CN110117576B - Duck adenovirus type-3 virus strain and preparation and application of yolk antibody thereof - Google Patents
Duck adenovirus type-3 virus strain and preparation and application of yolk antibody thereof Download PDFInfo
- Publication number
- CN110117576B CN110117576B CN201910329283.7A CN201910329283A CN110117576B CN 110117576 B CN110117576 B CN 110117576B CN 201910329283 A CN201910329283 A CN 201910329283A CN 110117576 B CN110117576 B CN 110117576B
- Authority
- CN
- China
- Prior art keywords
- adenovirus type
- duck adenovirus
- duck
- virus
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 241000272525 Anas platyrhynchos Species 0.000 title claims abstract description 116
- 241000193096 Human adenovirus B3 Species 0.000 title claims abstract description 92
- 210000002969 egg yolk Anatomy 0.000 title claims abstract description 45
- 238000002360 preparation method Methods 0.000 title claims abstract description 15
- 241000700605 Viruses Species 0.000 claims abstract description 59
- 108010000912 Egg Proteins Proteins 0.000 claims abstract description 21
- 102000002322 Egg Proteins Human genes 0.000 claims abstract description 21
- 235000013345 egg yolk Nutrition 0.000 claims abstract description 21
- 244000144977 poultry Species 0.000 claims abstract description 11
- 238000004321 preservation Methods 0.000 claims abstract description 7
- 230000003053 immunization Effects 0.000 claims abstract description 5
- 241000272834 Cairina moschata Species 0.000 claims description 22
- 241001465754 Metazoa Species 0.000 claims description 14
- 108090000623 proteins and genes Proteins 0.000 claims description 14
- NTIZESTWPVYFNL-UHFFFAOYSA-N Methyl isobutyl ketone Chemical compound CC(C)CC(C)=O NTIZESTWPVYFNL-UHFFFAOYSA-N 0.000 claims description 12
- 229940031551 inactivated vaccine Drugs 0.000 claims description 12
- 239000002773 nucleotide Substances 0.000 claims description 10
- 125000003729 nucleotide group Chemical group 0.000 claims description 10
- 229960005486 vaccine Drugs 0.000 claims description 10
- 238000000034 method Methods 0.000 claims description 7
- 201000010099 disease Diseases 0.000 claims description 6
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 claims description 6
- 230000002265 prevention Effects 0.000 claims description 4
- 238000010171 animal model Methods 0.000 claims description 3
- 239000003814 drug Substances 0.000 claims description 3
- 230000002779 inactivation Effects 0.000 claims description 2
- 230000003612 virological effect Effects 0.000 claims description 2
- 206010001258 Adenoviral infections Diseases 0.000 claims 1
- 238000004113 cell culture Methods 0.000 claims 1
- 238000004945 emulsification Methods 0.000 claims 1
- 208000015181 infectious disease Diseases 0.000 abstract description 10
- 230000005847 immunogenicity Effects 0.000 abstract description 3
- 210000004027 cell Anatomy 0.000 description 19
- 239000007788 liquid Substances 0.000 description 14
- 241000701161 unidentified adenovirus Species 0.000 description 11
- 108020004414 DNA Proteins 0.000 description 10
- 231100000517 death Toxicity 0.000 description 10
- 230000034994 death Effects 0.000 description 10
- 239000000243 solution Substances 0.000 description 10
- 210000003205 muscle Anatomy 0.000 description 9
- 230000003902 lesion Effects 0.000 description 8
- 238000010790 dilution Methods 0.000 description 6
- 239000012895 dilution Substances 0.000 description 6
- 238000003752 polymerase chain reaction Methods 0.000 description 6
- 239000000047 product Substances 0.000 description 6
- 238000000108 ultra-filtration Methods 0.000 description 5
- 238000001514 detection method Methods 0.000 description 4
- 235000013601 eggs Nutrition 0.000 description 4
- 210000004185 liver Anatomy 0.000 description 4
- WWZKQHOCKIZLMA-UHFFFAOYSA-N octanoic acid Chemical compound CCCCCCCC(O)=O WWZKQHOCKIZLMA-UHFFFAOYSA-N 0.000 description 4
- 208000024891 symptom Diseases 0.000 description 4
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 4
- 241000272517 Anseriformes Species 0.000 description 3
- 238000012408 PCR amplification Methods 0.000 description 3
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 3
- 239000000427 antigen Substances 0.000 description 3
- 108091007433 antigens Proteins 0.000 description 3
- 102000036639 antigens Human genes 0.000 description 3
- 230000009286 beneficial effect Effects 0.000 description 3
- 238000006243 chemical reaction Methods 0.000 description 3
- 238000012258 culturing Methods 0.000 description 3
- 230000000694 effects Effects 0.000 description 3
- 238000001962 electrophoresis Methods 0.000 description 3
- 239000012530 fluid Substances 0.000 description 3
- 238000007710 freezing Methods 0.000 description 3
- 230000008014 freezing Effects 0.000 description 3
- 238000002347 injection Methods 0.000 description 3
- 239000007924 injection Substances 0.000 description 3
- 230000007918 pathogenicity Effects 0.000 description 3
- 238000010257 thawing Methods 0.000 description 3
- 208000010370 Adenoviridae Infections Diseases 0.000 description 2
- 206010060931 Adenovirus infection Diseases 0.000 description 2
- 229920001817 Agar Polymers 0.000 description 2
- WSFSSNUMVMOOMR-UHFFFAOYSA-N Formaldehyde Chemical compound O=C WSFSSNUMVMOOMR-UHFFFAOYSA-N 0.000 description 2
- 241000701109 Human adenovirus 2 Species 0.000 description 2
- 231100000645 Reed–Muench method Toxicity 0.000 description 2
- 208000011589 adenoviridae infectious disease Diseases 0.000 description 2
- 239000008272 agar Substances 0.000 description 2
- OBETXYAYXDNJHR-UHFFFAOYSA-N alpha-ethylcaproic acid Natural products CCCCC(CC)C(O)=O OBETXYAYXDNJHR-UHFFFAOYSA-N 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 238000009395 breeding Methods 0.000 description 2
- 230000001488 breeding effect Effects 0.000 description 2
- 230000000120 cytopathologic effect Effects 0.000 description 2
- 238000011156 evaluation Methods 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 239000000706 filtrate Substances 0.000 description 2
- 238000001914 filtration Methods 0.000 description 2
- 239000008098 formaldehyde solution Substances 0.000 description 2
- 238000002955 isolation Methods 0.000 description 2
- 231100000225 lethality Toxicity 0.000 description 2
- 238000002156 mixing Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 230000008506 pathogenesis Effects 0.000 description 2
- 230000003449 preventive effect Effects 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 210000000952 spleen Anatomy 0.000 description 2
- 239000008227 sterile water for injection Substances 0.000 description 2
- 238000006467 substitution reaction Methods 0.000 description 2
- 230000008961 swelling Effects 0.000 description 2
- 230000001225 therapeutic effect Effects 0.000 description 2
- 241000271566 Aves Species 0.000 description 1
- 208000035473 Communicable disease Diseases 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 241000807592 Fowl adenovirus Species 0.000 description 1
- 206010053759 Growth retardation Diseases 0.000 description 1
- 206010019842 Hepatomegaly Diseases 0.000 description 1
- 206010067482 No adverse event Diseases 0.000 description 1
- 206010033546 Pallor Diseases 0.000 description 1
- 238000012300 Sequence Analysis Methods 0.000 description 1
- 241000221095 Simmondsia Species 0.000 description 1
- 235000004433 Simmondsia californica Nutrition 0.000 description 1
- 108020000999 Viral RNA Proteins 0.000 description 1
- 239000002671 adjuvant Substances 0.000 description 1
- 239000011543 agarose gel Substances 0.000 description 1
- 238000007605 air drying Methods 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 229960002233 benzalkonium bromide Drugs 0.000 description 1
- KHSLHYAUZSPBIU-UHFFFAOYSA-M benzododecinium bromide Chemical compound [Br-].CCCCCCCCCCCC[N+](C)(C)CC1=CC=CC=C1 KHSLHYAUZSPBIU-UHFFFAOYSA-M 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000007865 diluting Methods 0.000 description 1
- 238000013210 evaluation model Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 231100000001 growth retardation Toxicity 0.000 description 1
- 238000003306 harvesting Methods 0.000 description 1
- 230000036039 immunity Effects 0.000 description 1
- 238000002649 immunization Methods 0.000 description 1
- 238000009169 immunotherapy Methods 0.000 description 1
- 238000011081 inoculation Methods 0.000 description 1
- 238000010255 intramuscular injection Methods 0.000 description 1
- 239000007927 intramuscular injection Substances 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 239000012528 membrane Substances 0.000 description 1
- 239000011259 mixed solution Substances 0.000 description 1
- 239000004570 mortar (masonry) Substances 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 150000007523 nucleic acids Chemical class 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 231100000915 pathological change Toxicity 0.000 description 1
- 230000036285 pathological change Effects 0.000 description 1
- 230000001575 pathological effect Effects 0.000 description 1
- 239000002504 physiological saline solution Substances 0.000 description 1
- 238000005070 sampling Methods 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 238000002791 soaking Methods 0.000 description 1
- 239000011780 sodium chloride Substances 0.000 description 1
- 230000001954 sterilising effect Effects 0.000 description 1
- 238000004659 sterilization and disinfection Methods 0.000 description 1
- 238000003756 stirring Methods 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
- 239000000725 suspension Substances 0.000 description 1
- 210000001519 tissue Anatomy 0.000 description 1
- 238000005406 washing Methods 0.000 description 1
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
- C07K16/081—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from DNA viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2207/00—Modified animals
- A01K2207/20—Animals treated with compounds which are neither proteins nor nucleic acids
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/30—Bird
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/0337—Animal models for infectious diseases
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5252—Virus inactivated (killed)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/10—Immunoglobulins specific features characterized by their source of isolation or production
- C07K2317/11—Immunoglobulins specific features characterized by their source of isolation or production isolated from eggs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10211—Aviadenovirus, e.g. fowl adenovirus A
- C12N2710/10221—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10211—Aviadenovirus, e.g. fowl adenovirus A
- C12N2710/10234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Virology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Animal Behavior & Ethology (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Environmental Sciences (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Biotechnology (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- General Engineering & Computer Science (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Biomedical Technology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a duck adenovirus type-3 virus strain and preparation and application of a yolk antibody thereof, wherein the duck adenovirus type-3 yolk antibody prepared by the invention is prepared from a duck adenovirus type-3 virus strain with a preservation number of CCTCC NO: the virus strain of the invention is produced by immunizing poultry with the GD06 strain of duck adenovirus type 3 virus of V201905, and has good specificity and immunogenicity; the duck adenovirus type 3 egg yolk antibody has high safety, high immune protection rate and wide application prospect, effectively prevents the infection of the duck adenovirus type 3, effectively treats the duck adenovirus type 3, can be used for detecting the duck adenovirus type 3 virus and has wide application prospect.
Description
Technical Field
The invention belongs to the field of animal antigen antibodies, and particularly relates to a duck adenovirus type 3 virus strain and preparation and application of a yolk antibody thereof.
Background
Adenovirus (Fowl adenovirus) is a common infectious disease of poultry and wild birds. In recent years, duck adenovirus type 3 (DAdV-3) is widely spread in China, and after duck adenovirus type 3 is infected, muscovy ducks have symptoms of liver swelling, pallor, spleen swelling, blood stasis and the like. The death rate of the disease can reach more than 50 percent, and huge loss is caused to the duck breeding industry. In recent years, the duck adenovirus type 3 prevalence has an outbreak trend, and the development of the duck breeding industry is seriously damaged.
At present, no effective prevention and control means is available for duck adenovirus type 3, but inactivated vaccines are reported, but the vaccines are still in the scientific research stage, and no successful report and produced products are available. Meanwhile, the existing research has the following problems: firstly, the disease infection model is unreasonable in design, typical symptoms do not appear after the duck is infected with viruses, no viruses are detected in all tissues, and the duck does not have death symptoms and is different from clinical data; secondly, after the duck is inoculated with the inactivated vaccine, effective antibodies can not be generated in a short period, and even if the antibodies are generated in a short period, the protection rate of the duck against viruses is low, so that the duck is not suitable for the ducks within 2 weeks.
At present, no effective duck adenovirus type 3 animal infection model exists, no prevention and treatment means aiming at the duck adenovirus type 3 exist, and a new duck adenovirus type 3 strain serving as an animal evaluation model and a safe and effective yolk antibody generated by the strain are urgently needed.
Disclosure of Invention
The invention aims to provide a duck adenovirus type-3 GD06 virus strain and preparation and application of a yolk antibody thereof.
The invention provides a duck adenovirus 3 type GD06 strain, which is preserved in China center for type culture Collection in 2019, 1 month and 31 days, and the preservation number is CCTCC NO: and V201905.
The technical scheme adopted by the invention is as follows:
a duck adenovirus type-3 GD06 virus strain is preserved in China center for type culture Collection in 2019 in 1 month and 31 days, and the preservation number is CCTCC NO: v201905, classified name is 3 type GD06 strain of duck adenovirus.
Further, the nucleotide sequence of the Hexon gene of the virus strain is shown as SEQ ID NO. 1.
The application of the duck adenovirus type-3 GD06 strain in preparation of duck adenovirus type-3 vaccines.
Further, the duck adenovirus type 3 vaccine is a whole virus inactivated vaccine.
A method of constructing an animal model of adenovirus infection comprising: injecting the duck adenovirus type-3 GD06 virus strain into an animal body to cause the animal to develop diseases; preferably, the animal is poultry; more preferably, the animal is Muscovy duck.
The inactivated vaccine is the duck adenovirus type-3 GD06 virus strain which is cultured by LMH cells and is inactivated and emulsified.
A yolk antibody against duck adenovirus type 3 virus, which is produced by immunizing poultry with the duck adenovirus type 3 GD06 virus strain as described above.
Further, the poultry is laying hens.
The yolk antibody is applied to the preparation of a medicament for preventing/treating duck adenovirus type 3.
The invention has the beneficial effects that:
the invention provides a novel duck adenovirus type-3 GD06 strain, the preservation number of which is CCTCC NO: v201905. The virus strain of the invention has good specificity and immunogenicity. The invention also provides a duck adenovirus type 3 egg yolk antibody prepared by using the duck adenovirus type 3 GD06 virus strain, and the duck adenovirus type 3 egg yolk antibody has the advantages of good safety, high immune protection rate and agar amplification titer greater than 1:32, and can effectively prevent and treat duck adenovirus type 3 infection. The invention also establishes a duck adenovirus type 3 morbidity model for the first time, has the lethality rate of not less than 50 percent, is beneficial to the preparation of vaccines and the evaluation of antibody titer, and has wide application prospect.
Drawings
FIG. 1 shows the result of electrophoresis of a duck adenovirus type 3 PCR amplification product, wherein lane 1 shows the cell sap after inoculation of a pathological material; lane 2 is a non-inoculated cell fluid control; lane M is DNA molecular weight Standard DL2000;
FIG. 2 shows the result of electrophoresis of duck adenovirus type 3 PCR amplification products, wherein lane 1 is: f1 generation virus liquid; lane 2: f5 generation virus liquid; lane 3: f10 generation virus liquid; lane 4 is a non-inoculated cell fluid control; m: DNA molecular weight standard DL2000;
FIG. 3 shows the results of comparison of liver lesions of duck adenovirus type 3 counteracting duck and control duck, wherein A is counteracting duck, B is control duck, and the box in the figure shows the liver lesion area.
Detailed Description
A duck adenovirus type-3 GD06 virus strain is preserved in China center for type culture Collection in 2019 in 1 month and 31 days, and the preservation number is CCTCC NO: v201905, classified name is 3 type GD06 strain of duck adenovirus.
Preferably, the nucleotide sequence of the Hexon gene of the virus strain is shown as SEQ ID No. 1.
The application of the duck adenovirus type-3 GD06 strain in preparation of duck adenovirus type-3 vaccines.
Preferably, the duck adenovirus type 3 vaccine is a whole virus inactivated vaccine.
A method of constructing an animal model of adenovirus infection comprising: injecting the duck adenovirus type-3 GD06 virus strain into an animal body to cause the animal to develop diseases; preferably, the animal is poultry; more preferably, the animal is Muscovy duck.
The inactivated vaccine is the duck adenovirus type-3 GD06 virus strain which is cultured by LMH cells and is inactivated and emulsified.
A yolk antibody against duck adenovirus type 3 virus, which is produced by immunizing poultry with the duck adenovirus type 3 GD06 virus strain as described above.
Preferably, the poultry is laying hens.
The yolk antibody is applied to the preparation of a medicament for preventing/treating duck adenovirus type 3.
Isolation of viruses
Aseptically collecting the liver and spleen of a diseased duck suspected to be infected with duck adenovirus type 3 duck farm in the Jiangmen area, homogenizing by a mortar, and mixing according to the weight ratio of 1: sterile PBS was added at a ratio of 5 (W/V). After repeated freezing and thawing at minus 20 ℃ for 3 times, centrifuging for 10 minutes under the condition of 6000 r/min. The supernatant was collected, filtered through a 0.45 μm filter to obtain a filtrate, and the filtrate was inoculated to LMH cells (ATCC: CRL-2117) having a cell density of 80% to 90%. CO at 37 deg.C 2 Culturing in incubator, observing cellsAnd (4) collecting cell sap (containing supernate and cells) after the pathological changes for 72 hours, and repeatedly freezing and thawing for 3 times for later use.
Identification of viruses
A pair of primers for detecting a target gene Fiber2 (highly conserved) in duck adenovirus type 3 is designed, and the nucleotide sequence is shown in Table 1. The amplified gene Fiber2 is highly conserved in adenovirus, and the expected amplified gene length is 739bp. The harvested cell fluid was taken and DNA was extracted (Takara Mini BEST Viral RNA/DNA Extraction Kit Ver.5.0 Extraction Kit). The reaction system is as follows: the reaction volume is 50 mu L, the water is 21 mu L, the 2 XEx Taqmix is 25 mu L, the duck adenovirus 3-F (SEQ ID NO. 1) and the duck adenovirus 3-R (SEQ ID NO. 2) are respectively 1 mu L, and the DNA template is 2 mu L. The PCR reaction conditions are as follows: 5 minutes at 94 ℃; 30 seconds at 94 ℃, 30 seconds at 52 ℃, 30 seconds at 72 ℃ and 35 cycles; final extension at 72 ℃ for 10 min. PCR products were analyzed by electrophoresis on a 1% agarose gel containing Goldenvew (Tianze Gene).
As a result: no band was observed in the negative control, and the virus culture of the present invention showed the expected size of DNA fragment (shown in FIG. 1), which was 739bp. Thus, the isolated virus was initially determined to be duck adenovirus type 3.
Table 1 detection of primer sequences
Sequence analysis of the hexon of the Virus Strain
The primers duck adenovirus 3-2814-F and duck adenovirus 3-2814-R (SEQ ID NO:3 and SEQ ID NO: 4) for amplifying duck adenovirus type 3 Hexon Hexon gene are shown in Table 2. And amplifying the target gene Hexon by using PCR (polymerase chain reaction) and carrying out gene sequencing. The full-length nucleotide sequence of the Hexon is shown as SEQ ID NO:5, the expected length of the target gene product of the amplified Hexon is 2814bp. Through NCBI BLAST gene comparison analysis, the GD06 isolate Hexon gene belongs to the same branch with duck adenovirus type 3, and the GD06 isolate and the duck adenovirus type 3 GDMM10 isolate (accession number: MH 777398.1) and FJGT01 (accession number: MH 777395.1) have 99.96 percent of nucleotide similarity respectively; the nucleotide similarity with ZJJH07 duck adenovirus type 3 isolate (accession number: MH 777397.1) and AHAQ13 (accession number: MH 777396.1) in GenBank database is 99.89%; nucleotide similarity to duck adenovirus type 2 GR isolate (accession number: NC-024486.1) in the GenBank database was 77.08%.
Based on the above results, the GD06 isolate was determined to be duck adenovirus type 3 and designated GD06 strain.
The duck adenovirus type-3 GD06 strain of the invention is preserved in China center for type culture Collection in 2019, 1 month and 31 days, and the preservation number is as follows: CCTCC NO: and V201905.
TABLE 2 primer sequences for full-length amplification of the Hexon gene
TABLE 3 comparison of nucleotide sequence similarity of GD06 strain of the present invention with duck adenovirus type 2 and type 3 reference strains
The full-length nucleotide sequence of the duck adenovirus type-3 GD06 strain Hexon is as follows:
ATGGCCGCTCTGACCCCTGACTTGACGACGGCTACGGCGAGGCTGTCCTATTTTCACATTGCCGGTCCGAGCACACGGGAGTATCTGTCAGAGGACCTTCAGCAGTTTATGAGTGCAACATCCAGCTACTTTGAGTTGCGAAACAAATTCAGGCAAACGGTTGCTGCCCCAACGCGTAATGTTACTACCGAGAAAGCTCAACGTCTCCAGATACGCTACTATCCCATTCAGACTGACGAAACATCAAACACACACAGAGTGAGATTTTCCATGAATGTCGGTGACAGTTGGGTTCTTGACATGGGATCAACTTATTTTGACATAAAGGGTGTGCTAGATAGGGGTTCTTCTTTCAAACCATACAGTGGAACAGCTTACAATCCACTAGCTCCTAAAGAATCGGTGTTTAACTTTTGGTACACGCACACAGACTCTAAGAACTACATTGGTGCGCAGCTGTCGACTCTGTACGAAAACACAGACCCTGGCACAGGTACACCAACACAAAATGTAGTAAAAGCAATGAGTGGAGTCAATCCTGATCCAAACCAAGGGTCAAGTATCTCAGTTCCTGAATTGCTTATAGGAGACACAAATGACAATAAGTTTAGTGGAGTGGCGAAAGTAGCTAAGGCTGAATTGATGCTTGCTCATGGTGCTTACGTTAAGCCAGTGGCACCCACTGGGTCTCAGTCTCTATCCCAAACTGGATATGTGTTGTCTTCAGATGGGTCCACAAAGTATAACGGAGCTATTTCGGTTGAGGACTATACATCATCACTTCAGTATCCAGATAGCCTGTACATTCCACCAAACTCGACTGCTGTAGACAACTTTGGTGTGACAAAGGGACTCAGACCTAACTACATAGGTTTTCGCGATAATTTCATTAACATTCTTTATCATGACTCAGGTGTCTGCTCAGGTACGCTTAATTCTGAGAGGTCAGGCATGAACGTTGTTGTAGCATTACAGGACAGGAATACTGAACTAAGCTATCAGTACATGTTGGCTGACATGATGTCAAGGCATCATTATTTTGCACTATGGAATCAGGCAGTAGACCAGTATGATCATGACGTAAGAGTCTTCAACAATGACGGATATGAAGACGTATCTAGCTCCTATGCGTTCTACCCTAATTGCTTAGGCTTTCAACCTGGTGGAGAACTCTATACGAAATTGAAGGTAGTGAAGACAGACTCTTCTTCAGGCGCTATGTCTGGCGGTGAGGTGGCCAACACATCAAGTGCATTTGGAGTAGGCAACATTCCTGCCTATGAAATTAATATCCCGGCTTCTATGAAACGAATTTTCATTATGAGCAACATTGCTGATTACCTGCCAGACAAATACAAGGTCAGCATAGACTCAACAGACGGTGTGGACCAGAACTCATACGAGTATATGAACAAGCGTGTACCTCTTACCAACATTGTGGATCTTTTTACAAATATAGGTGCCAGATGGTCAGTGGATCAGATGGATAACGTTAATCCATTTAATCACCACAGAAATTGGGGCCTGAAATACAGGTCTCAGCTCCTAGGAAACAGCCGTTACTGTCAGTTTCACATTCAGGTACCGCAGAAGTATTTCGCTATAAAAAATCTACTACTTCTGCCAGGAACATACACCTATGAATGGGTACTCCGAAAGGATCCGAATATGGTGCTGCAGTCAAGCTTGGGGAACGATTTACGGCTTGACAAGGCTTCCATTACATTTACAGAGGTGAATTTGATGGCCAGCTTCATGCCTATGGACCATAATACCAGTAACCAACTAGAGCTCATGATGCGCAATGCTACTAATGATCAGACATTCATGGACTACCTCGGTGCAAAGAACGCACTTTACAGCATTCCTGCAGGGTCAAACCAAGTAACTATCAACATTCCTGCTAGAACCTGGGAAGGCATGCGAGGATGGTCTTTCACTCGTCTCAAAACAAAAGAAACACCTCAACAAGGAGCACAATATGACGTGGCGTTTAAGTATTCCGGATCAATTCCATACTTAGACGGTACATTCTATCTTAACCACACATTTAAGAATATGAGTGTGTTGTTTGATACATCGATAAATTGGCCAGGAAATGATAGGCTCATGTCACCGAACATGTTCGAAATTAAAAGAGCACCAGCAGCTGACTCTGAAGGATTTACTATGAGTCAATGCGACATTACGAAAGATTGGTGGCTAATTCAGATGGCCACAAACTACAACTTTGTGTATAACGGGTACAGGTTCTGGCCTGACAGACATTACTTCCAGTATGACTTTTTGCGTAACTTTGACCCAATGTCCAGACAGTCTCCCAATTTCTCTCAGTCTAATGGATTGTATGATCTGGTCTCTGTGGATAACACACCATCCACTGGAGCACCTAAACAGGAATACGTTCGTAACAACTCGGGGTTCGTGGCACCTAGGGCCGAACCAGTCTCAAATGCGAGACAGGGACACGCATGGCCCGCTAATTGGCCTTATCCACTGATTGGTAAACACTGCATAGACAGTGCTAACATTACCCAGTACAAGAAATTCCTGTGCGACAACTACCTGTGGACCATTCCCTTTAGCTCCGACTTTATGTATATGGGTGAGCTGACGGATCTGGGTCAGAATCCCATGTACACCAACAACTCCCACAGCATGGTGATCAACTTTGAGGTAGACCCCATGGACGAGGACACCTATCTCTACATGCTGTACGGAGTGTTTGATGCGGTCAGGGTGAACCAGCCTGAGCGCAATGTGCTGGCCATGGCTTACTTCCGTACGCCTTTCGCTACAGGTAACGCGGTGTAA(SEQ ID NO:5)
virus titre assay
Inoculating LMH cells in a 96-well plate, taking the identified GD06 strain F3 generation virus suspension when the cell density reaches 80-90%, diluting 10 times with sterile normal saline to 10 times -1 ～10 -8 There were 8 different dilutions. 10 wells of LMH cells washed 3 times with saline, 0.1mL per well, were inoculated for each dilution. Others served as no-virus controls. Adsorbing at 37 deg.C for 1 hr, adding maintaining solution, and placing in CO at 37 deg.C 2 Culturing in an incubator, observing and recording the number of cytopathic holes after 24-168 hours, and calculating TCID according to Reed-Muench method 50 。
As a result: at 10 -1 ～10 -4 Dilution inoculated wells all appeared diseased (10/10); 10 -5 Dilution seeded cells developed 5-well lesions (5/10); 10 -6 Dilution seeded cells developed 3-well lesions (3/10); 10 -7 And 10 -8 Dilution inoculated wells were free of lesions. The TCID of GD06 strain F3 generation virus liquid is calculated by a Reed-Muench method 50 Is 10 -5.3 /0.1mL。
Stability of duck adenovirus type-3 GD06 strain
GD06 strain is continuously passaged on LMH cells, the duck adenovirus type 3 virus liquid of the 1 st generation is named as F1, the duck adenovirus type 3 virus liquid of the 2 nd generation is named as F2, and the duck adenovirus type 3 virus liquid of the 10 th generation is named as F10. During cell passage, virus liquid of each passage can form lesions on cells, and the lesions become more and more obvious about 72 hours.
As a result: through PCR amplification detection, viral nucleic acid can be detected in the duck adenovirus type 3F 1, F5 and F10 generations (figure 2), and the stable passage of the duck adenovirus type 3 GD06 strain is proved.
Pathogenicity of Duck adenovirus type-3 GD06 strain
30 healthy muscovy ducks aged 5 days were randomly divided into 3 groups of 10 ducks. GD06 strain F3 virus liquid is injected into leg muscle of the first group, 0.5 mL/virus, and the virus content is 10 6.0 TCID 50 . The second group is injected with F5 virus solution through leg muscle, 0.5 mL/virus, the virus content is 10 6.0 TCID 50 . The third group was injected intramuscularly in the legs with 0.5 mL/mouse.
As a result: observations were made 14 days after injection. The first group was found to have 5/10 deaths and the second group to have 4/10 deaths (Table 4), with the post-infection death time centered on days 3 to 7 after injection. The third group (control group) did not die throughout the observation period (table 4). After the virus strain is injected into Muscovy ducks, a virus challenge experiment is carried out, for example, A in figure 3 shows that the virus strain can cause the Muscovy ducks to have hepatomegaly and pale lesions until death, and B shows that the Muscovy ducks have control ducks.
TABLE 4 pathogenicity of GD06 strain in different generations
Note: "/" indicates none.
Establishment of GD06 strain F3 generation disease model
40 healthy Muscovy ducks aged 20 days are randomly divided into 4 groups, and each group comprises 10 Muscovy ducks. The first, second and third groups are injected with GD06 strain F3 virus solution through leg muscle, 0.5 mL/virus, the virus content is 10 6.0 TCID 50 . The fourth group was observed for 7 days with a saline solution injected through leg muscles of 0.5 mL/mouse.
As a result: the first group had 6/10 deaths, the second and third groups had 5/10 deaths (Table 5), and the post-infection death times were concentrated between 3 and 6 days. But the fourth group (control group) did not die throughout the observation period. As can be seen from the results of the morbidity and mortality, the duck adenovirus type-3 GD06 strain can kill Muscovy ducks, and has strong pathogenicity and good immunogenicity. The invention establishes a duck adenovirus type 3 morbidity model for the first time, and the lethality rate of the duck adenovirus type 3 morbidity model is not lower than 50%. The establishment of the pathogenesis model is beneficial to vaccine preparation and antibody titer evaluation.
TABLE 5 pathogenesis model of GD06 strain F3 generation
Note: "/" indicates none.
Preparation of vaccines
Inoculating the GD06 strain virus liquid of the invention to LMH cells, observing cytopathic effect day by day, after culturing for 72 hours, harvesting the virus liquid, and repeatedly freezing and thawing for 3 times. 2L of the virus solution was added slowly to a formaldehyde solution to a final concentration of 0.2%, followed by inactivation at 37 ℃ for 24 hours with shaking. The inactivated virus liquid (antigen liquid) prepared by the invention is used for PCR detection by using duck adenovirus 3-F/R primers, and the PCR detection result is negative, so that duck adenovirus cannot be detected and the virus is completely inactivated. Taking prepared completely inactivated antigen solution, and carrying out the following steps: 2 (V/V) is added with Montanide ISA 71VG adjuvant (SEPPIC company, france), and emulsified for 10 minutes at 8000r/min to prepare the inactivated vaccine and the whole virus inactivated vaccine for subsequent experiments.
Immunization
2000 laying hens of 80 days old are injected intramuscularly with the inactivated vaccine prepared in the steps, wherein each laying hen is 1mL. When the laying hens are 94 days old, the laying hens are immunized again, and the dosage is 1 mL/laying hen. When the laying hens are 108 days old, the immunity is boosted once again, and the dosage is 1 mL/egg. After 14 days, 3 eggs were randomly picked, and the antibody titer in the yolk was monitored using jojoba, when the average antibody titer was greater than 1: at 32 hours, all eggs were collected. The titer of the dolichones antibody is lower than 1:32 then 1 boost. If the current antibody titer is greater than 1:32, then 1 antibody is monitored every 1 month, when the antibody titer is below 1: at 32, the booster was immediately given 1 time.
Preparation of yolk antibody
Soaking egg in 0.1% benzalkonium bromide water solution for 30 min for disinfection, washing with sterile water for injection for 2 times, taking out, and air drying. Separating egg yolk with yolk separator, adding 4 times of sterile water for injection into egg yolk, mixing, slowly adding octanoic acid while stirring to reach octanoic acid final concentration of 1%, and standing for 30 min. Filtering the mixed solution, and performing ultrafiltration concentration on the clear liquid by a 100kDa tangential flow ultrafiltration machine by 2-3 times. Sampling and measuring the agar titer of the sample after ultrafiltration, and when the antibody titer is more than 1: can be used only when the temperature is 32 ℃, and the ultrafiltration concentrated solution meeting the requirement is stored for 1 to 2 days at the temperature of between 2 and 8 ℃.
As a result: and (3) filtering and sterilizing the ultrafiltration concentrated solution stored at the temperature of between 2 and 8 ℃ by a filter membrane of 0.22 mu m, adding 0.01 percent formaldehyde solution, and performing aseptic subpackage to prepare the duck adenovirus type 3 egg yolk antibody.
And further detecting the effect of the duck adenovirus type 3 egg yolk antibody prepared by the invention.
1. Safety of yolk antibody
30 healthy Muscovy ducks aged 5 days are taken and randomly divided into 3 groups of 10. The first group is injected with duck adenovirus type 3 egg yolk antibody (with the batch number of 201801) through leg muscles, wherein the egg yolk antibody titer is more than 1. The second group of legs are injected with duck adenovirus type 3 yolk antibody (with the batch number of 201802), each of 2mL, and the titer of the yolk antibody is more than 1. The third group of leg muscle physiological saline, 2 mL/mouse, was kept in isolation and observed for 15 days. The batch numbers of 201801 and 201802 are duck adenovirus type 3 egg yolk antibodies prepared by the invention, and are two batches of products prepared at different times.
As a result: no adverse reaction is seen in the three groups of inoculated Muscovy ducks, which shows that the duck adenovirus type 3 egg yolk antibody prepared by the invention has good safety.
2. Preventive effect of yolk antibody
30 healthy Muscovy ducks aged 5 days are randomly divided into 3 groups, and each group comprises 10 healthy Muscovy ducks. The first group is injected with duck adenovirus type 3 egg yolk antibody (batch number: 201801) prepared by the invention through leg muscle, wherein the egg yolk antibody titer is more than 1. In the second group, 0.5mL of duck adenovirus type 3 egg yolk antibody (batch number: 201801) prepared by the invention is injected into leg muscles, and the egg yolk antibody titer is more than 1. The third group was injected intramuscularly in the legs with 0.5 mL/mouse. After 2 days, all Muscovy ducks are injected with 0.5mL of GD06 strain F3 virus solution prepared by the invention through intramuscular injection, and the virus content is 10 6.0 TCID 50 。
As a result: after 14 days of observation of Muscovy ducks, the first and second groups of Muscovy ducks injected with the egg yolk antibody prepared by the invention for prevention have no death number; while the mortality ratio of the third group (control group) was 5/10 (Table 6). The results show that the duck adenovirus type 3 egg yolk antibody prepared by the method can effectively prevent the infection of duck adenovirus type 3, the immune protection rate is 100%, and the effect is obvious.
TABLE 6 preventive effect of Duck adenovirus type 3 yolk antibody of the present invention
Note: "/" indicates that no antibody was used.
3. Therapeutic effect of yolk antibody
30 healthy Muscovy ducks aged 5 days are randomly divided into 3 groups, and each group comprises 10 healthy Muscovy ducks. Three groups of Muscovy ducks are injected with 0.5mL of GD06 strain F3 virus solution through leg muscles, the virus content is 10 6.0 TCID 50 . After infection, the Muscovy duck is treated when symptoms such as head shrinkage, growth retardation and the like appear. The first group was injected intramuscularly in the legs with 201801 batches of antibody, 0.5 mL/mouse, and the yolk antibody titer was greater than 1. The second group was injected intramuscularly in the legs with 201801 batches of antibody, 1 mL/mouse, with a yolk antibody titer greater than 1. The third group was injected intramuscularly in the legs with 0.5 mL/mouse.
As a result: after the injection, the observation is continued for 14 days, and the mortality rate of the first group after the treatment is 1/10; no mortality occurred in the second group after treatment; the mortality rate was 6/10 in the third group (control group) (Table 7). The results show that the duck adenovirus type 3 egg yolk antibody prepared by the method can effectively treat duck adenovirus type 3 infection, and the immunotherapy effect is higher than 90%.
TABLE 7 therapeutic Effect of Duck adenovirus type 3 egg yolk antibody of the present invention
Note: "/" indicates that no antibody was used.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> Guangdong Miket Biotech Co., ltd
<120> duck adenovirus type 3 virus strain, preparation and application of yolk antibody thereof
<130>
<160> 5
<170> PatentIn version 3.5
<210> 1
<211> 26
<212> DNA
<213> Artificial primer
<400> 1
gacatgggat caacttattt tgacat 26
<210> 2
<211> 19
<212> DNA
<213> Artificial primer
<400> 2
aatgatgcct tgacatcat 19
<210> 3
<211> 24
<212> DNA
<213> Artificial primer
<400> 3
atggccgctc tgacccctga cttg 24
<210> 4
<211> 17
<212> DNA
<213> Artificial primer
<400> 4
ttacaccgcg ttacctg 17
<210> 5
<211> 2814
<212> DNA
<213> Artificial sequence
<400> 5
atggccgctc tgacccctga cttgacgacg gctacggcga ggctgtccta ttttcacatt 60
gccggtccga gcacacggga gtatctgtca gaggaccttc agcagtttat gagtgcaaca 120
tccagctact ttgagttgcg aaacaaattc aggcaaacgg ttgctgcccc aacgcgtaat 180
gttactaccg agaaagctca acgtctccag atacgctact atcccattca gactgacgaa 240
acatcaaaca cacacagagt gagattttcc atgaatgtcg gtgacagttg ggttcttgac 300
atgggatcaa cttattttga cataaagggt gtgctagata ggggttcttc tttcaaacca 360
tacagtggaa cagcttacaa tccactagct cctaaagaat cggtgtttaa cttttggtac 420
acgcacacag actctaagaa ctacattggt gcgcagctgt cgactctgta cgaaaacaca 480
gaccctggca caggtacacc aacacaaaat gtagtaaaag caatgagtgg agtcaatcct 540
gatccaaacc aagggtcaag tatctcagtt cctgaattgc ttataggaga cacaaatgac 600
aataagttta gtggagtggc gaaagtagct aaggctgaat tgatgcttgc tcatggtgct 660
tacgttaagc cagtggcacc cactgggtct cagtctctat cccaaactgg atatgtgttg 720
tcttcagatg ggtccacaaa gtataacgga gctatttcgg ttgaggacta tacatcatca 780
cttcagtatc cagatagcct gtacattcca ccaaactcga ctgctgtaga caactttggt 840
gtgacaaagg gactcagacc taactacata ggttttcgcg ataatttcat taacattctt 900
tatcatgact caggtgtctg ctcaggtacg cttaattctg agaggtcagg catgaacgtt 960
gttgtagcat tacaggacag gaatactgaa ctaagctatc agtacatgtt ggctgacatg 1020
atgtcaaggc atcattattt tgcactatgg aatcaggcag tagaccagta tgatcatgac 1080
gtaagagtct tcaacaatga cggatatgaa gacgtatcta gctcctatgc gttctaccct 1140
aattgcttag gctttcaacc tggtggagaa ctctatacga aattgaaggt agtgaagaca 1200
gactcttctt caggcgctat gtctggcggt gaggtggcca acacatcaag tgcatttgga 1260
gtaggcaaca ttcctgccta tgaaattaat atcccggctt ctatgaaacg aattttcatt 1320
atgagcaaca ttgctgatta cctgccagac aaatacaagg tcagcataga ctcaacagac 1380
ggtgtggacc agaactcata cgagtatatg aacaagcgtg tacctcttac caacattgtg 1440
gatcttttta caaatatagg tgccagatgg tcagtggatc agatggataa cgttaatcca 1500
tttaatcacc acagaaattg gggcctgaaa tacaggtctc agctcctagg aaacagccgt 1560
tactgtcagt ttcacattca ggtaccgcag aagtatttcg ctataaaaaa tctactactt 1620
ctgccaggaa catacaccta tgaatgggta ctccgaaagg atccgaatat ggtgctgcag 1680
tcaagcttgg ggaacgattt acggcttgac aaggcttcca ttacatttac agaggtgaat 1740
ttgatggcca gcttcatgcc tatggaccat aataccagta accaactaga gctcatgatg 1800
cgcaatgcta ctaatgatca gacattcatg gactacctcg gtgcaaagaa cgcactttac 1860
agcattcctg cagggtcaaa ccaagtaact atcaacattc ctgctagaac ctgggaaggc 1920
atgcgaggat ggtctttcac tcgtctcaaa acaaaagaaa cacctcaaca aggagcacaa 1980
tatgacgtgg cgtttaagta ttccggatca attccatact tagacggtac attctatctt 2040
aaccacacat ttaagaatat gagtgtgttg tttgatacat cgataaattg gccaggaaat 2100
gataggctca tgtcaccgaa catgttcgaa attaaaagag caccagcagc tgactctgaa 2160
ggatttacta tgagtcaatg cgacattacg aaagattggt ggctaattca gatggccaca 2220
aactacaact ttgtgtataa cgggtacagg ttctggcctg acagacatta cttccagtat 2280
gactttttgc gtaactttga cccaatgtcc agacagtctc ccaatttctc tcagtctaat 2340
ggattgtatg atctggtctc tgtggataac acaccatcca ctggagcacc taaacaggaa 2400
tacgttcgta acaactcggg gttcgtggca cctagggccg aaccagtctc aaatgcgaga 2460
cagggacacg catggcccgc taattggcct tatccactga ttggtaaaca ctgcatagac 2520
agtgctaaca ttacccagta caagaaattc ctgtgcgaca actacctgtg gaccattccc 2580
tttagctccg actttatgta tatgggtgag ctgacggatc tgggtcagaa tcccatgtac 2640
accaacaact cccacagcat ggtgatcaac tttgaggtag accccatgga cgaggacacc 2700
tatctctaca tgctgtacgg agtgtttgat gcggtcaggg tgaaccagcc tgagcgcaat 2760
gtgctggcca tggcttactt ccgtacgcct ttcgctacag gtaacgcggt gtaa 2814
Claims (10)
1. The duck adenovirus type-3 GD06 virus strain is characterized in that the duck adenovirus type-3 GD06 virus strain is preserved in a China Center for Type Culture Collection (CCTCC) within 2019, 1 month and 31 days, and the preservation number is CCTCC NO: v201905, namely a classified name of duck adenovirus type 3 GD06 strain;
the nucleotide sequence of the Hexon gene of the virus strain is shown as SEQ ID NO. 5.
2. The application of the duck adenovirus type-3 GD06 strain of claim 1 in preparing duck adenovirus type-3 vaccine.
3. The use of claim 2, wherein the duck adenovirus type 3 vaccine is a whole virus inactivated vaccine.
4. A method of constructing an animal model of adenoviral infection, comprising: the duck adenovirus type 3 GD06 virus strain of claim 1 is injected into an animal to cause disease in the animal.
5. The method of claim 4, wherein the animal is poultry.
6. The method of claim 4, wherein the animal is a Muscovy duck.
7. A duck adenovirus type 3 inactivated vaccine is characterized in that the inactivated vaccine is the duck adenovirus type 3 GD06 viral strain of claim 1 after LMH cell culture and inactivation emulsification.
8. A yolk antibody against duck adenovirus type 3 virus, which is produced by immunizing poultry with the duck adenovirus type 3 GD06 virus strain of claim 1.
9. The egg yolk antibody of claim 8, wherein the poultry is a laying hen.
10. The use of the egg yolk antibody of claim 8 in the preparation of a medicament for the prevention/treatment of duck adenovirus type 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910329283.7A CN110117576B (en) | 2019-04-23 | 2019-04-23 | Duck adenovirus type-3 virus strain and preparation and application of yolk antibody thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910329283.7A CN110117576B (en) | 2019-04-23 | 2019-04-23 | Duck adenovirus type-3 virus strain and preparation and application of yolk antibody thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110117576A CN110117576A (en) | 2019-08-13 |
| CN110117576B true CN110117576B (en) | 2023-02-10 |
Family
ID=67521406
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910329283.7A Active CN110117576B (en) | 2019-04-23 | 2019-04-23 | Duck adenovirus type-3 virus strain and preparation and application of yolk antibody thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110117576B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110564699B (en) * | 2019-09-30 | 2021-08-03 | 山东信得科技股份有限公司 | Novel Muscovy duck adenovirus strain, inactivated vaccine and preparation method thereof |
| CN110628726B (en) * | 2019-09-30 | 2021-08-06 | 山东信得科技股份有限公司 | Novel Muscovy duck adenovirus strain, bivalent inactivated vaccine and preparation method thereof |
| CN111533803B (en) * | 2019-09-30 | 2021-09-28 | 山东信得科技股份有限公司 | Muscovy duck adenovirus type 2 and type3 refined egg yolk antibody and preparation method thereof |
| CN113198011B (en) * | 2021-04-28 | 2023-05-09 | 重庆永健生物技术有限责任公司 | Duck adenovirus type 3 strain inactivated vaccine and application thereof |
| CN113278595B (en) * | 2021-04-28 | 2023-05-09 | 重庆永健生物技术有限责任公司 | Duck adenovirus type 3 strain, duck adenovirus egg yolk antibody, and preparation methods and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6241991B1 (en) * | 1998-03-05 | 2001-06-05 | Akzo Nobel N.V. | Aviadenovirus |
| CN107982529A (en) * | 2017-12-14 | 2018-05-04 | 天津瑞普生物技术股份有限公司 | A kind of preparation method of 2 type adenovirus inactivated vaccine of duck |
| CN108330108A (en) * | 2017-12-26 | 2018-07-27 | 华南农业大学 | CH-GD-12-2014 plants of 3 type inactivated vaccine of Ana 1 aviadenovirus |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005017101A2 (en) * | 2003-05-19 | 2005-02-24 | THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH & HUMAN SERVICES, NATIONAL INSTITUTES OF HEALTH | Avian adenoassociated virus (aaav) and uses thereof |
-
2019
- 2019-04-23 CN CN201910329283.7A patent/CN110117576B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6241991B1 (en) * | 1998-03-05 | 2001-06-05 | Akzo Nobel N.V. | Aviadenovirus |
| CN107982529A (en) * | 2017-12-14 | 2018-05-04 | 天津瑞普生物技术股份有限公司 | A kind of preparation method of 2 type adenovirus inactivated vaccine of duck |
| CN108330108A (en) * | 2017-12-26 | 2018-07-27 | 华南农业大学 | CH-GD-12-2014 plants of 3 type inactivated vaccine of Ana 1 aviadenovirus |
Non-Patent Citations (1)
| Title |
|---|
| ２株Ⅰ群禽腺病毒的分离鉴定及致病性分析;王颖等;《中国畜牧兽医》;20181218;第45卷(第12期);第3563-3571页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110117576A (en) | 2019-08-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110117576B (en) | Duck adenovirus type-3 virus strain and preparation and application of yolk antibody thereof | |
| CN104988124B (en) | Genotype Ⅶ newcastle disease virus marker vaccine strain and its application | |
| KR101564316B1 (en) | A novel Fowl Adenovirus and vaccine thereof | |
| CN105985966A (en) | Gene VII-type newcastle disease virus strain, vaccine composition thereof and preparing method and application of vaccine composition | |
| CN114561366B (en) | Goat kuraria virus isolate and application thereof | |
| CN109306360B (en) | Method for expressing foreign protein by using baculovirus and application thereof | |
| CN108913666B (en) | Duck reovirus causing duck spleen necrosis and inactivated vaccine and application thereof | |
| CN109207436B (en) | Group I type 4 avian adenovirus strain and application thereof | |
| CN112063596A (en) | Pigeon paramyxovirus type 1 PPMV-1/BJ-C strain and application thereof | |
| CN106929480B (en) | Porcine reproductive and respiratory syndrome virus strain and application thereof | |
| KR101102271B1 (en) | Attenuated Avian Infectious Bronchitis Virus and Vaccine for Avian Infectious Bronchitis Comprising the Same | |
| CN108588034B (en) | Variant rabbit viral hemorrhagic disease virus and application thereof in preparation of inactivated vaccine | |
| CN109010818B (en) | Bivalent vaccine composition for preventing and/or treating porcine circovirus infection and preparation method and application thereof | |
| CN116042537A (en) | Avian reovirus strain QYH2020-QD, virus liquid, preparation method and application | |
| CN113278595B (en) | Duck adenovirus type 3 strain, duck adenovirus egg yolk antibody, and preparation methods and application thereof | |
| KR101092977B1 (en) | Avian Infectious Bronchitis Virus and Vaccine for Avian Infectious Bronchitis Comprising the Same | |
| CN114774373A (en) | Carrier pigeon Newcastle disease virus genetic engineering modified attenuated strain and preparation method and application thereof | |
| CN111411087B (en) | Cyprinus carpioides herpesvirus II type low virulent strain and application thereof | |
| CN112546215A (en) | Inactivated vaccine for avian adenovirus serotype 4, and preparation method and application thereof | |
| KR101073991B1 (en) | Avian metapneumovirus type B SC1509 strain isolated from chicken in Korea and the use thereof | |
| CN106754743B (en) | Super-strong-toxicity chicken infectious bursal disease virus cell adaptive strain and application thereof | |
| KR100913425B1 (en) | Influenza virus and immunogenic composition comprising the same | |
| CN114652828B (en) | Biological product containing novel goose parvovirus and duck circovirus antigen-antibody complex | |
| CN110713987A (en) | Recombinant gene VII type Newcastle disease virus strain and vaccine composition, preparation method and application thereof | |
| CN114703153B (en) | Serum type 2 avian adenovirus strain, vaccine and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Jiang Xianliang Inventor after: Huang Congling Inventor after: Huang Liping Inventor after: Qiu Junhui Inventor after: Zhang Xiuping Inventor before: Jiang Xianliang Inventor before: Huang Liping Inventor before: Qiu Junhui Inventor before: Zhang Xiuping |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |