CN1864747A - Method for preparing active carrier vaccine of avian Chlamydia psittaci - Google Patents
Method for preparing active carrier vaccine of avian Chlamydia psittaci Download PDFInfo
- Publication number
- CN1864747A CN1864747A CN 200610073453 CN200610073453A CN1864747A CN 1864747 A CN1864747 A CN 1864747A CN 200610073453 CN200610073453 CN 200610073453 CN 200610073453 A CN200610073453 A CN 200610073453A CN 1864747 A CN1864747 A CN 1864747A
- Authority
- CN
- China
- Prior art keywords
- chlamydia psittaci
- avian
- plasmid
- add
- vaccine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention relates to a process for preparing vaccine for fowl, which consists of isolating C.psittaci from fowl bodies suffering Chlamydia diseases, expanding to Major Outer Membraxle Pr0teln (MOMP) through PCR method, cloning in pMD-simple T vector, cutting destination gene and inserting into pshuttle-CMV vectors, extracting plasmid, linearizing and transferring into BJ5183 competence cell for isogenesis recombination to obtain recombinant adenoviridae plasmid, transforming recombinant adenovirus plasmid to DH5 alpha bacterium, extracting plasmid transfection AD-293 cells to obtain recombinant adenovirus, finally charging protective agent for freeze-drying.
Description
Technical field
The present invention relates to a kind of preparation method and vaccine thereof of epiornitic Seedling.The present invention relates to the preparation method of active carrier vaccine of avian Chlamydia psittaci exactly, and vaccine.
Background technology
(Avian Chlamydiosis AC) is a kind of contagious disease that is caused by psittacosis preferendum chlamydia (Chlamydophila psittaci) infected poultry to avian chlamydiosis.Avian chlamydiosis is called psittacosis again at present.Afterwards, " ornithosis " speech was introduced into, and was mainly used to distinguish the AC that Psittacula alexandri fasciata birds in addition infect.In fact, can cross infection from Psittacula alexandri fasciata and the isolated pathogenic chlamydia strain of non-Psittacula alexandri fasciata birds, cause same disease.
Chlamydia psittaci is the endotrophic microorganism of a kind of strictness, and research at present clearly has 8 serotypes, and wherein at least 6 serotypes (A, B, C, D, E, F) infect most of pet birds, poultry, wild bird.It is human to it should be noted that these fowl serotypes infect by birds.In earlier 1900s, popularly enjoy Psittacula alexandri fasciata, the Psittacula alexandri fasciata bird infects to infect behind the chlamydia psittaci gives the person of enjoying, and the result causes that people's chlamydia is popular, in America, Europe And Africa has hundreds of people's death, causes very big fear at that time.
As everyone knows, vaccine is one of effective method of prevent disease, yet, up to now, also there is not fowl chlamydia commercialization vaccine to prevent avian chlamydiosis both at home and abroad.And have the chlamydia inactivated vaccine of better immune effect can not be used to prevent the chlamydiosis of birds, thereby have to abandon to mammal.
Once there was document to disclose fowl source chlamydia psittaci dna vaccination (nucleic acid vaccine) (referring to D vanrompay, E.cox, G.volckaert et al.Turkeys are protected from infection with Chlamydiapsittaci by plasmid DNA vaccination against the major outer membrane protein.ClinExp Immunol, 1999,118:49-55) and fowl source chlamydia psittaci subunit vaccine (referring to: what really, Zhu Hong, Wang Chuanwu. " chlamydia psittaci recombinant major outer membrane protein immunity broiler effect observation " " China Agricultural University's journal " 2004,1:49-52).But dna vaccination is expelled to back degraded easily in the animal body.In addition, need possess a large amount of carriers during because of the preparation dna vaccination, so the cost height of its preparation, and unstable.And subunit vaccine needs the expression a large amount of to the MOMP protein requirement in process of production, extract expressing protein then, purification concentrates the back immune animal, and this process process can be carried out at laboratory, but in actual production, be difficult to use, because the cost of preparation is too high.In addition, subunit vaccine is similar to inactivated vaccine, and mainly based on humoral immunization, and chlamydia infection mainly is intracellular infection when stimulating body to produce immunity, and cellular immunization should be brought into play main effect, and adenovirus vaccine has but possessed the characteristics of this respect.
Therefore, research is suitable for preventing the efficient vaccine of avian chlamydiosis imperative.
Summary of the invention
The purpose of this invention is to provide a kind of preparation method of new fowl source chlamydia psittaci vaccine and the vaccine of preparation in this way.This vaccine is an active carrier vaccine of avian Chlamydia psittaci, and it can overcome the some shortcomings of prior art, can effectively improve the bird immunity function, and the cost of its preparation is low than prior art, and preparation method is more simple.
Preparation method of the present invention is; in the fowl body of suffering from avian chlamydiosis, isolate chlamydia psittaci; by the PCR method adventitia master protein gene (MOMP) that increases; it is cloned in pMD-simple T carrier; be inserted in the pshuttle-CMV carrier after downcutting genes of interest; carry out homologous recombination acquisition recombinant adenovirus plasmid in the BJ5183 competent cell with changing over to after its linearisation after extracting plasmid again; recombinant adenovirus plasmid is converted into DH5 α bacterium; extract plasmid transfection AD-293 cell and obtain recombinant adenovirus, add protective agent again and carry out lyophilizing.
( MOMP ) ：ATGAAAAAACTCTTGAAATCGGCATTATTGTTTGCCGCTACGGGTTCCGCTCTCTCCTTACAAGCCTTGCCTGTAGGGAACCCAGCTGAACCAAGTTTATTAATCGATGGCACTATGTGGGAAGGTGCTTCAGGTGATCCTTGCGATCCTTGCTCTACTTGGTGTGATGCTATCAGCATCCGCGCAGGATACTACGGAGATTATGTTTTCGATCGTGTATTAAAAGTTGATGTGAATAAAACTATCACCGGCATGGGTGCAGTTCCTACAGGAACCGCAGCAGCTAATTACAAAACTCCTACGGATAGACCCAACATCGCTTACGGCAAACACTTACAAGACGCCGAATGGTTCACCAATGCAGCTTTCCTCGCATTGAATATCTGGGATCGCTTTGATATTTTCTGCACATTAGGCGCTTCTAATGGGTACTTCAAAGCTAGTTCTGCGGCATTCAACCTCGTTGGTTTGATTGGTGTTAAAGGATCCTCCATAGCAGCTGATCAGCTTCCCAATGTAGGCATCACTCAAGGAATCGTTGAATTTTATACAGATACAACATTCTCTTGGAGTGTAGGTGCACGCGGAGCTTTATGGGAGTGTGGTTGTGCGACTTTAGGAGCAGAGTTCCAATACGCTCAGTCTAATCCTAAAATTGAAATGTTGAATGTAGTCTCCAGCCCAGCACAATTTGTGGTTCACAAGCCTAGAGGATACAAGGGAACAGCATTTCCTTTACCTCTAACAGCTGGTACTGATCAGGCAACTGACACTAAGTCGGCTACAATTAAATACCACGAATGGCAAGTTGGTTTAGCGCTCTCTTATCGATTGAACATGCTTGTTCCTTACATTGGCGTAAACTGGTCACGAGCAACTTTTGATGCTGACGCTATCCGCATCGCTCAACCTAAATTAGCTGCTGCTGTGTTAAACTTGACCACATGGAACCCAACCCTTTTAGGAGAAGCTACAGCTTTAGATACTAGCAACAAATTCGCTGACTTCTTGCAAATTGCTTCGATTCAGATCAACAAAATGAAGTCTAGAAAAGCTTGTGGTGTAGCTGTTGGTGCAACGTTAATCGACGCTGACAAATGGTCAATCACTGGTGAAGCACGCTTAATCAATGAAAGAGCCGCTCACATGAATGCTCAATTCAGATTCTAA。
In preparation process of the present invention, the preparation method of fowl source chlamydia psittaci adventitia master protein gene be: the chick embryo yolk sac 0.3～0.5cm that is taken at inoculation fowl source chlamydia psittaci rule death after 72 hours
3, put into mortar and grind, add 1ml TE buffer, adding 20%SDS again is 1% to final concentration, mixing adds E.C. 3.4.21.64 again to final concentration 100～200ug/ml, puts into 60 ℃ of water-bath 30min behind the mixing.Take out, change 12～24h in 37 ℃ of water-baths over to, during jolting frequently for several times, add isopyknic balance phenol again, the reversing mixing, the centrifugal 10min of 7500rpm under 4 ℃ of conditions draws the upper strata water, add isopyknic phenol: chloroform: the mixed liquor of isoamyl alcohol=25: 24: 1, behind mixing, draw the upper strata water under 4 ℃ of conditions, add the dehydrated alcohol of 2.5 times of volume pre-coolings-20 ℃ at the gained aqueous phase, carry out centrifugation again, dissolve with TE or distilled water precipitate dry back under naturalness;
In the preparation process of the present invention, add 10 * PCR buffer, 5 μ L in the PCR reaction tube, dNTP 4 μ L add each 1 μ L of upstream and downstream primer, template 6 μ L, Pyrobest again
TMDNA Polymerase high-fidelity enzyme 0.25 μ L and pure water 32.75 μ L form 50 μ L systems, and reaction condition is: first 95 ℃ of degeneration 5min, 94 ℃ of 1.5min then, 49 ℃ of 1.5min, 72 ℃ of 2min, totally 40 circulations.
Prepare active carrier vaccine of avian Chlamydia psittaci by above method.
The prepared vaccine of the present invention has tangible immune effect to birds, and does not degrade after entering in the animal body, and the present invention can make the main effect of cellular immunization performance, so its immune effect will be better than existing technology.In addition, do not need a large amount of carriers when the present invention prepares vaccine, its preparation cost also will be lower than prior art.
Description of drawings
Fig. 1 is for the reorganization plasmid enzyme restriction is identified, PCR identifies figure (M:DL2000marker).Wherein:
1, the recombiant plasmid enzyme action is identified product
2, negative control;
3, PCR identifies product
Fig. 2 identifies (M:DL2000) for the recombinant adenovirus target gene PCR.Wherein:
1, genes of interest
2, negative control
The specific embodiment
1) extraction of genomic DNA
A) be taken at the chick embryo yolk sac 0.3～0.5cm that inoculates the death after 72 hours of fowl chlamydia
3, put into mortar and grind, add 1ml TE (Tris-Cl and EDTA) buffer, change in the 1.5mlEp pipe.
B) adding 20%SDS is 1% to final concentration, and mixing adds E.C. 3.4.21.64 again to final concentration 100～200ug/ml, puts into 60 ℃ of water-bath 30min behind the mixing, makes chlamydial adventitia destroyed, and chlamydial genome is discharged.Then system is taken out, change 12～24h in 37 ℃ of water-baths over to, jolting frequently for several times in this course.
C) add isopyknic balance phenol, the reversing mixing, the centrifugal 10min of 7500rpm under 4 ℃ of conditions draws the upper strata water, repeats extracting once.Peek time water adds isopyknic chloroform: isoamyl alcohol (24: 1), the reversing mixing, the centrifugal 10min of 7500rpm under 4 ℃ of conditions is separated chlamydial genome and destructive chlamydia adventitia so that after a while extract the chlamydia adventitia.Extract the upper strata water then, add 2.5 times of volumes and be chilled to-20 ℃ dehydrated alcohol in advance, the 12000rpm centrifugal treating was told precipitate after 10 minutes, and dissolve with TE or distilled water drier back under naturalness, puts-20 ℃ or 4 ℃ of preservations.
2) amplification of MOMP gene
Add 10 * PCR buffer, 5 μ L in 200 μ L PCR reaction tubes, dNTP 4 μ L get each 1 μ L of the upstream and downstream primer shown in the table 1, template 6 μ L, Pyrobest
TMDNA Polymerase high-fidelity enzyme 0.25 μ L, pure water 32.75 μ L form 50 μ L systems.Reaction condition is as follows: carry out degenerative treatments 5min at 95 ℃, and then place 1.5min at 94 ℃, place 1.5min for 49 ℃, place 2min for 72 ℃, repeat 94 ℃ again and place 1.5min, and down-stream, carry out 35 circulations altogether, extend 10min at 72 ℃ for the last time.
Table 1
| Primer | Direction | Sequence 5 ' → 3 ' | Position * |
| CHL-M1 | Forward | 5’-ATG AAA AAA CTC TTG AAA TCG-3’ | 1-21 |
| CHL-M2 | Oppositely | 5’-TTA GAA TCT GAA TTG AGC ATTC-3’ | 1149-1170 |
The position of the corresponding primer of expression in fowl chlamydia strain outer membrane protein gene reading frame between * above-mentioned digital block.
3) the MOMP gene reclaims
Utilize commercial DNA to reclaim test kit and reclaim MOMP.Used test kit is the recovery test kit that precious biological engineering (Dalian) company limited is produced among the present invention.
4) clone of MOMP gene
The PCR product is connected to the pMD18-T carrier, through conversion, coated plate, put 37 ℃ of incubated overnight, picking colony is identified, send the order-checking of positive bacteria liquid, according to sequencing result, (forward primer adds restricted enzyme BgL II respectively to design a restriction enzyme site on original primer, downstream primer adds restricted enzyme Sa I), carry out pcr amplification then, amplified production is connected to pMD18-T simple carrier, change in the JM109 competence antibacterial, coat the LB culture medium flat plate that contains 50 μ g/ml ampicillin, put 37 ℃ of incubators and cultivate 12-16h.The single bacterium colony of picking carries out the enzyme action evaluation then, PCR identifies.
5) MOMP gene and pshuttle-CMV carrier is connected
With BgL II and SaL I positive pMD18-T simple is carried out double digestion, reclaim the purpose fragment then.Use T4 DNA
-Ligase is connected in the pshuttle-CMV carrier of using BgL II and SaL I double digestion, purification, recovery, change in the DH5 α competent cell, coat the LB culture medium flat plate that contains 50 μ g/ml kanamycin, put 37 ℃ of incubator incubated overnight, the single bacterium colony of picking, increase bacterium and cultivate, extract plasmid (commercial plasmid extraction kit), carry out enzyme action evaluation and PCR then and identify.
Enzyme action qualification process: the distilled water that in the reaction tube of 200 μ L, adds 4 μ L, the plasmid that 4 μ L extract, 10 times of spissated H buffer of 1 μ L (commercialization), the BgL II (commercialization) of 0.5 μ L and the SaL I (commercialization) of 0.5 μ L, enzyme action 4h in 37 ℃ of water-baths.
PCR identifies: add 10 * PCR buffer, 5 μ L in 200 μ L PCR reaction tubes, dNTP 4 μ L, each 1 μ L of upstream and downstream primer, template 6 μ L, Pyrobest
TMDNA Polymerase high-fidelity enzyme 0.25 μ L, pure water 32.75 μ L form 50 μ L systems.Reaction condition is as follows: 94 ℃ of 1.5min, and 49 ℃ of 1.5min, 72 ℃ of 2min, totally 35 circulations, last 72 ℃ are extended 10min.
Result:, identify and the PCR evaluation that by enzyme action the illustration purpose gene correctly is inserted in the pMD18-T carrier referring to accompanying drawing 1.
6) homologous recombination construction recombinant adenovirus plasmid in the antibacterial
Will be through the positive pshuttle-CMV plasmid 10 μ L that enzyme action is identified and PCR identifies, at 2500V, 200 Ω, under the condition of 25 μ F, electroporation cotransformation 80 μ L BJ5183 competent cells, with the LB culture medium flat plate screening that contains 50 μ g/ml kanamycin, 8 clones of picking behind 37 ℃ of incubators cultivation 16-20h extract plasmid and carry out the electrophoresis evaluation, and recon is converted into DH5 α bacterium, extract plasmid, further carry out enzyme action and identify.
7) recombinant adenovirus plasmid is packed in 293 cells
Extract the about 30ug of recombinant adenovirus plasmid, join in the DMEM culture medium of 1.5ml serum-free, gently mixing.The liposome of getting 60ul joins in the DMEM culture medium of 1.5ml serum-free, mixing, and room temperature is placed 5min.The recombinant adenovirus that dilution is good joins in the good liposome of dilution, and room temperature is placed 20min.Get 2ml liposome-DNA mixture and join in 24 hours longly in 95% 293 cells, shake the cell bottle gently.Place 37 ℃ to contain 5%CO in the cell bottle
2In the incubator 6 hours, add the DMEM culture medium that 6ml contains hyclone then, cultivated 3-7 days.
8) PCR of genes of interest identifies
293 cells of the pathological changes after 3 generations of learning from else's experience, freeze repeatedly molten 3 times, get 1ml freeze thawing liquid, add the E.C. 3.4.21.64 of 10%SDS50 μ l and 3 μ l, 60 ℃ of effect 30min, put 37 ℃ of water-bath effect 2h then, add isopyknic balance phenol, reversing mixing, the centrifugal 10min of 7500rpm under 4 ℃ of conditions, draw the upper strata water, repeat extracting once.Get the upper strata water, add isopyknic chloroform: isoamyl alcohol (24: 1), reversing mixing, the centrifugal 10min of 7500rpm under 4 ℃ of conditions.Get the upper strata water, add the dehydrated alcohol of 2.5 times of volume pre-coolings, the centrifugal 10min of 12000rpm.Be deposited under the naturalness and dissolve with TE or distilled water after the drying, put one 20 ℃ or 4 ℃ of preservations.With CHL-M1:5 '-ATG AAA AAA CTC TTG AAA TCG-3, CHL-M2:5 '-TTA GAA TCT GAA TTG AGC ATTC-3 primer MOMP that increases, amplification condition: 94 ℃ of pre-degeneration 5min, 94 ℃ of degeneration 30s, 49 ℃ of annealing 1min, 72 ℃ are extended 2min, 35 circulations, and last 72 ℃ are extended 10min.Whether detect the pathological changes that causes by the recombinant adenovirus that contains by the MOMP genes of interest.
Testing result: referring to accompanying drawing 2.Identify figure by PCR, the illustration purpose gene correctly is inserted in the adenovirus vector.
9) evaluation of recombinant adenovirus destination gene expression product
The utilization indirect immunofluorescence detects: the microscope slide of sterilization is placed 6 porocyte culture plates, insert 293 cells, treat to insert when cell covers with 90% area recombinant adenovirus, be cultured to 90% cytopathy, take out microscope slide, fix (20 ℃ 20min), are done negative control simultaneously with methanol.The microscope slide that fixes adds the chlamydia positive serum, and 37 ℃ act on 2 hours, with PBS liquid rinsing 3 times, each 5min, adding is anti-with fluorescein-labeled two, hatches 30 minutes for 37 ℃, use PBS liquid rinsing 3 times then, each 5min treats to observe under the rearmounted fluorescence microscope of natural drying.
10) recombinant adenovirus titer determination
Recombinant adenovirus went down to posterity through number generation, treated that the virus infected cell time carries out the mensuration of malicious valency after stable.Get 293 cells of pathological changes, multigelation 3 times carries out 10 times of serial dilutions in the culture fluid of 1ml volume, with 10 of dilution
-5-10
-9Virion adds the 6 orifice plate Tissue Culture Plates that covered with 90%293 cells respectively, and negative control is stayed in last hole.Cultivate 2h for 37 ℃, the surface covers the DMEM nutritional solution that contains 1.25% agarose gently then, cultivates at 37 ℃ of cell culture incubators of 5%CO2, and observe every day, cultivated 6-7 days.
11) laboratory animal immunity
Buy 40 of SPF chickens, the sampling blood sampling detects chlamydial antibody and egg drop syndrome antibody, carries out the recombinant adenovirus immunity then, 10 of muscle immunity, and subcutaneous immune 10, every 0.2ml/ is only.The normal saline of matched group injection 0.9%.Before the immunity SPF chicken of being bought is carried out chlamydial antibody and detect and egg drop syndrome, the result is all negative.Fowl chlamydia MOMP detection of antibodies was carried out on 8th in immunity back, and the antibody horizontal of muscle immunity reaches 1: 16, the antibody horizontal of indivedual chickens even surpassed 1: 64.And the antibody horizontal of subcutaneous immune chicken reaches 1: 16, and antibody horizontal is more neat, and T lymphocyte testing result shows that recombinant adenovirus stimulates body to produce cellular immunization.
That the immune mechanism of this vaccine and chlamydia are invaded animal body mechanism is consistent, possessed subunit vaccine the effect that can not possess.Simultaneously, this Seedling preparation cost is low, and immunizing dose is few, good immune effect, and stablize, do not degrade.
Claims (5)
1; the preparation method of active carrier vaccine of avian Chlamydia psittaci; it is characterized in that in the fowl body of suffering from avian chlamydiosis, isolating chlamydia psittaci; by the PCR method adventitia master protein gene (MOMP) that increases; it is cloned in pMD-simple T carrier; be inserted in the pshuttle-CMV carrier after downcutting genes of interest; carry out homologous recombination acquisition recombinant adenovirus plasmid in the BJ5183 competent cell with changing over to after its linearisation after extracting plasmid again; recombinant adenovirus plasmid is converted into DH5 α bacterium; extract plasmid transfection AD-293 cell and obtain recombinant adenovirus, add protective agent again and carry out lyophilizing.
2, the preparation method of active carrier vaccine of avian Chlamydia psittaci according to claim 1, the feature of the preparation method of fowl source chlamydia psittaci adventitia master protein gene is: the chick embryo yolk sac 0.3～0.5cm that is taken at the rule death after 72 hours of inoculation fowl source chlamydia psittaci
3, put into mortar and grind, add the 1mlTE buffer, adding 20%SDS again is 1% to final concentration, mixing adds E.C. 3.4.21.64 again to final concentration 100～200ug/ml, puts into 60 ℃ of water-bath 30min behind the mixing.Take out, change 12～24h in 37 ℃ of water-baths over to, during jolting frequently for several times, add isopyknic balance phenol again, the reversing mixing, the centrifugal 10min of 7500rpm under 4 ℃ of conditions draws the upper strata water, add isopyknic phenol: chloroform: the mixed liquor of isoamyl alcohol=25: 24: 1, behind mixing, draw the upper strata water under 4 ℃ of conditions, add the dehydrated alcohol of 2.5 times of volume pre-coolings-20 ℃ at the gained aqueous phase, carry out centrifugation again, dissolve with TE or distilled water precipitate dry back under naturalness;
3, the preparation method of active carrier vaccine of avian Chlamydia psittaci according to claim 1 and 2 is characterized in that adding 10 * PCR buffer, 5 μ L in the PCR reaction tube, dNTP 4 μ L add each 1 μ L of upstream and downstream primer, template 6 μ L, Pyrobest again
TMDNA Polymerase high-fidelity enzyme 0.25 μ L and pure water 32.75 μ L form 50 μ L systems, and reaction condition is: first 95 ℃ of degeneration 5min, 94 ℃ of 1.5min then, 49 ℃ of 1.5min, 72 ℃ of 2min, totally 40 circulations.
4, the active carrier vaccine of avian Chlamydia psittaci for preparing with the described either party's method of claim 1 to 3.
5, fowl source chlamydia psittaci adventitia master protein gene (MOMP) sequence in the active carrier vaccine of avian Chlamydia psittaci according to claim 4 is:
ATGAAAAAACTCTTGAAATCGGCATTATTGTTTGCCGCTACGGGTTCCGCTCTCTCCTTACAAGCCTTG
CCTGTAGGGAACCCAGCTGAACCAAGTTTATTAATCGATGGCACTATGTGGGAAGGTGCTTCAGGTGA
TCCTTGCGATCCTTGCTCTACTTGGTGTGATGCTATCAGCATCCGCGCAGGATACTACGGAGATTATGTT
TTCGATCGTGTATTAAAAGTTGATGTGAATAAAACTATCACCGGCATGGGTGCAGTTCCTACAGGAAC
CGCAGCAGCTAATTACAAAACTCCTACGGATAGACCCAACATCGCTTACGGCAAACACTTACAAGAC
GCCGAATGGTTCACCAATGCAGCTTTCCTCGCATTGAATATCTGGGATCGCTTTGATATTTTCTGCACAT
TAGGCGCTTCTAATGGGTACTTCAAAGCTAGTTCTGCGGCATTCAACCTCGTTGGTTTGATTGGTGTTA
AAGGATCCTCCATAGCAGCTGATCAGCTTCCCAATGTAGGCATCACTCAAGGAATCGTTGAATTTTATA
CAGATACAACATTCTCTTGGAGTGTAGGTGCACGCGGAGCTTTATGGGAGTGTGGTTGTGCGACTTTA
GGAGCAGAGTTCCAATACGCTCAGTCTAATCCTAAAATTGAAATGTTGAATGTAGTCTCCAGCCCAGC
ACAATTTGTGGTTCACAAGCCTAGAGGATACAAGGGAACAGCATTTCCTTTACCTCTAACAGCTGGTA
CTGATCAGGCAACTGACACTAAGTCGGCTACAATTAAATACCACGAATGGCAAGTTGGTTTAGCGCTC
TCTTATCGATTGAACATGCTTGTTCCTTACATTGGCGTAAACTGGTCACGAGCAACTTTTGATGCTGAC
GCTATCCGCATCGCTCAACCTAAATTAGCTGCTGCTGTGTTAAACTTGACCACATGGAACCCAACCCTT
TTAGGAGAAGCTACAGCTTTAGATACTAGCAACAAATTCGCTGACTTCTTGCAAATTGCTTCGATTCAG
ATCAACAAAATGAAGTCTAGAAAAGCTTGTGGTGTAGCTGTTGGTGCAACGTTAATCGACGCTGACA
AATGGTCAATCACTGGTGAAGCACGCTTAATCAATGAAAGAGCCGCTCACATGAATGCTCAATTCAGA
TTCTAA。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200610073453 CN1864747A (en) | 2006-03-27 | 2006-03-27 | Method for preparing active carrier vaccine of avian Chlamydia psittaci |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200610073453 CN1864747A (en) | 2006-03-27 | 2006-03-27 | Method for preparing active carrier vaccine of avian Chlamydia psittaci |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1864747A true CN1864747A (en) | 2006-11-22 |
Family
ID=37423998
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200610073453 Pending CN1864747A (en) | 2006-03-27 | 2006-03-27 | Method for preparing active carrier vaccine of avian Chlamydia psittaci |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1864747A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101579521A (en) * | 2009-05-13 | 2009-11-18 | 中国农业科学院兰州兽医研究所 | Abortus Chlamydia psittaci vaccine and preparation method thereof |
| CN104131020A (en) * | 2014-08-01 | 2014-11-05 | 中国农业科学院兰州兽医研究所 | Coexpression vector of Chlamydophila abortus and Chlamydophila psittaci protective antigen MOMP and MIP, construction and expression method thereof |
-
2006
- 2006-03-27 CN CN 200610073453 patent/CN1864747A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101579521A (en) * | 2009-05-13 | 2009-11-18 | 中国农业科学院兰州兽医研究所 | Abortus Chlamydia psittaci vaccine and preparation method thereof |
| CN104131020A (en) * | 2014-08-01 | 2014-11-05 | 中国农业科学院兰州兽医研究所 | Coexpression vector of Chlamydophila abortus and Chlamydophila psittaci protective antigen MOMP and MIP, construction and expression method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Alexander et al. | A long-term study of the pathogenesis of infection of fowls with three strains of avian infectious bronchitis virus | |
| CN101514334B (en) | Chicken infectivity bronchitis virus attenuated vaccine strain and application thereof | |
| CN105985966B (en) | Gene VII type newcastle disease virus strain, vaccine composition, preparation method and application thereof | |
| WO2021103421A1 (en) | Gene vii type newcastle disease virus attenuated strain and use thereof | |
| CN112500458B (en) | Novel variant subunit vaccine of chicken infectious bursal disease virus, preparation method and application thereof | |
| CN110872578B (en) | Variant infectious bursal disease virus, subunit vaccine, preparation method and application thereof | |
| CN110117576B (en) | Duck adenovirus type-3 virus strain and preparation and application of yolk antibody thereof | |
| CN102363769A (en) | Chicken Marek's disease Meq gene deleted vaccine strain, construction method thereof, and application thereof | |
| CN114561366B (en) | Goat kuraria virus isolate and application thereof | |
| CN103509761B (en) | Recombinant porcine pseudorabies virus strain used for expression of porcine circovirus type II (PCV2) ORF2 gene, and preparation method thereof | |
| CN113943714A (en) | Cat calicivirus strain and application thereof | |
| JP2019517804A (en) | Recombinant non-pathogenic Marek's disease virus construct encoding infectious laryngotracheitis virus and infectious bursal disease virus antigen | |
| CN111593027A (en) | Grass carp reovirus type II attenuated strain and application thereof | |
| CN105802920B (en) | A11 plants of infectious bursal disease virus and its application | |
| CN112940084B (en) | Serum type4 avian adenovirus subunit vaccine and application thereof | |
| CN109022373A (en) | The end of duck plague virus UL56 gene 3 ' missing and LORF5 gene deletion mutants and its construction method and application | |
| CN111057682B (en) | Avian H9N2 subtype avian influenza strain separation identification and application | |
| CN102399756A (en) | Chicken Marek's disease virus (MDV) miRNA (micro Ribonucleic Acid) deletion vaccine strain and application thereof | |
| CN111647568A (en) | Reverse genetic vaccine strain of novel variant strain of chicken infectious bursal disease virus and application thereof | |
| CN112538464A (en) | Reverse genetic vaccine strain rHN20 of avian adenovirus serotype 4 as well as construction method and application thereof | |
| CN1864747A (en) | Method for preparing active carrier vaccine of avian Chlamydia psittaci | |
| CN1242065C (en) | Pig breeding and respiratory syndrome recombined adenovirus and vaccine | |
| CN114921422A (en) | Canine-derived feline parvovirus isolate and application thereof | |
| CN113214407B (en) | II-type grass carp reovirus VP4-NS38 fusion protein gene, expression vector, strain and application thereof | |
| CN115161291A (en) | Cat parvovirus strain and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |