CN1858242A - Method for predicting angiotonin II receptor agonist hypotensor medicine function and its use - Google Patents
Method for predicting angiotonin II receptor agonist hypotensor medicine function and its use Download PDFInfo
- Publication number
- CN1858242A CN1858242A CN 200510011681 CN200510011681A CN1858242A CN 1858242 A CN1858242 A CN 1858242A CN 200510011681 CN200510011681 CN 200510011681 CN 200510011681 A CN200510011681 A CN 200510011681A CN 1858242 A CN1858242 A CN 1858242A
- Authority
- CN
- China
- Prior art keywords
- receptor
- angiotensin
- gene
- adrenoceptor
- test kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of reagent kit including reagent for detecting the polymorphic site genotype of adrenoceptor gene of nucleic acid template. By means of PCR-RFLP method or Taqman method, the detection is fast, safe, convenient, sensitive and reliable. The detection can predict the hypotensive effect of angiotonin II receptor 1 agonist hypotensor and predict the functional state of the target organ of the primary hypertension patient, so that the medicine may be selected based on the individual difference to raise clinical treating efficiency and safety and lower the toxic side effect risk and treating cost.
Description
Technical field
The present invention relates to a kind of method and application thereof of predicting angiotonin II receptor agonist hypotensor medicine function, by measuring biological sample specific site genotype, the drug effect of prediction angiotensin-ii receptor 1 agonist hypotensor.
Background technology
Essential hypertension is one of modal chronic disease, is the substantial risk factor of cerebral apoplexy, coronary heart disease, diabetes etc., and therefore effectively controlling blood pressure has important clinical and public hygienics meaning.Clinically be used for the treatment of hypertensive medicine six classes are arranged, comprising: angiotensin-ii receptor (AT1-R) antagonist, beta-blocker, angiotensin converting enzyme inhibitor (ACEI), calcium antagonist, alpha adrenergic receptor retarding agent and diuretic(s) etc.But hypertensive so far inverse amplification factor is lower, and the data of the China and the U.S. shows that inverse amplification factor only is respectively 8.1% and 34%.This low inverse amplification factor not only with antihypertensive drugs itself render a service relevant, and with to lack effective outcome prediction guidance system clinically relevant.
The existing clinical method that is used to predict depressor curative effect, choose reasonable antihypertensive drugs mainly is doctors experience prediction and monitoring of blood pressure.These methods are too rough, and the doctor is difficult to carry out according to the patient individual difference selection, the compatibility and quantitative of medicine, to obtain better curative effect, to reduce toxic side effect, has increased the weight of patient's body and mind misery and economical load indirectly.Studies show that in a large number the individual difference of drug effect effect is relevant with environment, inherited genetic factors and interaction thereof.Pharmacogenomics is the difference of probing into drug effect from genomic level, discloses the front subject and the hi-tech means of the hereditary feature of these differences.Its achievement in research can be the doctor and drafts the personalized medicine scheme, and accurately predicting and raising curative effect of medication reduce the poisonous side effect of medicine risk, thereby reduce medical expense, improve patients ' life quality and make significant contribution.
According to the literature, pharmacogenomics has been illustrated the gene pleiomorphism of some drug targetings and the incidence relation between the certain drug effect, and that the product that these achievements cause has begun to be used for is clinical.For example, breast cancer related gene detection kit (the Oncotype DX that has gone on the market in the California, USA approval
TM).This product is to be used to predict reactivity and the chemical sproof test kit (Science 2004 303:1754-1755s) of patient to chemotherapeutics.Because the specificity and the susceptibility of this test kit are better, its test item has been classified the preceding essential items for inspection of metastatic breast cancer chemotherapy as, thereby estimates the recurrence rate of mammary cancer.
Primary hypertension relative gene has been found that so far and surpasses 70 that antihypertensive drugs and Study on gene polymorphism majority concentrate on both interactions to [Drugs, 2004 in the influence of cardiovascular event generation; 64 (16): 1801-1816].For example existing the report carried the hyperpietic at α-seats such as adducin gene 460W, adopts diuretic therapy than adopting other step-down treatments, more helps to reduce the occurrence probability of patient's myocardial infarction and apoplexy.There are interaction in the polymorphism of ACE insertion/disappearance and Angiotensin proenzyme inhibitor (ACEI) for another example, show as the difference of different genotype at aspects such as the mRNA expression of angiotensin receptor albumen (AT1), left ventricular hypertrophy, arteriosclerosis.
But, with the research of hypotensive effect genes involved very limited [Drugs, 2004; 64 (16): 1801-1816].Only report comprises that there are the incidence relation of gene pleiomorphism and depressor curative effect in nitricoxide synthase (NOE) gene pleiomorphism and diuretic(s), α-adducin gene pleiomorphism and diuretic(s), G protein alpha-subtype gene polymorphism and beta-2 adrenoceptor retarding agent and ACE gene pleiomorphism and angiotensin-ii receptor (AT1-R) antagonist etc.
Angiotensin-ii receptor 1 (AT1-R) antagonist (sartans) is a clinical the most frequently used line depressor.The mechanism of action of such medicine is optionally to combine with AT1-R, suppresses the contracting blood vessel function of Angiotensin II and makes blood pressure drops.Sartans is also protected the potassium natriuresis because of it and is specially adapted to the treatment that hypertension is followed congestive heart failure and renal failure patient except being used for the treatment of essential hypertension.Chang Yong AT1-R class drug main will comprise clinically: losartan (Losartan), valsartan (Valsartan), irbesartan (Irbesartan), Kang Deshatan (Candesartan), eprosartan (Eprosartan), Tasosartan (Tasosartan) and telmisartan (Telmisartan) etc.
Although sartans as a clinical new line antihypertensive drugs product of releasing, though efficacy of antihypertensive treatment is reliable and side effect is less, also is difficult to overcome many deficiencies, as still has the part patient insensitive to this type of medicine, show as the step-down onset slowly, weak curative effect; Drug side effect has appearred in a few patients, comprises cough and angioedema (similar to angiotensin-convertion enzyme inhibitor class medicine, but incidence is relatively low), liver toxicity and hyperglycemia and anaemia reaction etc.For example Reeves etc. discovers that to 2955 adult hyperpietic's irbesartan step-downs treatments about 44% patient does not reach satisfied clinical efficacy of antihypertensive treatment (Hypertension.1998; 31 (6): 1311-6).The research of GuthrieR etc. also shows, after irbesartan treatment course of treatment of continuous 12 weeks, 150-300mg/d, 53% the patient's efficacy of antihypertensive treatment of only having an appointment is remarkable.
Existing pharmacogenomics research report at irbesartan is the large-scale clinical study of a Sweden, i.e. SILVHIA test.This research finds successively, has the mononucleotide polymorphism site of a plurality of genes may be relevant with the improvement effect of the efficacy of antihypertensive treatment of irbesartan or left ventricular hypertrophy in the renin-angiotensin-aldosterone system path.The gene that this research has been reported comprises, angiotensinogen gene, angiotensin-converting enzyme gene, angiotensin-ii receptor 1 gene and aldosterone synthase gene (Am J Hypertens.2004; 17 (1): 8-13.J Hypertens.2001; 19 (10): 1783-7.J Hypertens.2002; 20 (4): 657-63.Am J Hypertens.2002; 15 (5): 389-93.).In addition, may some relevant other genetic polymorphisms comprise the main metabolic enzyme-Cytochrome P450 of apolipoprotein B gene (APOB), ldl receptor gene (LDL-R), transforming growth factor gene (TGF β 1), preproendothelin gene (preproendothelin-1) and irbesartan-2C9 gene (CYP2C9) (BMC Cardiovasc Disord.200428 with the drug reaction of irbesartan; 4 (1): 16.Clin Cardiol.2004; 27 (5): 287-90.Clin Cardiol.2004; 27 (3): 169-73.J Hypertens.2002; 20 (10): 2089-93.).So far do not see the association study of adrenergic receptor gene and irbesartan efficacy of antihypertensive treatment, do not see the test kit product that research causes at the irbesartan pharmacogenomics yet.
Summary of the invention
The technical problem that solves
Because there is individual difference in drug reaction, the clinician is selecting medicine to lack enough personalized medicine foundations so far, be difficult to accomplish to provide the compatibility of drugs and the dosage of " formula of cutting the garment according to the figure " for patient, can not be immediately, the risk that takes place of controlling blood pressure and toxic side effect effectively, even may delay treatment opportunity, cause patient health and dual economically loss.
In view of above-mentioned deficiency, blindness when the present invention is intended to overcome selection of clinical angiotensin-ii receptor 1 (AT1-R) antagonist or develops the novel composition of combination with it, for personalized medicine provides method, test kit and the application thereof of the effect of a kind of prediction angiotensin-ii receptor 1 (AT1-R) antagonist class medication medication, be convenient to instruct clinical application.
Technical scheme
For achieving the above object, take following technical scheme:
A kind of pharmaceutically-active method of predicting angiotensin-ii receptor 1 agonist hypotensor, this method is by measuring biological sample adrenoceptor α 1a gene polymorphism sites genotype, the hypotensive effect of prediction angiotensin-ii receptor 1 agonist hypotensor, wherein adrenoceptor α 1a gene polymorphism sites is an adrenoceptor α 1a gene A rg347Cys polymorphism:
When a) adrenoceptor α 1a gene genotype was the 347Arg/Arg homozygous wildtype, the hypotensive effect of prediction angiotensin-ii receptor 1 antagonist was poor;
When b) adrenoceptor α 1a gene genotype was 347Cys/Arg heterozygote or 347Cys/Cys homozygous mutation type, the hypotensive effect of prediction angiotensin-ii receptor 1 antagonist was good.
The method that said determination adrenoceptor α 1a gene polymorphism sites genotype adopts is selected from a kind of in the biological detecting methods such as PCR, gene chip, gene sequencing, genescan, Taqman.PCR, gene chip, gene sequencing, genescan genotype detection method are the conventional methods of using of those skilled in the art, and the Taqman technology is a kind of method of using the fluorescence technique real-time quantitative PCR, and specific operation process is seen the embodiment of the invention 1.Wherein preferred detection method is PCR or Taqman technology.
Above-mentioned biological sample is a kind of in blood sample, oral mucosa examination, saliva sample, the urine sample.Wherein, preferred biological specimen is periphery whole blood or blood cell sample.
Above-mentioned angiotensin-ii receptor 1 agonist hypotensor is selected from irbesartan (Irbesartan), losartan (Losartan), valsartan (Valsartan), telmisartan (Telmisartan/Micardis, telmisartan), Candesartan (Candesartan, Kang Deshatan), eprosartan (Eprosartan, Eprosartan), a kind of in Olmesartan (OlmesartanMedoxomil, olmesartan medoxomill), Tasosartan (Tasosartan/Verdia) and their active metabolite, salt or the ester class.Wherein preferred irbesartan or losartan, they are medicines commonly used, representative in the angiotensin-ii receptor 1 agonist hypotensor thing.
The pharmaceutically-active test kit of a kind of prediction angiotensin-ii receptor 1 agonist hypotensor, comprise the nucleic acid-templated genotypic reagent of adrenoceptor α 1a gene polymorphism sites of measuring biological sample, PCR reaction reagent, digestion with restriction enzyme reaction reagent or Taqman reaction reagent, specific probe are wherein arranged.
Wherein the PCR reaction reagent contains following specific primer sequence:
Forward primer: 5 ' GGTGTAGCCCAGGGCATGTT3 '
Reverse primer: 5 ' CCATGCTCCAGCCAAGAGTTC3 '
Wherein specific probe is for detecting the wild-type probe and the mutant probe of adrenoceptor α 1a gene polymorphism sites, and their sequence is respectively:
Wild-type probe: 5 ' TGCTTTCTGCAGAGACA3 ';
Mutant probe: 5 ' TCTGCGGAGACACTG3 '.
The reagent of biological sample amplifying nucleic acid template wherein, PCR reaction reagent, the reagent that does not specialize in digestion with restriction enzyme reaction reagent or the Taqman reaction reagent are the conventional reagent that use of those skilled in the art.
The biological sample kind that is wherein detected is one or more in blood sample, oral mucosa examination, saliva sample, the urine sample.This is periphery whole blood or blood cell sample for the blood sample of wherein said detection.
Above-mentioned angiotensin-ii receptor 1 agonist hypotensor is selected from a kind of in irbesartan, losartan, valsartan, telmisartan, Candesartan, eprosartan, Olmesartan, Tasosartan and their active metabolite, salt or the ester class.
Above-mentioned prediction angiotensin-ii receptor 1 agonist hypotensor drug effect is prediction angiotensin-ii receptor 1 agonist hypotensor hypotensive effect.
Test kit provided by the invention prediction angiotensin-ii receptor 1 agonist hypotensor drug effect, its process comprise (a) from take from examined extract the periphery Trace Blood sample nucleic acid-templated; (b) with the special segment on the PCR method amplification PRCP gene; (c) with restriction enzyme the PCR product being carried out enzyme cuts; (d) carry out (b) (c) step with the positive control template simultaneously; (e) the electrophoretic separation enzyme is cut product, identifies and judged result according to the banding pattern characteristics of positive template.
Test kit provided by the invention prediction angiotensin-ii receptor 1 agonist hypotensor drug effect, its process comprise (a) from take from examined extract the periphery Trace Blood sample nucleic acid-templated; (b) with the special segment on the Taqman method amplification PRCP gene; (c) identify also judged result.
A kind of pharmaceutically-active method of predicting angiotensin-ii receptor 1 agonist hypotensor, this method is by measuring biological sample adrenoceptor α 1a gene polymorphism sites genotype, the hypotensive effect of prediction angiotensin-ii receptor 1 agonist hypotensor.Method of the present invention also can be in medicament research and development application.
Above-mentioned application is meant the hypotensive effect according to polymorphism genetype for predicting angiotensin-ii receptor 1 agonist hypotensor of adrenergic receptor gene, design and regulate the compound medicines that the adrenoceptor function can strengthen angiotensin-ii receptor 1 antagonist class medicine hypotensive effect, described compound medicines comprises selectivity or nonselective angiotensin II receptor antagonists and selectivity or nonselective adrenoceptor retarding agent.
The present invention studies based on pharmacogenomics for many years.Carry out the step-down treatment by take irbesartan to the hyperpietic, investigate the relation of inherited genetic factors and curative effect of medication.Irbesartan is a kind of in the angiotensin-ii receptor 1 agonist hypotensor thing, optionally combine with AT1-R, thereby the vasoconstriction effect that suppresses Ang II makes blood pressure drops, clinically is used for the step-down treatment.The transformation period of irbesartan is grown (being about 19 hours), therefore is suitable for taking medicine every day once, and common dose is 150-300mg/ days, and clinical being widely used in treated light, moderate essential hypertension.
The gene pleiomorphism of studying among the present invention is a α 1a adrenergic receptor gene polymorphism.α 1a adrenoceptor is one of three hypotypes of alpha adrenergic receptor, and ADR α 1a is main hypotype [the Proc Natl Acad Sci USA.2002 that participates in peripheral vascular resistance and systemic arterial pressure adjusting in animal and human's body; 99 (14): 9474-9.Epub 2002Jul 01].A polymorphism performance of ADR α 1a gene is the sudden change of the 1441st Nucleotide C to T, cause the 347th arginine of polypeptide chain (Arg) to be substituted by halfcystine (Cys), this polymorphic site is amino acid whose acidylate site at ADR α 1a C-terminal and G albumen coupling, and the location of pair cell and function have important effect [Br J Pharmacol.1996; 118 (6): 1403-8.].α 1a adrenoceptor is distributed in the human artery and vein vascular system widely.The distribution frequency at seat such as α 1a adrenoceptor 347Cys there are differences in not agnate crowd, wherein white man be 53.8%, Black people 29.5%, Japanese 10%.
What the present invention relates to discovers:
After the 1 antagonist class pharmacological agent of hypertensive patient's menses angiotensin II acceptor, taking medicine back the 28th day, seat carrier's such as 347Cys hypotensive effect significantly is better than the individuality that the wild homozygous allelotrope of 347Arg/Arg carries.Prompting ADR α 1a gene A rg347Cys polymorphism is relevant with the hypotensive effect of angiotensin-ii receptor 1 antagonist class; ADR α 1a gene genotype, as one of indication mechanism of predicting angiotensin-ii receptor 1 antagonist class antihypertensive drug, can indicate and qualitative and predict quantitatively and the drug effect of angiotensin-ii receptor 1 agonist hypotensor instruct clinician's personalized medicine.
ADR α 1a gene genotype, as one of indication mechanism of prediction angiotensin-ii receptor 1 antagonist class antihypertensive drug: metabolism (enzyme) activity/functional status that can indicate ADR α 1a gene pleiomorphism correspondence, function target spot as new drug instructs the research and development of compound antihypertensive drug; And can indicate compound antihypertensive drug in conjunction with development, the more individual dose,optimum of choose reasonable angiotensin-ii receptor 1 antagonist class medicine and the compatibility of suitable combination drug.
Human beta-2 adrenoceptor (β ARs) belongs to Gs protein coupling receptor superfamily member, plays an important role in cardiovascular function and disease, plays a role by neurohormone norepinephrine and suprarenin.The activation of β 1AR and β 2AR causes the positive inotropic and the positive chronotropic action of cardiac muscle.β 1AR mainly is distributed in heart, has represented 80% myocardial cell β AR.The β 1AR of kidney and β 2AR activate the release of feritin, thus the activation renin-angiotensin-aldosterone system.β 2AR also is present in artery, causes vasorelaxation after the activation.β 3AR is in the news recently, thinks in essence main relevant with metabolism, also may with catecholamines to relevant [the Can J.Physiol.Pharmacol.2000 of the negative inotropic action of heart; 78:681-690.].
β 1AR intronless is positioned 10q24-26.Belong to the g protein coupled receptor superfamily member, comprise the outer aminoterminal of born of the same parents, stride carboxyl terminal in film district and the born of the same parents for 7.There is the multidigit point in the gene pleiomorphism of β 1AR, has reported 14 kinds of polymorphisms, and wherein 5 kinds belong to sudden change unintentionally.Wherein, adrenoceptor β 1 gene, the 389th amino acids sports glycine (Arg389Gly) by arginine, carries active slight rising of the adenylate cyclase of Arg389 individuality; Binding ability to agonist is strong; Maximum Racemic isoproterenol irritation level height.
Human beta 2 adrenoreceptor belongs to G protein coupling receptor superfamily member, and molecular weight is 6400D, is that first adenosine cyclase of being cloned connects acceptor, by 413 amino acid, forms 7 bunches of hydrophobic groupings.Be the transbilayer helix district, each transbilayer helix district is made up of 20～30 amino acid, and N-holds outside born of the same parents, contains two glycosylated l-asparagines, and C-holds in born of the same parents, is 3 ring texturees.Its gene order by clone, order-checking, is positioned 5q31-32.[Kobilka BK, et al.ProcNatl Acad Sci USA, 1987,84:46-50.], and have two outstanding features: the gene of intronless and two promotors [Kobilka BK etal.J Biol Chem, 1987,262 (15): 7321-7327.] are efficiently arranged.β 2-AR combines with β2Ji Dongji and plays a role, lax bronchial smooth muscle cell.
Human β 2AR gene and wild-type relatively contain 9 site mutations, and wherein 4 belong to the non-degeneracy site mutation, and have produced amino acid whose change (Arg-Gly 16, and Gln-Glu 27, and Val-Met 34, and Thr-Ile 164).Wherein three mutational sites (16,27,164) can cause the function of receptors variation, Ile 164 shows as with the sweet cyclase coupling function of gland and descends, Gly 16 can strengthen the receptor response decline of agonist induction, and 27 demonstrations of Gln have resistivity to the receptor response decline of agonist induction.β 2AR gene promoter area also finds to exist polymorphism to change, they are positioned at the 1470bp of β 2AR coding region 5 ' end, have 8 kinds of polymorphisms (20T～C ,-47T～C ,-367T～C,-468C～G,-654G～A ,-1023G～A ,-1343A～G,-1429T～A), and find that some sudden change can change the genetic expression of β 2AR coding region, catchment.
Beneficial effect
The invention provides a kind of method of utilizing functional gene prediction angiotensin-ii receptor 1 antagonist class curative effect of antihypertensive drug, can be used as the pharmaceutically-active indication mechanism of angiotensin-ii receptor 1 agonist hypotensor, by measuring adrenergic receptor gene polymorphic site genotype, the drug effect of prediction angiotensin-ii receptor 1 agonist hypotensor.According to adrenoceptor polymorphism genotype, design and regulate the compound medicines that the adrenoceptor function can strengthen angiotensin-ii receptor 1 antagonist class medicine hypotensive effect, being convenient to the doctor selects according to individual difference when medication, improve the efficient and the security of clinical application and treatment, reduced risk and economical load that toxic side effect takes place.Use the invention achievement of this class functional gene polymorphism, select medicine, prediction medication curative effect and instruct new drug development to have the using value of industry and service instructing the clinical of antihypertensive drug from now on more economically effectively.
Embodiment
Embodiment 1: measure ADR α 1a gene A rg347Cys pleomorphism site and predict the hypotensive effect of calcium antagonist hypotensor nifedipine
(1) the Arg347Cys polymorphic site genotype of mensuration ADR α 1a gene:
(1) genomic dna of extraction host cell:
(a) add the 30ml erythrocyte cracked liquid in whole blood, slowly shake up, room temperature left standstill 10 minutes, during, shake for several times, thoroughly splitting erythrocyte;
(b) in 4 ℃, 2000 leave the heart/minute, 10 minutes, remove supernatant, the white corpuscle that will precipitate is broken up on the oscillator in rotation, adds proteolytic enzyme 40ul, RNA enzyme 50ul, shakes up, and adds write cell lysis buffer and puts 15ml, 37 ℃ of water-baths of mixing were taken out after 20 minutes, put in the cold water;
(c) add cold albumen precipitation liquid 4ml, be placed on-20 ℃ of refrigerators 5 minutes behind the mixing, take out in 4 ℃, 3000 rev/mins centrifugal 10 minutes.Supernatant liquor poured into slowly shake in the 50ml centrifuge tube that has added the 15ml Virahol for several times, separate out to the DNA floss;
(d) the DNA floss of separating out is moved to another 1.5ml and has packed on the 75% alcoholic acid filter paper, make evaporate dried.
(e) add DNA hydrating fluid 1.5ml, put shaking table, shaken over night, standby;
(f) mensuration of DNA concentration adopts ultraviolet spectrophotometry, measures the OD value under two wavelength of 260nm and 280nm respectively, is DNA concentration with OD260nm * 50 income values.And with OD260nm/OD280nm ratio estimation DNA purity;
(2) use the Taqman method to detect Arg347Cys polymorphic site genotype
(a) with PCR instrument amplification ADR α 1a functional gene polymorphic site and flanking sequence thereof, in 5ul PCR reaction system, contain genomic dna 10ng, 2.5ul Taqman_2X Universal PCR Master Mix No AmpEraseUNG (composition comprises: AmpliTaq Gold DNA Polymerase, dNTPs with Dutp, PassiveReference, with the damping fluid of optimizing), and the forward primer of 0.72uM, each 0.16uM of allele-specific probe of the reverse primer of 0.72uM and two sections band fluorescence report groups.
Primer sequence is
Forward primer: 5 ' GGTGTAGCCCAGGGCATGTT3 '
Reverse primer: 5 ' CCATGCTCCAGCCAAGAGTTC3 '
The sequence of allele-specific probe is:
VIC-5’TGCTTTCTGCAGAGACA3’-NFQ，
Corresponding to " A (or Cys) " allelotrope, carry VIC fluorescence report group.
FAM-5’TCTGCGGAGACACTG3’-NFQ
Corresponding to " G (or Arg) " allelotrope, carry FAM fluorescence report group.
The PCR reaction conditions:
95 ℃ of 10min, 1 circulation;
92℃ 15s，
60℃ 1min，
50 circulations.
(b) on 7900 type quantitative real time PCR Instruments, detect fluorescence information
The PCR plate of finishing the PCR reaction is put on the 7900 type quantitative real time PCR Instruments, is selected for use " AllelicDiscrimination " program, scan judgement with the result:
The genotype of sending FAM fluorescence person is the Arg/Arg homozygote;
The genotype of sending VIC fluorescence person is the Cys/Cys homozygote;
The genotype of sending two kinds of fluorescence persons is the Arg/Cys heterozygote.
(2) prediction drug effect:
To primary hypertension patient, genotype is that seat carrier's such as 347Cys hypotensive effect significantly is better than the individuality that the wild homozygous allelotrope of 347Arg/Arg carries.
Above method is divided into groups primary hypertension patient by clinical verification; ADR α 1a genotype grouping (homozygous wildtype group, heterozygosis subtype group+homozygous mutation type group).Gave irbesartan respectively 28 days, and observed its hypotensive effect, the result is as follows:
Diastolic pressure (DBP) antihypertensive effect that primary hypertension patient was taken after the irbesartan the 28th day carries at seats such as 347Cys and significantly is better than 347Arg/Arg homozygote (P＜0.05) in the individuality, and prompting ADR α 1a gene 347Arg/Cys polymorphism can be predicted the antihypertensive effect of irbesartan.Table 1 is the hypotensive effect according to the observed irbesartan of biological specimen genotype.
Table 1.ADR α 1a gene A rg347Cys polymorphic site reduces the prediction of diastolic pressure effect to irbesartan
| Genotype | The example number | Means standard deviation | The P value |
| Arg/Arg Arg/Cys+Cys/Cys | 920 193 | 6.1±8.3 7.8±8.0 | - 0.033 |
Embodiment 2: test kit is formed (Taqman method) and is used
1, reagent constituents comprises:
A liquid: Taqman 2X Universal PCR Master Mix No AmpErase UNG (composition comprises: AmpliTaqGold DNA Polymerase, dNTPs with Dutp, Passive Reference, the damping fluid of having optimized);
B liquid: forward primer, reverse primer; Primer sequence is
Forward primer: 5 ' GGTGTAGCCCAGGGCATGTT3 '
Reverse primer: 5 ' CCATGCTCCAGCCAAGAGTTC3 '
C liquid: the allele-specific probe of two sections band fluorescence report groups, sequence is:
VIC-5’TGCTTTCTGCAGAGACA3’-NFQ，
Corresponding to " A (or Cys) " allelotrope, carry VIC fluorescence report group.
FAM-5’TCTGCGGAGACACTG3’-NFQ
Corresponding to " G (or Arg) " allelotrope, carry FAM fluorescence report group.
2, use this test kit amplification functional gene polymorphic site and flanking sequence thereof and the genotypic step of detection pleomorphism site as follows: amplifying target genes fragment: in 5ul PCR reaction system, contain genomic dna 10ng, 2.5ul A liquid, and 0.72uM B liquid and 0.16uM C liquid, carry out the PCR reaction by following condition:
On 7900 type quantitative real time PCR Instruments, detect fluorescence information
The PCR plate of finishing the PCR reaction is put on the 7900 type quantitative real time PCR Instruments, is selected for use " AllelicDiscrimination " program, scan judgement with the result:
The genotype of sending FAM fluorescence person is the Arg/Arg homozygote;
The genotype of sending VIC fluorescence person is the Cys/Cys homozygote;
The genotype of sending two kinds of fluorescence persons is the Arg/Cys heterozygote.
Claims (15)
1. pharmaceutically-active method of predicting angiotensin-ii receptor 1 agonist hypotensor, this method is by measuring biological sample adrenoceptor α 1a gene polymorphism sites genotype, the hypotensive effect of prediction angiotensin-ii receptor 1 agonist hypotensor.
2. the method for claim 1 is characterized in that, is by measuring biological sample adrenoceptor α 1a gene A rg347Cys polymorphism, the hypotensive effect of prediction angiotensin-ii receptor 1 agonist hypotensor.
3. method as claimed in claim 2, it is characterized in that the method that described mensuration adrenoceptor α 1a gene A rg347Cys pleomorphism site genotype adopts is selected from a kind of in the biological detecting methods such as PCR, gene chip, gene sequencing, genescan, Taqman.
4. as arbitrary described method in the claim 1～3, it is characterized in that described biological sample is a kind of in blood sample, oral mucosa examination, saliva sample, the urine sample.
5. as arbitrary described method in the claim 1～3, it is characterized in that: described angiotensin-ii receptor 1 agonist hypotensor is selected from a kind of in irbesartan, losartan, valsartan, telmisartan, Candesartan, eprosartan, Olmesartan, Tasosartan and their active metabolite, salt or the ester class.
6. predict the pharmaceutically-active test kit of angiotensin-ii receptor 1 agonist hypotensor for one kind, comprise the nucleic acid-templated genotypic reagent of adrenoceptor α 1a gene polymorphism sites of measuring biological sample, PCR reaction reagent, digestion with restriction enzyme reaction reagent or Taqman reaction reagent, specific probe are wherein arranged.
7. test kit as claimed in claim 6, wherein the PCR reaction reagent contains following specific primer sequence:
Forward primer: 5 ' GGTGTAGCCCAGGGCATGTT 3 '
Reverse primer: 5 ' CCATGCTCCAGCCAAGAGTTC 3 '.
8. test kit as claimed in claim 6, wherein specific probe is for detecting the wild-type probe and the mutant probe of adrenoceptor α 1a gene polymorphism sites.
9. test kit as claimed in claim 8, wherein specific probe sequence is respectively:
Wild-type probe: 5 ' TGCTTTCTGCAGAGACA3 ';
Mutant probe: 5 ' TCTGCGGAGACACTG3 '.
10. test kit as claimed in claim 6, the biological sample kind that is wherein detected are one or more in blood sample, oral mucosa examination, saliva sample, the urine sample.
11. test kit as claimed in claim 10, this is periphery whole blood or blood cell sample for the blood sample of wherein said detection.
12. test kit as claimed in claim 6 is characterized in that: described angiotensin-ii receptor 1 agonist hypotensor is selected from a kind of in irbesartan, losartan, valsartan, telmisartan, Candesartan, eprosartan, Olmesartan, Tasosartan and active metabolite thereof, salt or the ester class.
13. test kit as claimed in claim 6 is characterized in that: described prediction angiotensin-ii receptor 1 agonist hypotensor drug effect is prediction angiotensin-ii receptor 1 agonist hypotensor hypotensive effect.
14. the application of the described method of claim 1 in medicament research and development.
15. application as claimed in claim 14, it is characterized in that, described application is meant the hypotensive effect according to polymorphism genetype for predicting angiotensin-ii receptor 1 agonist hypotensor of adrenergic receptor gene, design and regulate the compound medicines that the adrenoceptor function can strengthen angiotensin-ii receptor 1 antagonist class medicine hypotensive effect, described compound medicines comprises selectivity or nonselective angiotensin II receptor antagonists and selectivity or nonselective adrenoceptor retarding agent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510011681 CN1858242A (en) | 2005-04-30 | 2005-04-30 | Method for predicting angiotonin II receptor agonist hypotensor medicine function and its use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510011681 CN1858242A (en) | 2005-04-30 | 2005-04-30 | Method for predicting angiotonin II receptor agonist hypotensor medicine function and its use |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1858242A true CN1858242A (en) | 2006-11-08 |
Family
ID=37297200
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200510011681 Pending CN1858242A (en) | 2005-04-30 | 2005-04-30 | Method for predicting angiotonin II receptor agonist hypotensor medicine function and its use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1858242A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109207586A (en) * | 2018-11-06 | 2019-01-15 | 宁波艾捷康宁生物科技有限公司 | Gene SNP site is applied in hypertension individuation drug therapy genotype detection and kit |
-
2005
- 2005-04-30 CN CN 200510011681 patent/CN1858242A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109207586A (en) * | 2018-11-06 | 2019-01-15 | 宁波艾捷康宁生物科技有限公司 | Gene SNP site is applied in hypertension individuation drug therapy genotype detection and kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Crisan et al. | Angiotensin I-converting enzyme: genotype and disease associations | |
| US6521747B2 (en) | Haplotypes of the AGTR1 gene | |
| US6525185B1 (en) | Polymorphisms associated with hypertension | |
| AU2018202373A1 (en) | Method of identifying disease risk factors | |
| CN109082464B (en) | Primer group and kit for detecting hypertension drug metabolism related genes | |
| JP2012507297A (en) | Method for treating psychosis and schizophrenia based on ERBB4 gene polymorphism | |
| WO2007143617A1 (en) | Warfarin dosage prediction | |
| JP5608944B2 (en) | Identification of hypertension susceptibility genes | |
| CN1858240B (en) | Method for predicting angiotonin II receptor agonist hypotensor function and use | |
| EP1130123A2 (en) | Diagnostic method | |
| CN110257506B (en) | Polymorphism detection kit and method for hypertension accurate medication related gene | |
| US10258606B2 (en) | Endothelin single nucleotide polymorphisms and methods of predicting β-adrenergic receptor targeting agent efficacy | |
| CN1858242A (en) | Method for predicting angiotonin II receptor agonist hypotensor medicine function and its use | |
| CN1858243A (en) | Method for predicting angiotonin II receptor agonist hypotensor medicine function and its use | |
| CN1858241A (en) | Method for predicting angiotonin II receptor agonist hypotensor function and use | |
| JP4532750B2 (en) | CYP2A6 gene diagnosis method | |
| CN1827776A (en) | Method for predicting calcium antagonist medicine effect and application thereof | |
| CN1810986A (en) | Method of predicting medicine effect of calcium agonist as hypotensor and its application | |
| JP2008528054A (en) | Pharmacogenomics of antihypertensive agents | |
| CN1465712A (en) | Kit for5 forecasting ACEI group hypotensor effect, method, software and compound medicine thereof | |
| EP1549770A2 (en) | Methods to predict cholesterol elevations during immunosuppressant therapy | |
| JP5757647B2 (en) | SNP marker for hypertension, method for determining risk of developing hypertension, and method for using small animals susceptible to hypertension susceptibility genes | |
| CN101063165A (en) | Method for predicting action effect of angiotensin conversion enzyme inhibitor medicament | |
| US20070122803A1 (en) | Methods for the detection of polymorphisms in the human oatpf gene | |
| EP1280814A1 (en) | Association of beta2 adrenergic receptor haplotypes with drug response |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Owner name: ANHUI BIOLOGICAL MEDICAL INST.; APPLICANT Free format text: FORMER OWNER: ANHUI BIOLOGICAL MEDICAL INST. Effective date: 20080815 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20080815 Address after: 153, Medical University Of Anhui, 81 Mei Shan Road, Anhui, Hefei Province, China: 230032 Applicant after: Anhui Institute of biomedical research Co-applicant after: AUSA Pharmed Ltd. Address before: 153, Medical University Of Anhui, 81 Mei Shan Road, Anhui, Hefei Province, China: 230032 Applicant before: Anhui Biological Medical Science Inst. |
|
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20061108 |