKCS, and encoding gene and application - Google Patents
Small interference RNA molecule for restraining protein expression of DNA-PKCS, and encoding gene and application Download PDFInfo
- Publication number
- CN1796555A CN1796555A CNA2004101025680A CN200410102568A CN1796555A CN 1796555 A CN1796555 A CN 1796555A CN A2004101025680 A CNA2004101025680 A CN A2004101025680A CN 200410102568 A CN200410102568 A CN 200410102568A CN 1796555 A CN1796555 A CN 1796555A
- Authority
- CN
- China
- Prior art keywords
- sequence
- dna
- seq
- protein expression
- pkcs
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
This invention describes the coding gene and applications of the small-disturbance RNA molecules that can suppress the expression of DNA-PKcs proteins. The small-disturbance RNA molecules contain at least one double-chain RNA sequence from the following 1) and 2): 1) the sense strand possesses the nucleic acid sequence from the sequence 1 in the sequence table, and the antisense strand possesses the nucleic acid sequence from the sequence 2 in the sequence table. 2) The sense strand possesses the nucleic acid sequence from the sequence 3 in the sequence table, and the antisense strand possesses the nucleic acid sequence from the sequence 4 in the sequence table. This invention also describes a cancer-depression, and radiation and/or chemotherapy enhanced sensitivity drug that uses the small-disturbance RNA molecules or an expression carrier containing the small-disturbance RNA molecules as the active component. The drug has multiple drug effects and can be widely used for cancer therapy.
Description
Technical field
The present invention relates to suppress siRNA molecule and the encoding gene and the application of DNA-PKcs protein expression, particularly its application in suppressing tumour and radiation and chemotherapy sensitizing.
Background technology
Malignant tumour is the major disease of harm humans health, radiotherapy is one of its important means, but a lot of tumour inherent radiation resistances are arranged and cause radiocurable failure, and the nearly all toxic big defective of present radiosensitizer, clinical application is restricted, and searching low toxicity, effective radiotherapy hypersitization medicine remain the main task that faces at present.
DNA-PKcs is the catalytic subunit (DNA Dependent Protein KinaseCatalytic Subunit) of DNA dependent kinases, constitutes the DNA-PK mixture jointly with Ku70 of two other subunit and Ku80.Belong to phosphatidyl-inositol 3-kinase (Phosphatidylinositol-3-kinase, PI-3K) superfamily member with ATM, ATR etc.DNA-PKcs played an important role in non-homogeneous terminal the connection in (NHEJ) reparation of dna double splitting of chain.Finding at present that DNA-PKcs expresses in kinds of tumor cells is higher than healthy tissues, is one of major reason of these tumours opposing radiation and chemotherapies, and with the grade of malignancy and the transfer characteristics of some tumours substantial connection is arranged.
RNA perturbation technique (RNAi) is the biotechnology of specificity degraded target gene under the mediation of double-stranded RNA (ds RNA) molecule, can make the genetic expression silence, reaches the antagonism target gene and realizes biological (gene) therapeutic purpose.Length is the so-called siRNA (siRNA of 21 to 25 bases, small interfering RNA) mediation specificity disturbance reponse, only mRNA (Elbashir, the S.M. of degraded and its height complementary specific gene, Harborth, J., Lendeckel, W.et al., Duplexes of 21-nucleotide RNAs mediate RNAinterference in cultured mammalian cells, Nature, 2001,411 (6836): 494).
The innovation and creation content
The siRNA molecule that the purpose of this invention is to provide a kind of DNA-PKcs of inhibition protein expression.
The siRNA molecule of inhibition provided by the present invention DNA-PKcs protein expression is following 1) and 2) at least one double-stranded RNA sequence:
1) positive-sense strand has the nucleotide sequence of sequence 1 in the sequence table, and antisense strand has the nucleotide sequence of sequence 2 in the sequence table;
2) positive-sense strand has the nucleotide sequence of sequence 3 in the sequence table, and antisense strand has the nucleotide sequence of sequence 4 in the sequence table.
To have 1) double-stranded RNA sequence called after PRKDC
SiRNAH1, 11637-11655 (GI:31340617) position sequence 5 ' GGGCGCUAAUCGUACUGAA 3 ' complementation of its antisense strand and DNA-PKcs mRNA.Sequence 1 is by 19 based compositions in the sequence table, and the direction of sequence is 5 ' end → 3 ' end from left to right; Sequence 2 is by 19 based compositions in the sequence table, and the direction of sequence is 5 ' end → 3 ' end from left to right.
To have 2) double-stranded RNA sequence called after PRKDC
SiRNAH2, 12321-12339 (GI:31340617) position sequence 5 ' CAUUCGUGCCCAAGAACCA 3 ' complementation of its antisense strand and DNA-PKcs mRNA.Sequence 3 is by 19 based compositions in the sequence table, and the direction of sequence is 5 ' end → 3 ' end from left to right; Sequence 4 is by 19 based compositions in the sequence table, and the direction of sequence is 5 ' end → 3 ' end from left to right.
The encoding gene of the siRNA molecule of above-mentioned inhibition DNA-PKcs protein expression also belongs to protection scope of the present invention.
The encoding gene that suppresses the siRNA molecule of DNA-PKcs protein expression can have following 1) and 2) at least one double chain nucleotide sequence:
1) sense strand (positive-sense strand) (not making the DNA chain of template) have the nucleotide sequence of sequence 5 in the sequence table or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 5 dna sequence dnas hybridization that limit; Antisense strand (making the DNA chain of template) have the nucleotide sequence of sequence 6 in the sequence table or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 6 dna sequence dnas hybridization that limit;
2) sense strand (positive-sense strand) (not making the DNA chain of template) have the nucleotide sequence of sequence 7 in the sequence table or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 7 dna sequence dnas hybridization that limit; Antisense strand (making the DNA chain of template) have the nucleotide sequence of sequence 8 in the sequence table or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 8 dna sequence dnas hybridization that limit.
The rigorous condition of described height can be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS, under 65 ℃, hybridize and wash film.
To have 1) double chain oligonucleotide sequence called after PRKDC
SiDNAH1, coding PRKDC
SiRNAH1Sequence 5 is by 47 based compositions in the sequence table, and the direction of sequence is 5 ' end → 3 ' end from left to right; Sequence 6 is by 47 based compositions in the sequence table, and the direction of sequence is 3 ' end → 5 ' end from left to right.
To have 2) double chain oligonucleotide sequence called after PRKDC
SiDNAH2, coding PRKDC
SiRNAH2Sequence 7 is by 47 based compositions in the sequence table, and the direction of sequence is 5 ' end → 3 ' end from left to right; Sequence 8 is by 47 based compositions in the sequence table, and the direction of sequence is 3 ' end → 5 ' end from left to right.
Under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 5 dna sequence dnas hybridization that limit can be SEQ ID №: 9, can with SEQ ID № in the sequence table: the nucleotide sequence of the 6 dna sequence dnas hybridization that limit can be SEQ ID №: 10.
Sequence 9 is become by 64 bases, and the direction of sequence is 5 ' end → 3 ' end from left to right; Sequence 10 is become by 64 bases, and the direction of sequence is 3 ' end → 5 ' end from left to right.
Under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 7 dna sequence dnas hybridization that limit can be SEQ ID №: 11, can with SEQ ID № in the sequence table: the nucleotide sequence of the 8 dna sequence dnas hybridization that limit can be SEQ ID №: 12.
Sequence 11 is become by 64 bases, and the direction of sequence is 5 ' end → 3 ' end from left to right; Sequence 12 is become by 64 bases, and the direction of sequence is 3 ' end → 5 ' end from left to right.
Expression vector, clone and the host bacterium of encoding gene that contains the siRNA molecule of above-mentioned inhibition DNA-PKcs protein expression all belongs to protection scope of the present invention.
The inventor studies show that, the siRNA molecule of above-mentioned inhibition DNA-PKcs protein expression has the inhibition tumour and strengthens the effect of tumour cell to radiation and chemotherapeutics cis-platinum susceptibility, and can significantly suppress the expression of oncogene c-Myc.Therefore another object of the present invention provides a kind of inhibition tumour medicine and a kind of radiation sensitization and/or chemotherapy sensitizing medicine.
Inhibition tumour medicine provided by the present invention, radiation sensitization and/or chemotherapy sensitizing medicine, their activeconstituents are the siRNA molecule of above-mentioned inhibition DNA-PKcs protein expression or the expression vector that carries the siRNA molecule encoding gene of described inhibition DNA-PKcs protein expression.
Also can contain dda adjuvant and/or MPL and/or Quil-A and/or RIBI adjuvant and/or saline (physiological saline) or other adjuvant in the said medicine, as aluminium adjuvant, freund adjuvant etc.
Medicine of the present invention can be made into various ways such as injection liquid, pulvis, paste, nanometer formulation.The medicine of above-mentioned various formulations all can be according to the method preparation in genomic medicine/oligonucleotide drug field.
The consumption of said medicine is generally the described siRNA molecule of 20-200 μ g or its expression vector/kg body weight/day, and be 10 to 20 days the course of treatment, or before each radiotherapy or chemotherapy 12-24 hour with once.
Medicine of the present invention will be widely used in treatment for cancer with its multiple drug action (directly suppressing, suppress oncogene c-Myc expression, radiation or chemotherapy sensitizing).
Description of drawings
Figure 1A-Figure 1B is PRKDC
SiRNAH1, PRKDC
SiRNAH2, H3 and non-distinguished sequence NC compare DNA-PKcs albumen in the HeLa cell and c-Myc protein expression restraining effect
Fig. 2 A-Fig. 2 B is PRKDC
SiRNAH1, PRKDC
SiRNAH2, H3 and NC suppress the enhancement curve of HeLa cell proliferation to 2Gy or 4Gy irradiation
Fig. 3 is PRKDC
SiRNAH1The enhancement curve that 0.1 μ mmol/L cis-platinum is suppressed HeLa cell proliferation
Fig. 4 is PRKDC
SiRNAH1The restraining effect that suppresses HeLa cellular oncogene c-Myc expression product transcriptional activity
Fig. 5 is transfection PRKDC
SiRNAH1The HeLa inoculation nude mice growth of tumor rate of expression vector
Embodiment
Cell and reagent
The human cervical carcinoma Hela cell ties up in the DMEM nutrient solution that contains 10% new-born calf serum and cultivates.The BACB/C nude mice in age in 4-5 week is available from Institute of Experimental Animals, Chinese Academy of Medical Sciences.
Plasmid vector pSilencer
TM3.1-H1hugro available from Ambion company, a small amount of plasmid extraction kit and T
4Dna ligase is available from Promega company, Hind III and BamH I are NEB company product, DMEM and Lipo-fectamine are GIBCO BRL company product, Protease inhibitor cocktail tablet and Hygromycin B are Roche company product, DNA-PKcs antibody (H-163), c-myc antibody (9E10), β-actin antibody (I-19) is available from Santa Cruz company, the anti-rabbit of horseradish peroxidase labelled goat, goat anti-mouse, the anti-goat-anti body of rabbit are available from Beijing Zhong Shan company, and other reagent is the analytical pure product that domestic corporation produces.
The cell experiment that embodiment 1, siRNA molecule of the present invention inhibition DNA-PKcs protein expression, inhibition tumor growth, radiation and chemotherapy increase
1, acts on the molecular designing of the siDNA of DNA-PKcs target molecule
Utilize computer aided design (CAD) and homologous sequence scanning analysis software, 3 pairs of specific actions have been synthesized in the siRNA molecular sequences of DNA-PKcs target molecule different sites, wherein H3 is the known action sequence, acts on the translation initiation district (354-372) of DNA-PKcs, PRKDC
SiDNAH1And PRKDC
SiDNAH2Sequence for the present invention's selection, act on the catalytic activity district (11637-11655 of DNA-PKcs mRNA respectively, its sequence is 5 ' GGGCGCUAAUCGUACUGAA 3 '), district (12321-12339 between functional domain, its sequence is 5 ' CAUUCGUGCCCAAGAACCA 3 '), concrete sequence following (the underscore base sequence is the target sequence at DNA-PKcs mRNA):
PRKDC
SiDNAH1Positive-sense strand:
5 '-GATCCC
GGGCGCTAATCGTACTGAATTCAAGAGA
TTCAGTACGATTAGCGCCCTTTTTTGGAAA-3 ' (sequence 9);
PRKDC
SiDNAH1Antisense strand:
3 '-GG
CCCGCGATTAGCATGACTTAAGTTCTCT
AAGTCATGCTAATCGCGGGAAAAAACCTTTTCGA-5 ' (sequence 10)
PRKDC
SiDNAH2Positive-sense strand:
5 '-GATCCC
CATTCGTGCCCAAGAACCATTCAAGAGA
TGGTTCTTGCGCACGAATGTTTTTTGGAAA-3 ' (sequence 11);
PRKDC
SiDNAH2Antisense strand:
3 '-GG
GTAAGCACGGGTTCTTGGTAAGTTCTCT
ACCAAGAACCCGTGCTTACAAAAAACCTTTTCGA-5 ' (sequence 12).
The H3 positive-sense strand:
5’-GATCCC
GATCGCACCTTACTCTGTTTTCAAGAGA
AACAGAGTAAGGTGCGATCTTTTTTGGAAA-3’；
The H3 antisense strand:
3’-GG
CTAGCGTGGAATGAGACAAAAGTTCTCT
TTGTCTCATTCCACGCTAGAAAAAACCTTTTCGA-5’。
BamH I sticky end and Hind III sticky end have been added respectively at every pair of siDNA chain upstream and downstream.According to a conventional method by the synthetic PRKDC of AudioCodes company
SiDNAH1, PRKDC
SiDNAH2With the H3 oligonucleotide sequence.
2.DNA-PKcs the structure of siRNA expression vector
Plasmid pSilencer
TM3.1-H1 hugro uses T after Hind III and BamH I enzyme are cut
4Dna ligase be connected with the siDNA of synthetic DNA-PKcs (16 ℃, 8h), transform DH5 α bacterial strain, be coated with the LB culture plate that contains 50mg/L penbritin (Amp), get single bacterium colony and shake the bacterium lateral order.The bacterium colony of choosing no base sudden change or disappearance extracts plasmid, obtains siRNA expression vector: PRKDC
SiRNAH1Expression vector, PRKDC
SiRNAH2Expression vector and H3 expression vector.
3. cell transfecting
24h inoculation (3-5) * 10 before the transfection
5The HeLa cell is in the culture dish of 60mm, and through the siRNA of Lipofectamine mediated dna-PKcs expression vector transfection HeLa cell (pressing the test kit description operation), 48h is by 1 * 10 after the transfection
5Individual cell inoculation in the culture dish of 60mm, hygromycin selection positive colony (250 μ g/ml), every 3d changes a nutrient solution (will establish a negative control NC simultaneously, soon not carry the empty carrier transfectional cell of siDNA).
4.Western blot detects DNA-PKcs and c-Myc expresses variation
The positive colony that filters out is chosen the back continue to cultivate, Totomycin concentration reduce by half (125 μ g/ml).Collect positive colony cell and negative control cell (NC) lysis buffer (50mmol/L Tris-HCL pH7.5 respectively, 1%Noridet P40,0.5% Sodium desoxycholate, 150mmol/L NaCl, 1Protease inhibitor cocktailtablet/50ml) extracts total protein of cell, through the quantitative albumen of Coomassie brilliant blue staining, get sample on the 15-20 μ g total protein, after SDS-PAGE (SDS-PAGE), albumen is transferred on the pvdf membrane, simultaneously with the demarcation of β-actin as the albumen applied sample amount.5% skim-milk room temperature sealing 1-2h, with corresponding one anti-(DNA-PKcs antibody (H-163) or c-myc antibody (9E10) or β-actin antibody (I-19)) room temperature effect 1-2h, develop behind two anti-(the anti-rabbit of horseradish peroxidase labelled goat, goat anti-mouse, the anti-goat-anti body of rabbit) room temperature effect 1h of corresponding horseradish peroxidase mark respectively.Detected result shows stable transfected cells strain HeLa-H1 (transfection PRKDC shown in Figure 1A and Figure 1B
SiRNAH1Expression vector), HeLa-H2 (transfection PRKDC
SiRNAH2), the expression of the DNA-PKcs of HeLa-H3 (transfection H3 expression vector) obviously suppressed (Figure 1A).Meanwhile C-Myc expresses and also obviously is suppressed.Figure 1B shows PRKDC for the quantitative analysis of protein expression inhibition degree
SiDNAH1The siRNA molecule PRKDC that expresses
SiRNAH1Effect the most remarkable, cause DNA-PKcs and c-Myc expression inhibiting horizontal exceeding 95%, PRKDC is described
SiRNAH1Best results.Among Figure 1A and Figure 1B, NC is the HeLa-NC cell of the transfection empty carrier that do not carry siDNA; H-1 is transfection PRKDC
SiRNAH1The HeLa-H1 cell of expression vector; H-2 is transfection PRKDC
SiRNAH2The HeLa-H2 cell of expression vector; H-3 is the HeLa-H3 cell of transfection H3 expression vector.Ordinate zou among Figure 1B " expression level " is the ratio with house-keeping gene β-actin protein content.
5. cell growth curve after gammairradiation or the cis-platinum effect
Transfection is not carried the HeLa cell (HeLa-NC) of the empty carrier of siDNA, transfection PRKDC
SiRNAH1The HeLa cell (HeLa-H1) of expression vector, transfection PRKDC
SiRNAH2The HeLa cell (HeLa-H2) of expression vector and the HeLa cell (HeLa-H3) of transfection H3 expression vector are with every hole 5 * 10
4Individual being inoculated in 24 orifice plates, in CO
2The conventional cultivation in the incubator treats behind the cell attachment that respectively with 2Gy or 4Gy dose irradiation cell, from irradiation, every kind of cell of each dosage group every day is got 3 holes digestion, and living cell counting is averaged, continuously 6d.Or, observe cell growth curve equally with 0.1 μ M cis-platinum effect.The radiosensitizing effect result is shown in Fig. 2 A and Fig. 2 B, show after the gammairradiation cell, cell growth is being suppressed in various degree all, the cell of transfection siRNA expression vector (HeLa-H1, HeLa-H2, HeLa-H3) is subjected to the propagation behind the irradiation to suppress more obvious, susceptibility is significantly higher than control cells (NC), and transfection PRKDC
SiRNAH1The radiosensitivity of the cell of expression vector (HeLa-H1) is the highest, and the propagation of 2Gy irradiation back cell almost completely is suppressed.
Strengthen the HeLa cell as shown in Figure 3, show transfection PRKDC the susceptibility result of cis-platinum
SiRNAH1The HeLa cell of expression vector significantly increases the susceptibility of chemotherapeutics cis-platinum, and is especially more obvious to the enhancement effect of 0.1 μ M low dosage cis-platinum.
6.SEAP detection system detects the c-myc transcriptional activity
Plasmid P
TAL-SEAP (negative control, Clontech company) is transfection HeLa-NC respectively, HeLa-H1, HeLa-H2 and HeLa-H3 cell; Plasmid P
SEAG2-SEAP (positive control, Clontech company) is transfection HeLa-NC respectively, HeLa-H1, HeLa-H2 and HeLa-H3 cell; Plasmid P
MYC-SEAP (Clontech company) is transfection HeLa-NC, HeLa-H1, HeLa-H2 and HeLa-H3 cell respectively.And after transfection 24,48h collects the nutrient solution supernatant, detects the c-myc activity with the EscAPeSEAP test kit, and working method is referring to specification sheets.Each test is established 3 and is repeated sample, and test repeats 3 times.Among Fig. 4, ordinate zou " c-myc activity " is plasmid P
MYCC-myc activity (the OD of-SEAP transfectional cell
MYC) and plasmid P
TALC-myc activity (the O of-SEAP transfectional cell
DTAL) difference and plasmid P
SEAG2C-myc activity (the OD of-SEAP
SEAG2) ratio (OD
MYC-OD
TAL/ OD
SEAG2).The activity level result that c-Myc regulation and control reporter gene SEPA expresses shows transfection PRKDC
SiRNAH1The transcriptional activity of the c-Myc of the HeLa cell of expression vector lower (Fig. 4).
7. the HeLa cell inoculation nude mice tumor growth analyses of transfection siRNA expression vector
Nude mice is divided into 3 groups, 5 every group, every nude inoculation 2 * 10
6Individual cell is observed the tumor growth situation, and since 9d, every 3d measures a gross tumor volume.The result shows transfection PRKDC as shown in Figure 5
SiRNAH1The HeLa cell (HeLa-H1) of expression vector inoculation nude mice becomes after the knurl growth of tumor slow down than control group is obvious (mean value that data are every group of 5 nude mice gross tumor volumes).
Sequence table
<160>12
<210>1
<211>19
<212>RNA
＜213〉artificial sequence
<220>
<223>
<400>1
gggcgcuaau?cguacugaa 19
<210>2
<211>19
<212>RNA
＜213〉artificial sequence
<220>
<223>
<400>2
uucaguacga?uuagcgccc 19
<210>3
<211>19
<212>RNA
＜213〉artificial sequence
<220>
<223>
<400>3
cauucgugcc?caagaacca 19
<210>4
<211>19
<212>RNA
＜213〉artificial sequence
<220>
<223>
<400>4
ugguucuugg?gcacgaaug 19
<210>5
<211>47
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>5
gggcgctaat?cgtactgaat?tcaagagatt?cagtacgatt?agcgccc 47
<210>6
<211>47
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>6
cccgcgatta?gcatgactta?agttctctaa?gtcatgctaa?tcgcggg 47
<210>7
<211>47
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>7
cattcgtgcc?caagaaccat?tcaagagatg?gttcttgggc?acgaatg 47
<210>8
<211>47
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>8
gtaagcacgg?gttcttggta?agttctctac?caagaacccg?tgcttac 47
<210>9
<211>64
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>9
gatcccgggc?gctaatcgta?ctgaattcaa?gagattcagt?acgattagcg?cccttttttg 60
gaaa 64
<210>10
<211>64
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>10
ggcccgcgat?tagcatgact?taagttctct?aagtcatgct?aatcgcggga?aaaaaccttt 60
tcga 64
<210>11
<211>64
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>11
gatccccatt?cgtgcccaag?aaccattcaa?gagatggttc?ttgggcacga?atgttttttg 60
gaaa 64
<210>12
<211>64
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>12
gggtaagcac?gggttcttgg?taagttctct?accaagaacc?cgtgcttaca?aaaaaccttt 60
tcga 64
Claims (10)
1, suppressing the siRNA molecule of DNA-PKcs protein expression, is following 1) and 2) at least one double-stranded RNA sequence:
1) positive-sense strand has the nucleotide sequence of sequence 1 in the sequence table, and antisense strand has the nucleotide sequence of sequence 2 in the sequence table;
2) positive-sense strand has the nucleotide sequence of sequence 3 in the sequence table, and antisense strand has the nucleotide sequence of sequence 4 in the sequence table.
2, the encoding gene of the siRNA molecule of the described inhibition of claim 1 DNA-PKcs protein expression.
3, gene according to claim 2 is characterized in that: the encoding gene of the siRNA molecule of described inhibition DNA-PKcs protein expression has following 1) and 2) at least one double chain nucleotide sequence:
1) sense strand have the nucleotide sequence of sequence 5 in the sequence table or under the rigorous condition of height can with SEQ ID №: the nucleotide sequence of the 5 dna sequence dnas hybridization that limit; Antisense strand have the nucleotide sequence of sequence 6 in the sequence table or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 6 dna sequence dnas hybridization that limit;
2) sense strand have the nucleotide sequence of sequence 7 in the sequence table or under the rigorous condition of height can with SEQ ID №: the nucleotide sequence of the 7 dna sequence dnas hybridization that limit; Antisense strand have the nucleotide sequence of sequence 8 in the sequence table or under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 8 dna sequence dnas hybridization that limit.
4, gene according to claim 3, it is characterized in that: under the rigorous condition of height can with SEQ ID №: the nucleotides sequence of the 5 dna sequence dnas hybridization that limit is classified SEQ ID № as: 9, can with SEQ ID № in the sequence table: the nucleotides sequence of the 6 dna sequence dnas hybridization that limit is classified SEQ ID № as: 10.
5, gene according to claim 3, it is characterized in that: under the rigorous condition of height can with SEQ ID №: the nucleotides sequence of the 7 dna sequence dnas hybridization that limit is classified SEQ ID № as: 11, can with SEQ ID № in the sequence table: the nucleotides sequence of the 8 dna sequence dnas hybridization that limit is classified SEQ ID № as: 12.
6, the expression vector that contains the siRNA molecule encoding gene of arbitrary described inhibition DNA-PKcs protein expression among the claim 2-5.
7, the clone that contains the siRNA molecule encoding gene of arbitrary described inhibition DNA-PKcs protein expression among the claim 2-5.
8, the host bacterium that contains the siRNA molecule encoding gene of arbitrary described inhibition DNA-PKcs protein expression among the claim 2-5.
9, be the tumour medicine of activeconstituents with the siRNA molecule of the described inhibition of claim 1 DNA-PKcs protein expression or the expression vector that carries the siRNA molecule encoding gene of described inhibition DNA-PKcs protein expression.
10, be radiation sensitization and/or the chemotherapy sensitizing medicine and the direct anticancer propagation of activeconstituents with the siRNA molecule of the described inhibition of claim 1 DNA-PKcs protein expression or the expression vector that carries the siRNA molecule encoding gene of described inhibition DNA-PKcs protein expression.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004101025680A CN100496614C (en) | 2004-12-27 | 2004-12-27 | Small interference RNA molecule for restraining protein expression of DNA-PKCS, and encoding gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004101025680A CN100496614C (en) | 2004-12-27 | 2004-12-27 | Small interference RNA molecule for restraining protein expression of DNA-PKCS, and encoding gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1796555A true CN1796555A (en) | 2006-07-05 |
| CN100496614C CN100496614C (en) | 2009-06-10 |
Family
ID=36817873
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2004101025680A Expired - Fee Related CN100496614C (en) | 2004-12-27 | 2004-12-27 | Small interference RNA molecule for restraining protein expression of DNA-PKCS, and encoding gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100496614C (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112083171A (en) * | 2020-09-07 | 2020-12-15 | 中国人民解放军总医院第八医学中心 | Ku70 protein T455 site phosphorylation inhibitor and application thereof |
| CN115317501A (en) * | 2021-12-24 | 2022-11-11 | 南通大学附属医院 | Application of small interfering RNA for knocking down ripk1 in preparation of PGCCs (PGCCs) inhibitor |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004043406A2 (en) * | 2002-11-12 | 2004-05-27 | The Johns Hopkins University | ENGINEERED RNAi ADENOVIRUS SILENCING EXPRESSION (ERASE) OF DNA REPAIR PROTEINS |
-
2004
- 2004-12-27 CN CNB2004101025680A patent/CN100496614C/en not_active Expired - Fee Related
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112083171A (en) * | 2020-09-07 | 2020-12-15 | 中国人民解放军总医院第八医学中心 | Ku70 protein T455 site phosphorylation inhibitor and application thereof |
| CN115317501A (en) * | 2021-12-24 | 2022-11-11 | 南通大学附属医院 | Application of small interfering RNA for knocking down ripk1 in preparation of PGCCs (PGCCs) inhibitor |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100496614C (en) | 2009-06-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1240439C (en) | Genetic switch medicine for treating tumor | |
| Zhang et al. | MicroRNAs of the miR-17~ 92 family maintain adipose tissue macrophage homeostasis by sustaining IL-10 expression | |
| Lam et al. | Leptin induces CD40 expression through the activation of Akt in murine dendritic cells | |
| CN1860228A (en) | Staple type oligonucleotide and drug comprising the same | |
| CN1346363A (en) | The novel antisense-oligos with better stability and antisense effect | |
| CN1718194A (en) | Oligonucleotide medicine for treating myophagism | |
| CN1701077A (en) | Use of antisense oligonucleotides to inhibit the expression of Akt-1 | |
| CN1796555A (en) | Small interference RNA molecule for restraining protein expression of DNA-PKCS, and encoding gene and application | |
| KR101325186B1 (en) | An Anticancer Agent Comprising Double-stranded miRNAs as an Active Ingredient | |
| CN1793359A (en) | HBV specificity interference target point gene and its siRNA and application in anti HBV infecting thereof | |
| CN1249243C (en) | Targetted liver cancer AFP gene siRNAs expression carrier and its constructing method and use | |
| CN1740194A (en) | A kind of tumor correlated albumen and encoding gene thereof and application | |
| CN1882702A (en) | Synthetic lethal screen using RNA interference | |
| CN101068927A (en) | Methods and compositions to inhibit p2x7 receptor expression | |
| CN1324136C (en) | SiRNA double chain for inhibiting bc 1-2 gen expression and use | |
| CN1884526A (en) | RNA interference method for specificly and high effectively treating CSFV infection and biological formulation | |
| CN1800387A (en) | Small interfering RNA for suppressing multiple effect growth factor expression and its uses | |
| CN1427008A (en) | Method of designing and selecting natural siRNA as gene medicine and medicine formulation | |
| CN1233831C (en) | SiRNA and expression plasmid for inhibiting human bc1-2 gene expression and their use for preparing medicine | |
| CN1727477A (en) | siRNA for restraining expression and proliferation of tumor and leukaemia cell VEGE and application | |
| CN1880332A (en) | siRNA double-chain for suppressing bc1-2 gene expression | |
| CN1948484A (en) | siRNA for inhibiting human hPEBP4 gene expression and its application | |
| CN1206242C (en) | Anti-angiogenesis and anti-cancer function of angiogenin combined with nucleotide | |
| CN1277836C (en) | Human angiogenin antisense oligonucleotide and medicine combination | |
| CN1244591C (en) | mRNA antisense nucleic acid with inhibited VEGF expression and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20090610 Termination date: 20191227 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |