CN101063165A - Method for predicting action effect of angiotensin conversion enzyme inhibitor medicament - Google Patents

Abstract

The invention discloses a method to estimate BenNaPuLi and so on blood vessel nerves factor invertase depressant (ACEI) action effect with mononucleotide polymorphism site genetic type and appliance, which is characterized by the following: relating Glu112Asp polymorphism of praline carboxypeptidase gene (PRCP) with decompression effect of BenNaPuLi; carrying 112Asp allele of individual; possessing bad reaction for BenNaPuLi; possessing small dropping amplitude of blood pressure; using to forecast decompression effect of ACEI medicine with PRCP gene E112D polymorphism or other genetic polymorphism with chain relation. This invention can improve availability and safety of clinical medicine, which provides criterion for new medicine to treat high blood pressure.

Description

The method of prediction action effect of angiotensin conversion enzyme inhibitor medicament

Technical field

The present invention relates to a kind of by measuring the single nucleotide polymorphism (SNP) of the important enzyme gene on the adjusting of blood vessel and endothelial function, the Angiotensin II degraded path, the method for prediction action effect of angiotensin conversion enzyme inhibitor medicament.Belong to field of medicaments.

Background technology

Essential hypertension is one of China and global modal chronic disease.The hypertensive patient whole world has 6.9 hundred million people approximately, and sickness rate is up to 31.3%.Epidemiological study shows that blood pressure level and cardiovascular diseases sickness rate are linear dependence; Elevation of blood pressure is the independent hazard factor of cerebral apoplexy and incidence of coronary heart disease.Hypertension is to cause the life-threatening heart, cerebro-vascular diseases such as myocardium infarct, cerebral apoplexy, the not congruent major cause of renal function.Therefore, the effective clinical meaning of controlling blood pressure to preventing that having of hyperpietic's cardiovascular and cerebrovascular complication is great.

Renin-angiotensin-aldosterone system (RAAS) plays an important role in body blood pressure regulation and hypertension incidence.Proangiotensin changes into angiotensin I under the feritin effect, the effect of menses angiotensin saccharase (ACE) again, generate Angiotensin II, Angiotensin II can cause vasoconstriction, stimulate the aldosterone secretion, myocardial hypertrophy, vessel wall thickening etc., thus cause elevation of blood pressure and promote hypertensive generation.

Be used for the treatment of hypertensive drug main clinically and will be divided into six classes: diuretic(s), receptor, retarding agent, alpha-2-adrenoceptor retarding agent, calcium antagonist, angiotensin converting enzyme inhibitor (ACEI) and angiotensin-ii receptor (AT1-R) antagonist.Back both is the antihypertensive drug that acts on the RAAS system.In order to reduce relevant case fatality rate and disability rate, the hyperpietic need take antihypertensive drugs usually for a long time.

Though it is people are more and more perfect to the understanding and the intervention of blood pressure, still dissatisfied for the blood pressure compliance rate of hyperpietic's step-down treatment.The reason of the low inverse amplification factor of blood pressure is many-sided, as the understanding difference of doctor to controlled target, the patient can not change bad life habits, medicine is not tolerated, the treatment compliance is poor, the controlling of blood pressure rates low (40%-50%) of single therapy etc. be the more important thing is, with shortage is effectively relevant at patient individual difference's curative effect of medication prognoses system clinically.Be used to predict the clinical experience of the method for curative effect of medication simply by virtue of the doctor clinically, this Forecasting Methodology has tangible hysteresis quality and blindness, can not select medicine that individuation information accurately is provided to the doctor.

Zinadril Briem (benazepril) is a kind of non-sulfydryl angiotensin-convertion enzyme inhibitor (ACEI), is widely used in the step-down treatment at present, and it mainly brings into play the step-down drug effect by the activity that suppresses ACE enzyme in the RAAS system.But drug effect exists remarkable individual difference, and generally speaking the Zinadril Briem of 10mg is effective to 50% light moderate hypertension patient approximately.Medicine needs the process competence exertion effect of process transhipment (absorb, distribute, drain) and conversion (metabolism) in human body; Medicine is brought into play the participation that effect needs some media equally in vivo, as promoting or suppress the activity of corresponding enzyme, activates or blocks corresponding acceptor etc., carries out a series of signal conduction afterwards again, finally causes biological effect.The gene that coding participates in the enzyme, acceptor of said process etc. is undergone mutation and may be caused enzymic activity and quantity, function of receptors etc. to change, thereby produces different effects.

Thinking that at present the individuation difference of medicine is the phenotype of a complexity, is the coefficient result of h and E factor.The individual difference of known drug curative effect and side effect is relevant with inherited genetic factors.Find that in family and twin study about 30%～60% blood pressure variation causes [Lancet, 1994 by inherited genetic factors; 344:169-171], and have the monogenic inheritance hypertension of small portion.The genetic polymorphism of drug reaction shows as the polymorphism of drug metabolism enzyme, the polymorphism of drug receptor and the polymorphism of drug targets etc.The existence of these polymorphisms may cause individual difference [Science, 2000 of drug effect and untoward reaction in many pharmacological agenies; 287:1977-1978] [J Clin Invest, 1994; 94; 1872-1882].

The gene pleiomorphism that disease-related or drug reaction are relevant is the important genetics basis of drug reaction individual difference.Pharmacogenomics is means of utilizing high-throughout genomics and information biology, analyze with find may be relevant with disease incidence difference or drug reaction difference the candidate because of and single nucleotide polymorphism (SNP), for the individual difference of predict drug response provides heredity mark (Genetic marker).In order to predict that the patient is to a certain kind or the issuable drug reaction of certain drug (curative effect and/or toxic side effect), for the clinician selects curative effect higher according to personal feature, the treatment plan of the more individuation that toxic side effect is lower, reduce avoidable medical expense, objective reference frame is provided.

SNP is meant the single nucleotide variations on gene level between Different Individual, and a SNP, nearly 3,000,000 SNP between two irrelevant individualities appear in average per 1000 pairs of bases.SNP is very important on personalized medicine.The factor that influences drug effectiveness comprises that prodrug activates because of metabolism, the binding ability of medicine and target cell, and medicine combines and activity with the medicine target, and active medicine is by metabolism, degraded and discharge; Medicine metabolism, degraded and discharge link and medicine non-specific binding and activity in vivo in vivo then depended in the security of medicine.There is the idiogenetics feature difference of SNP loci gene type in arbitrary place on these links, finally all may show as the differential responses difference (curative effect or side effect) of Different Individual to same medicine, and its difference can reach hundreds of times sometimes.

Find that at present the genes involved that essential hypertension relates to surpasses 70, the curative effect of medication that different genes causes has difference to the hyperpietic.Most researchs concentrate on the influence of observing the gene pleiomorphism cardiovascular response that treatment causes to antihypertensive drugs.For example, carry the hyperpietic at α-seats such as adducin gene 460W, compare with using other hypotensor treatments, the probability that myocardial infarction and apoplexy appear in diuretic therapy reduces [Lancet, 1997; 349:1353-7].Aspect hypotensive effect, find that nitricoxide synthase (NOE) gene pleiomorphism and diuretic(s), α-adducin gene pleiomorphism and diuretic(s), G protein alpha-subtype gene polymorphism and receptor, retarding agent, ACE gene pleiomorphism and angiotensin-ii receptor (AT1-R) antagonist etc. all exist interaction [Drugs, 2004; 64:1801-1816].There are interaction in polymorphism and ACEI that ACE inserts disappearance, show as the difference of different genotype at aspects such as the mRNA of AT1 receptor protein expression, left ventricular hypertrophy, arteriosclerosis.

Proline carboxypeptidase (PRCP) is the nervous plain II degrading enzyme of a kind of important vessel.Equaling nineteen sixty-eight by Yang HYT at first finds.PRCP equals at 5 o'clock at pH, has best enzymic activity, the 20-50% when enzymic activity only is left maximum when pH is elevated to 7.PRCP belongs to the serine stretch protein enzyme family, and activity can be suppressed by phenylmethylsulfonyl fluoride (PMSF).Studies show that in a large number PRCP can be at the outer film expression of endotheliocyte.The PRCP Angiotensin II of degrading makes that having the vasoactive Angiotensin II that contracts strongly is transformed into and has vasodilator active hypertensin 1-7, participates in the adjusting of RAAS system function.In addition, PRCP still is the plasmakinin activation of zymogen thing outside a kind of XIIa of being independent of, and can make kininogenase activate and generate bradykinin.The Angiotensin II because PRCP can degrade, the generation that increases hypertensin 1-7 can promote the release of bradykinin again, two kinds of effects can both make the generation of NO increase, and then vasodilator, play the effect that brings high blood pressure down.The PRCP assignment of genes gene mapping is in human chromosomal 11q14 zone.Be positioned at the base mutation of an A-C on its exon, caused the 112nd amino acids to become aspartic acid (Asp) by L-glutamic acid (Glu).We discover, the expression of this pleomorphism site and the mRNA of PRCP and activity etc. are relevant.In view of the important regulating effect of PRCP to RAAS system and blood pressure, this functional mononucleotide polymorphism site probably can have influence on the curative effect of ACEI class medicine.

Hyperpietic's efficacy of antihypertensive treatment is relevant with the gene pleiomorphism of homocysteine (Hcy) path.Gene pleiomorphism relevant with ACEI hypotensor curative effect [Thrombosis Research 2004,113:361-369] that there are some researches show Methylene tetrahydrofolate reductase (MTHFR) C677T.Primary hypertension patient for 444 China carries out the step-down treatment of the ACEI hypotensor thing Zinadril Briem in 2 weeks by a definite date, results suggest MTHFR C677T gene is that primary hypertension patient and the genotype of TT is that the patient of CT or the CC basic blood pressure value of comparing obviously increases, and it is better for the antihypertensive effect of ACEI hypotensor thing, especially better for the antihypertensive effect of diastolic pressure.

Because the individual difference of drug reaction is a complicated phenotypic characteristic, is by multiple inherited genetic factors and the interactive result of multiple environmental factors.From now on according to the therapeutic regimen of the individuation of the genotypic environment characteristic Design of individual patient, need the doctor when selecting the treatment hypertension drug, can synthetically expect the reaction that the patient produces specific medicine according to the multiple hereditary feature of patient, select for the suitableeest treatment plan of respective patient individuality, instruct the doctor that the medical service of individuation is provided for the patient.

Summary of the invention

In order to overcome the blindness of selection of clinical ACEI class medicine, the present invention provides a kind of method of action effect of the ACEI of prediction class medicine for personalized medicine, promptly by measuring the proline carboxypeptidase (Prolylcarboxypeptidase on the Angiotensin II degraded path of regulating blood vessel and endothelial function in the biological sample, PRCP) the pleomorphism site genotype of gene, the action effect of prediction ACEI class medicine.Analyzing on the genotypic basis of pleomorphism site, can predict that individual patient uses the validity and the security of ACEI class medicine, instructing clinical application, implementing the individuation medical treatment, controlling blood pressure effectively reduces medical treatment cost in early days.

For achieving the above object, take following technical scheme:

The method of the action effect of prediction Zinadril Briem angiotensin-convertion enzyme inhibitor (ACEI) class medicines such as (benazepril) of the present invention, by in the detection of biological sample blood vessel and endothelial function being regulated, the important enzyme of Angiotensin II degraded path is the genotype of the pleomorphism site E112D (rs2298668) of proline carboxypeptidase (PRCP) gene, prediction contains the action effect of ACEI class medicine: when PRCP pleomorphism site genotype is that the mutator gene type is when (comprising 112DD homozygous mutation type and 112ED heterozygous mutant type), a little less than the action effect of prediction ACEI hypotensor thing; When PRCP pleomorphism site genotype was homozygous wildtype 112EE, the action effect of prediction ACEI hypotensor thing strengthened.Forecasting Methodology of the present invention also is the prediction test kit of Application and Development present method development, reaches developmental function and provides foundation in the new drug of proline carboxypeptidase.

In the present invention; described action effect also relates to the target organ protection function that causes because of step-down except the hypotensive effect effect; comprise: renal function protection, complication such as prevention PTCA postoperative restenosis and prevention of arterial sclerosis, coronary atherosclerotic heart disease, stenocardia, myocardial infarction, heart failure, peripheral vascular disease, hematencephalon, cerebral infarction, lacunar infarction, retinal arteriosclerosis.

In embodiments of the invention, described medicine is the medicine that contains ACEI, and the described medicine to be predicted and the action effect of composition thereof mainly are the action effects that brings high blood pressure down.Concrete, ACEI class drug main will be by influencing the action effect that renin-angiotensin-aldosterone system (RAAS) plays blood pressure regulation.ACEI suppresses the activity of angiotensin-converting enzyme (ACE) by combining with angiotensin i-converting enzyme, reaches the generation that suppresses Angiotensin II with this, reduces the secretion of aldosterone; In addition, the degraded of restriction bradykinin, and then activate nitric oxide synthetase, the protection blood vessel inner skin cell function reduces the vessel wall tension force that sympathetic nerve causes, and finally realizes the blood pressure regulation action effect.Being used for the ACEI class medicine that contains of the present invention is selected from: Zinadril Briem (benazepril), captopril (captopril), enalapril (enalapail), Yipingshu (cilazapril), perindopril (perindopril), delapril (delapril), quinapril (quinapril), lisinopril (lisinopril), Ramipril (ramipril), imidapril (imidapril), zofenopril (zofenopril), Trolapril (trandolapril), and fosinopril (fosinopril) etc.Wherein enalapril, Zinadril Briem and lisinopril are medicines commonly used, representative in the ACEI class medicine.Be preferably enalapril, Zinadril Briem, lisinopril or fosinopril.

In the method for the present invention, the efficacy of antihypertensive treatment of described PRCP E112D (rs2298668) pleomorphism site and the ACEI class medicine that comprises Zinadril Briem takes place relevant, has remarkable prediction effect.Concrete, when (1) described PRCP pleomorphism site genotype is 112ED heterozygous mutant gene or pleomorphism site genotype when being 112DD homozygous mutation type, predict that above-mentioned ACEI class medicine and pharmaceutical composition thereof bring high blood pressure down a little less than the action effect; When (2) described PRCP pleomorphism site genotype is the 112EE homozygous wildtype, predict that the action effect that above-mentioned ACEI class medicine and pharmaceutical composition thereof bring high blood pressure down strengthens.

Among the present invention, can utilize the polymorphism parting oligonucleotide to detect the genotype of above-mentioned pleomorphism site, preferably, described polymorphism parting oligonucleotide is: (1) allele-specific nucleic acid primer, the proline carboxypeptidase gene segment that is used to increase and contains described pleomorphism site, it can detect the pleomorphism site genotype of key gene PRCP (proline carboxypeptidase) gene of blood vessel and endothelial function adjusting path, and/or (2) are used to detect the genotypic oligonucleotide probe of pleomorphism site that it can detect key gene PRCP (proline carboxypeptidase) gene of blood vessel and endothelial function adjusting path, it can be specifically can detect the nucleic acid hybridization that blood vessel and endothelial function are regulated the pleomorphism site on key gene PRCP (proline carboxypeptidase) gene of path with it, preferably, the length of oligonucleotide probe is 15-50 Nucleotide.

Thus, the present invention predicts the method for the efficacy of antihypertensive treatment of ACEI class medicine, specifically can may further comprise the steps: 1) utilize the pleomorphism site genotype of above-mentioned polymorphism parting oligonucleotide test kit detection from key gene described in the biological sample of individuality; 2) foundation contains the genotypic predictive model of test sample PRCP pleomorphism site; 3) according to the hypotensive effect effect of described polymorphism site genotype estimation AECI class medicine.

In method of the present invention, can be used for predicting that the pleomorphism site of the action effect of AECI class medicine comprises E112D (rs2298668) pleomorphism site of above-mentioned PRCP at least, can also further comprise and exist other pleomorphism sites of linkage disequilibrium to determine on the same gene near this site with it, such pleomorphism site comprises nonsense mutation site, missense mutation site and the pleomorphism site and the site thereof that are positioned at gene intron position, generegulation position.

Common single nucleotide polymorphism (SNP) site can be positioned at exon position, intron position and the non-coding region position of gene, is preferably the exon position, especially can change the pleomorphism site of amino acid sequence coded.

In method of the present invention, measure the genotype of described pleomorphism site and can use following difference foranalysis of nucleic acids technology:

Polymerase chain reaction (PCR), polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), PCR-alleles-specific oligonucleotide probe method, PCR-sequence specific oligonucleoside acid system, sequencing, PCR-sequence specific primers method, the PCR-fluorescent method, the PCR finger-printing method, oligonucleotide connects to be analyzed, the detection method of fluorescent energy resonance transfer, biochip, nucleic acid chip, mass-spectrometric technique, genescan, single strand conformation polymorphism, denaturing gradient gel electrophoresis, enzyme or chemical mispairing patterning method, the Taqman biological detecting method.Wherein preferred detection method is PCR, PCR-RFLP, Taqman technology, biochip, nucleic acid chip or test kit.

PCR, PCR-RFLP, biochip, sequencing, Teqman genescan technology are the conventional methods of using of those skilled in the art.The Taqman technology is a kind of method of using fluorescence technique to carry out real-time quantitative PCR.Biochip is meant methods such as adopting the synthetic or micro-sampling of Hiroshima original position, with the large number of biological macromole such as nucleic acid fragment, peptide molecule even tissue slice, biological samples such as cell solidify in upholder in an orderly manner (as slide, silicon chip, polyacrylamide gel, carriers such as nylon membrane) surface, form intensive two-dimentional molecular arrangement, then with the molecular hybridization that hits of the biological sample to be measured of mark, by specific instrument such as laser confocal scanning instrument or electric charge coupling photographic camera (CCD) intensity of hybridization signal is carried out fast, parallel, check and analysis efficiently, thereby the quantity of target molecule or quality in the judgement sample.

The present invention is not to be restriction for detection method for the explanation of the detection method of loci gene type; Any those skilled in the art adopt conventional biological technique method to predict that by detecting pleomorphism site genotype of the present invention other risks take AECI class medicine efficacy of antihypertensive treatment as core all belong to content of the present invention, can further include the example that the pleomorphism site that adopts conventional biological technique method to be associated by the indirect reflection of the difference that detects the genotypic transcription product of pleomorphism site functional form of the present invention and/or expression product is predicted ACEI hypotensor thing action effect.

In method of the present invention, wherein said biological sample from individuality is selected from: as the blood sample of periphery whole blood, peripheral blood cells, white corpuscle, serum etc., and humoral samples such as urine, saliva, tissue samples such as oral mucosa examination, hair, skin, biopsy, organize sample secretory product, fecal matter sample, culturing cell, preferred, described sample is a blood sample, choose wantonly, described sample can carry out purifying in advance, for example separates total nucleic acid.

What the present invention relates to discovers:

(Prolylcarboxypeptidase PRCP) is the nervous plain II degrading enzyme of a kind of important vessel to proline carboxypeptidase.Equaling nineteen sixty-eight by Yang HYT at first finds.PRCP equals at 5 o'clock at pH, has best enzymic activity, the 20-50% when enzymic activity only is left maximum when pH is elevated to 7.PRCP belongs to the serine stretch protein enzyme family, and activity can be suppressed by phenylmethylsulfonyl fluoride (PMSF).Studies show that in a large number PRCP can be at the outer film expression of endotheliocyte.PRCP is the conditioning agent between renin-angiotensin-aldosterone system (RAAS) and the kassinin kinin-bradykinin system (KKS), is the another kind of important regulation system of blood vessel and endothelial function.The PRCP Angiotensin II of degrading makes that having the vasoactive Angiotensin II that contracts strongly is transformed into and has vasodilator active hypertensin 1-7, participates in the adjusting of RAAS system function.In addition, PRCP still is the plasmakinin activation of zymogen thing outside a kind of XIIa of being independent of, and can make kininogenase activate and generate bradykinin.The Angiotensin II because PRCP can degrade, the generation that increases hypertensin 1-7 can promote the release of bradykinin again, two kinds of effects can both make the generation of NO increase, and then vasodilator, play the effect that brings high blood pressure down.

Proline carboxypeptidase (PRCP) gene was cloned in 1993, be positioned human No. 11 autosomal long-armed go up (11q14), a kind of lysosomal enzyme of encoding, effect is that enzyme is cut the C-terminal amino acid that is connected with proline(Pro) as peptide classes such as Angiotensin II, Angiotensin II I and bradykinins.Be positioned at the base mutation of an A-C on its exon, caused the 112nd amino acids to become aspartic acid (Asp) by L-glutamic acid (Glu).We discover, the expression of this pleomorphism site and the mRNA of PRCP and activity etc. are relevant.In view of the important regulating effect of PRCP to RAAS system and blood pressure, this functional mononucleotide polymorphism site probably can have influence on the drug effect of ACEI class medicine.But still there is not bibliographical information with the relation of ACEI class medicine hypotensive effect and Forecasting Methodology thereof, test kit.

The present invention finds and proof:

In hypertensive patient (table 1), the step-down amplitude of PRCP 112DD homozygous mutation type and 112ED heterozygous significantly weakens than 112EE homozygous wildtype patient step-down amplitude, and it is bigger that systolic pressure reduces amplitude difference.Adjusted factors such as age, region, sex, occupation, habits of smoking and alcohol drinking, education degree, baseline blood pressure and BMI through overcorrection after, discovery PRCP 112DD homozygous mutation type genotype and 112ED heterozygous are lacked 8.61mmHg (95%CI:4.51-10.71mmHg, p＜0.001) than the drop-out value of blood pressure of the genotypic systolic pressure of PRCP 112EE homozygous wildtype; The blood pressure drops feature and the systolic pressure of diastolic pressure have same trend, the few 6.10mmHg (95%CI:4.60-7.60mmHg, p＜0.001) of drop-out value.E112D (Glu112Asp) polymorphism of results suggest proline carboxypeptidase gene (PRCP) is relevant with the antihypertensive effect of Zinadril Briem, carries the Low Response of the allelic individuality of 112D (112Asp) to Zinadril Briem, and the blood pressure drops amplitude is little.The diastolic pressure decline scope is littler than systolic pressure.This result has obtained strong confirmation (table 2) mutually in the crowd of two different areas.

Therefore, PRCP gene E112D (Glu112Asp) polymorphism or can be used to predict the action effect and the development prediction test kit of ACEI class medicines such as Zinadril Briem with near it other gene pleiomorphism that has linkage relationship; The above results also provides foundation for developmental function in the new drug of proline carboxypeptidase.For the clinician more scientifically provides the therapeutic regimen of individuation for the patient, prediction and hold drug effect, the validity that improves ACEI class medicine provides objective basis.

Description of drawings

Fig. 1 is to use the PCR-RFLP method to detect the genotypic gel electrophoresis figure of E112D pleomorphism site of PRCP gene.

Fig. 2 is to use the Taqman method to detect the genotypic fluorescence pattern of E112D pleomorphism site of PRCP gene.

Wherein:

1---the 167bp segment; 2---the 101bp segment; 3---the 66bp segment;

4---send the FAM fluorescence area; 5---send two kinds of fluorescence areas;

6---send the VIC fluorescence area.

Embodiment

Embodiment 1:PCR-RFLP method is measured E112D (rs2298668) the pleomorphism site genotype of PRCP gene

(1) genomic dna of extraction host cell: according to the molecular biology method operation of routine.

(a) add the 30ml erythrocyte cracked liquid in whole blood, slowly shake up, room temperature left standstill 10 minutes, during, shake for several times, thoroughly splitting erythrocyte;

(b) in 4 ℃, 2000 leave the heart/minute, 10 minutes, remove supernatant, the white corpuscle that will precipitate is broken up on the oscillator in rotation, adds proteolytic enzyme 40ul, RNA enzyme 50ul, shakes up, and adds write cell lysis buffer and puts 15ml, 37 ℃ of water-baths of mixing were taken out after 20 minutes, put in the cold water;

(c) add cold albumen precipitation liquid 4ml, be placed on-20 ℃ of refrigerators 5 minutes behind the mixing, take out in 4 ℃, 3000 rev/mins centrifugal 10 minutes.Supernatant liquor poured into slowly shake in the 50ml centrifuge tube that has added the 15ml Virahol for several times, separate out to the DNA floss;

(d) the DNA floss of separating out is moved to another 1.5ml and has packed on the 75% alcoholic acid filter paper, make evaporate dried.

(e) add DNA hydrating fluid 1.5ml, put shaking table, shaken over night, standby;

(f) mensuration of DNA concentration adopts ultraviolet spectrophotometry, measures the OD value under two wavelength of 260nm and 280nm respectively, is DNA concentration with OD260nm * 50 income values.And with OD260nm/OD280nm ratio estimation DNA purity;

(2) use PCR and restriction fragment length polymorphism analysis method (PCR-RFLP) to detect PRCP E112D pleomorphism site

According to PRCP E112D gene order design PCR Auele Specific Primer, comprise PCR forward primer and PCR reverse primer, carry out conventional pcr amplification by following condition.

Primer sequence:

Forward primer: 5 ' ATGGTTTGCCAAAAGGTTCA 3 ' (SEQ ID No.1)

Reverse primer: 5 ' TGTCACCAAAGGGGAGAGAC 3 ' (SEQ ID No.2)

The PCR reaction system:

Genomic dna 15ng/ μ l, upstream and downstream primer 10pmol (20 μ mol/L), dNTPs 1.25mmol/l, 10 * buffer, 1.0 μ l, Gold Taq archaeal dna polymerase 3U, dH ₂O supplies cumulative volume to 6.55 μ l.

The PCR reaction conditions:

Behind 94 ℃ of pre-sex change 3min; 94 ℃ of sex change 45sec, 62 ℃ of annealing 45sec, 72 ℃ are extended 1sec, 38 loop cycles; Last 72 ℃ are extended 7min; Obtain the amplified fragments of 167bp.

Enzyme tangent condition and system (15 μ l):

PRCP E112D site PCR product purpose fragment length is 167bp, total enzyme system of cutting is 15 μ l, PCR product 10 μ l wherein, 10 * NEBuffer#2,1.5 μ l, (its identification segment is G/GWCC to the AVaII restriction endonuclease, wherein W is A or T) 4U (0.4 μ l) and 3.1ul ddH2O, 37 ℃ are spent the night.

Genotype result judges:

Product point sample after the DNA enzyme cut after 37 ℃ of enzymes are cut and spent the night, reads glue figure (as shown in Figure 1) and carries out gene type assay on 2.5% agarose gel under ultraviolet lamp.Idiotype is identified as follows:

Endonuclease bamhi is 167bp, and the PRCP genotype is 112EE (wild-type);

Endonuclease bamhi is 167+101+66bp, and the PRCP genotype is 112ED (heterozygote);

Endonuclease bamhi is 101+66bp, and the PRCP genotype is 112DD (homozygote).

Embodiment 2:Taqman method is measured E112D (rs2298668) the pleomorphism site genotype of PRCP gene

(1) on the working method of standard and working specification, adopts the genomic dna that extracts host cell with the ordinary method described in the embodiment 1

(2) use the Taqman method to detect Glu112Asp (E112D) the pleomorphism site genotype of PRCP gene

(a) with PCR instrument amplification PRCP functional gene polymorphic site and flanking sequence thereof, in 5ul PCR reaction system, contain genomic dna 10ng, 2.5 (composition comprises the Taqman 2X Universal PCR Master Mix NoAmpERAASe UNG of μ l: AmpliTaq Gold DNA PolymeRAASe, dNTPs withDutp, Passive Reference, with the damping fluid of optimizing), and the forward primer of 0.90 μ M, each 0.25 μ M. of allele-specific probe of the reverse primer of 0.90 μ M and two sections band fluorescence report groups

Primer sequence is

Forward primer: 5 ' GTTTGCCAAAAGGTTCAGTGACTT 3 ' (SEQ ID No.3)

Reverse primer: 5 ' TCTCCATAGTATCGATGTTCAGCAAAC 3 ' (SEQ ID No.4)

The sequence of allele-specific probe is:

VIC-5’CATAGCTTTCAGTTCCTCA 3’-NFQ(SEQ ID No.5)

Corresponding to " T (or Glu) " allelotrope, carry VIC fluorescence report group.

FAM-5’ATAGCTTTCAGGTCCTCA 3’-NFQ(SEQ ID No.6)

Corresponding to " G (or Asp) " allelotrope, carry FAM fluorescence report group.

The PCR reaction conditions:

95 ℃ of 10min, 1 circulation;

92℃ 15s，

60℃ 1min，

50 circulations.

(b) on ABI Primer 7900 type quantitative real time PCR Instruments, detect fluorescence information and carry out genotypic evaluation

The PCR plate of finishing the PCR reaction is put on the 7900 type quantitative real time PCR Instruments, is selected for use " Allelic Discrimination " program in SDS 2.1 softwares, scan judgement (as shown in Figure 2) with the result:

The genotype of sending FAM fluorescence person is the Asp/Asp homozygote;

The genotype of sending VIC fluorescence person is the Glu/Glu homozygote;

The genotype of sending two kinds of fluorescence persons is the Asp/Glu heterozygote.

The correlation analysis of embodiment 3:PRCP gene E112D polymorphism genotype and Zinadril Briem efficacy of antihypertensive treatment is in hypertensive patient, the step-down amplitude of PRCP 112DD homozygous mutation type and 112ED heterozygous significantly weakens than 112EE homozygous wildtype patient step-down amplitude, the difference bigger (table 1) that systolic pressure reduces.Predictive equation analysis after factors such as age, region, sex, occupation, habits of smoking and alcohol drinking, education degree, baseline blood pressure and BMI have been adjusted in overcorrection, discovery PRCP 112DD homozygous mutation type genotype and 112ED heterozygous are lacked 8.61mmHg (95% CI:4.51-10.71mmHg, p＜0.001) than the drop-out value of blood pressure of the genotypic systolic pressure of PRCP 112EE homozygous wildtype; The blood pressure drops feature and the systolic pressure of diastolic pressure have same trend, the few 6.10mmHg (95% CI:4.60-7.60mmHg, p＜0.001) of drop-out value.E112D (Glu112Asp) polymorphism of results suggest proline carboxypeptidase gene (PRCP) is relevant with the antihypertensive effect of Zinadril Briem, carry the Low Response of the allelic individuality of 112D (112Asp) to Zinadril Briem, the blood pressure drops amplitude is little, and the diastolic pressure decline scope is littler than systolic pressure.This trend has obtained confirmation (table 2) mutually in the crowd of two different areas.

The correlation analysis of table 1.PRCP gene E112D polymorphism genotype and Zinadril Briem efficacy of antihypertensive treatment

Genotype		N	Mean ± standard deviation	Do not adjust			Adjust *
										β	S.E.	P	β	S.E.	P
				The systolic pressure diastolic pressure	EE ED+DD EE ED+DD	329 73 329 73	14.59±18.27 6.58±16.86 8.60±12.88 2.13±11.25	Ref -8.01 Ref -6.47	--- 2.20 --- 1.49							--- ＜0.001 --- ＜0.001	Ref -8.61 Ref -6.10	--- 2.10 --- 1.50	--- ＜0.001 --- ＜0.001

Annotate: (1) adjusts variable is Age, Age2, County, Gender, Occupation, Drinking and Smoking Status, Education, Baseline SBP and DBP, Body Mass Index. (2) EE represents homozygous wildtype, and ED represents heterozygous, and DD represents the homozygous mutation type.

Therefore, PRCP gene E112D (Glu112Asp) polymorphism or exist other gene pleiomorphism of linkage relationship can be used to predict the antihypertensive effect and the development prediction test kit of ACEI class medicines such as Zinadril Briem with it; In the Forecasting Methodology of the present invention, PRCP E112D (rs2298668) pleomorphism site is relevant with the efficacy of antihypertensive treatment of the pharmaceutical composition that contains ACEI class medicine that comprises Zinadril Briem, has remarkable prediction effect.Concrete, when (1) described PRCP pleomorphism site genotype is 112ED heterozygous mutant gene or pleomorphism site genotype when being 112DD homozygous mutation type, predict a little less than the action effect that the pharmaceutical composition of the above-mentioned ACEI of containing class medicine brings high blood pressure down; When (2) described PRCP pleomorphism site genotype was the 112EE homozygous wildtype, the action effect that the prediction aforementioned pharmaceutical compositions brings high blood pressure down strengthened.

The present invention can instruct the doctor to implement to predict medication, selects according to individual difference, has improved the validity and the security of clinical application.Result of study also provides foundation for developmental function in the new drug and the individuation application thereof of PRCP step-down simultaneously.

The table 2. liang PRCP of research area gene E112D polymorphism genotype and the analysis of Zinadril Briem efficacy of antihypertensive treatment are relatively

Genotype		N	Mean ± standard deviation	Do not adjust			Adjust *
										β	S.E.	P	β	S.E.	P
				Community one
The systolic pressure diastolic pressure	EE ED+DD EE ED+DD	233 48 233 48	13.11±18.17 6.78±17.13 6.54±12.12 2.60±11.38											Ref -6.33 Ref -3.93	--- 2.72 --- 1.81	--- 0.020 --- 0.030	Ref -6.91 Ref -3.22	--- 2.37 --- 1.77	--- 0.004 --- 0.069
				Community two
The systolic pressure diastolic pressure	EE ED+DD EE ED+DD	96 25 96 25	18.18±18.10 6.19±16.68 13.60±13.36 1.23±11.17											Ref -12.0 Ref -12.37	--- 3.75 --- 2.58	--- 0.001 --- ＜0.001	Ref -12.9 Ref -11.3	--- 3.93 --- 2.47	--- 0.001 --- ＜0.001

Annotate: (1) adjusts variable is Age, Age2, and County, Gender, Occupation, Drinking and Smoking Status, Education, Baseline SBP and DBP, Body Mass Index. (2) EE represents homozygous wildtype; ED represents heterozygous; DD represents the homozygous mutation type.

Embodiment 4: contain ACEI class drug effect effect by measuring the prediction of genes of individuals shape parameter and other physiological parameters

Set up predictive model by measuring genes of individuals shape parameter and other physiological parameters, can predict the action effect of ACEI class medicine more accurately.

1, obtains the data information result similar, i.e. PRCP E112D pleomorphism site genotype parameter and basic physiological parameter: age, sex, smoking history, history of drinking history, occupation, education degree, basic systolic pressure, basic diastolic pressure and weight index as present embodiment.

2,, obtain being used for predicting the predictive model of the action effect that contains ACEI class medicine according to multiple linear regression analysis.

Predictive equation is respectively:

The predictive equation of efficacy of antihypertensive treatment:

(1) predictive equation of diastolic pressure fall:

Δ dbp=C1+a1 * 112DD+b1 * 112ED-c1 * age+d1 * BMI+e1 * sex-f1 * history of drinking history+g1 * smoking history+h1 * occupation+j1 * education degree+k1 * basic diastolic pressure

Δ dbp is the drop-out value of the diastolic pressure after treating.

(2) predictive equation of systolic pressure fall:

Δ sbp=C2+a2 * 112DD+b2 * 112ED-c2 * age+d2 * BMI+e2 * sex-f2 * history of drinking history+g2 * smoking history+h2 * occupation+j2 * education degree+k2 * basic systolic pressure

Δ sbp is the drop-out value of the systolic pressure after treating.

The value mode of the genotype parameter value in the above step is as follows: according to the genotype value in the PRCP genotype polymorphism site of measuring.When the genotype of individuality was DD homozygous mutation type, 112DD genotype parameter value was 1 in the predictive equation, and 112ED genotype parameter value is 0; When the genotype of individuality was the 112ED heterozygous, 112DD genotype parameter value was 0 in the predictive equation, and 112ED genotype parameter value is 1; When the genotype of individuality was the EE homozygous wildtype, 112DD genotype parameter value was 0 in the predictive equation, and 112ED genotype parameter value is 0.

The value mode of the basic physiological parameter value in the above step is as follows: the age parameter is got actual age numerical value, and unit is year; BMI (weight index) parameter is body weight (kilogram)/height (rice) ²(kg/m ²); The sex parameter gets 0 for the male sex, and the women gets 1; The history of drinking history parameter gets 0 for never touching liquor, and once drinks or drinks now and get 1; The smoking history parameter is for to get 0 from non-smoking, and smoking once or smoking now get 1; The height parameter is got actual height values, and unit is centimetre (cm); The body weight parameter is got the ABW value, and unit is a kilogram (kg); The occupation parameter gets 0 for the peasant, and non-peasant gets 1; The education degree parameter is that medium above education degree gets 0, and other are 1; Basis systolic pressure parameter is a practical basis systolic pressure value, and unit is mmhg (mmHg).

Embodiment 5: the efficacy of antihypertensive treatment of prediction ACEI class medicine

Adopt the case-control study method, the hyperpietic according to its loci gene type detected result, is predicted that it takes the ratio that blood pressure drops behind the ACEI class medicine reaches Ministry of Health's standard, its Follow-up results is concluded as table 3:

Table 3.PRCP gene E112D pleomorphism site genotype is to the efficacy of antihypertensive treatment predicting function

	Effectively (%)	Invalid (%)	Add up to (%)
				Positive (EE) negative (ED+DD)	149(45％) 31(38％)	189(55％) 50(62％)	338(100％) 81(100％)
Add up to	180(44％)	239(56％)	419(100％)

Annotate: according to the ministry of Health of China standard, definition " effectively " is reduced to＜90mmHg or sbp decline＞=30mmHg for taking back dbp decline＞10mmHg or dbp (1); The definition engineering noise is for taking the back blood pressure still for unusually, and fall does not satisfy dbp decline＞10mmHg and dbp reduces to＜and any one standard among 90mmHg and the sbp decline＞=30mmHg.(2) EE represents homozygous wildtype; ED represents heterozygous; DD represents the homozygous mutation type.(3) susceptibility=149/180*100%=83%; Specificity=50/239*100%=21%; Positive advance notice value (PV+)=149/338*100%=44%; Negative advance notice value PV-=50/81*100%=62%.(4) * chi-square value=4.691, p=0.030.

The above results shows: among the patient of homozygous wildtype 112EE loci gene type, taking behind the ACEI class medicine step-down, to reach effective ratio higher, and heterozygous 112ED loci gene type and the effective ratio of homozygous mutation type 112DD loci gene type patient's step-down are lower, and this is consistent with predicting the outcome of the inventive method.

Sequence table (SEQUENCE LISTING)

＜110〉Anhui Biological Medical Inst

＜120〉method of prediction action effect of angiotensin conversion enzyme inhibitor medicament

<130> JSP060102

<160> 6

<170> PatentIn version 3.1

<210> 1

<211> 20

<212> DNA

＜213〉artificial sequence

<400> 1

atggtttgcc aaaaggttca 20

<210> 2

<211> 20

<212> DNA

＜213〉artificial sequence

<400> 2

tgtcaccaaa ggggagagac 20

<210> 3

<211> 24

<212> DNA

＜213〉artificial sequence

<400> 3

gtttgccaaa aggttcagtg actt 24

<210> 4

<211> 27

<212> DNA

＜213〉artificial sequence

<400> 4

tctccatagt atcgatgttc agcaaac 27

<210> 5

<211> 19

<212> DNA

＜213〉artificial sequence

<400> 5

catagctttc agttcctca 19

<210> 6

<211> 18

<212> DNA

＜213〉artificial sequence

<400> 6

atagctttca ggtcctca 18

Claims (9)

1. method of predicting action effect of angiotensin conversion enzyme inhibitor medicament, predict action effect of angiotensin conversion enzyme inhibitor medicament by mensuration from the genotype of the pleomorphism site E112D of proline carboxypeptidase gene in experimenter's the biological sample: when genotype was the 112EE homozygous wildtype, action effect of angiotensin conversion enzyme inhibitor medicament strengthened; When genotype is 112ED heterozygous or 112DD homozygous mutation type, the prediction action effect of angiotensin conversion enzyme inhibitor medicament a little less than.

2. the method for claim 1, it is characterized in that described angiotensin converting enzyme inhibitor class medicine is selected from: Zinadril Briem, captopril, enalapril, Yipingshu, perindopril, delapril, quinapril, lisinopril, Ramipril, imidapril, zofenopril, Trolapril and fosinopril.

3. the method for claim 1 is characterized in that, described biological sample is selected from: blood sample, humoral sample, tissue sample, organize sample secretory product, fecal matter sample, culturing cell.

4. method as claimed in claim 3 is characterized in that, described blood sample is selected from: periphery whole blood, peripheral blood cells, white corpuscle, serum; Described humoral sample is selected from: urine sample, saliva; Described tissue sample is selected from: oral mucosa examination, hair, skin, biopsy.

5. the method for claim 1, it is characterized in that the genotypic method of wherein measuring the pleomorphism site E112D of proline carboxypeptidase gene is selected from following difference foranalysis of nucleic acids technology: polymerase chain reaction, the PCR-restriction fragment length polymorphism is analyzed, PCR-alleles-specific oligonucleotide probe method, PCR-sequence specific oligonucleoside acid system, sequencing, PCR-sequence specific primers method, the PCR-fluorescent method, the PCR finger-printing method, oligonucleotide connects to be analyzed, the detection method of fluorescent energy resonance transfer, biochip, nucleic acid chip, mass-spectrometric technique, genescan, single strand conformation polymorphism, denaturing gradient gel electrophoresis, enzyme or chemical mispairing patterning method, and Taqman biological detecting method.

6. the method for claim 1, it is characterized in that, by utilizing the E112D pleomorphism site genotype of proline carboxypeptidase gene in the polymorphism parting oligonucleotide detection of biological sample, wherein, described polymorphism parting oligonucleotide is: (1) allele-specific nucleic acid primer, the proline carboxypeptidase gene segment that is used to increase and contains described pleomorphism site, and/or (2) be used to detect the genotypic oligonucleotide probe of pleomorphism site of described proline carboxypeptidase gene, and it can be specifically and the nucleic acid hybridization that contains described proline carboxypeptidase gene polymorphism sites.

7. method as claimed in claim 6 is characterized in that, the length of described oligonucleotide probe is 15-50 Nucleotide.

8. the method for claim 1 is characterized in that, the genotype of the pleomorphism site E112D of described proline carboxypeptidase gene is by existing the genotype of other pleomorphism site of linkage disequilibrium to determine near this pleomorphism site with it.

9. method as claimed in claim 8 is characterized in that, described other pleomorphism site comprises nonsense mutation site, missense mutation site and the pleomorphism site that is positioned at gene intron position, generegulation position.

Images