CN1810839A - Anti-hepatitis B virus fusion protein and its coding gene and application - Google Patents
Anti-hepatitis B virus fusion protein and its coding gene and application Download PDFInfo
- Publication number
- CN1810839A CN1810839A CN 200610007869 CN200610007869A CN1810839A CN 1810839 A CN1810839 A CN 1810839A CN 200610007869 CN200610007869 CN 200610007869 CN 200610007869 A CN200610007869 A CN 200610007869A CN 1810839 A CN1810839 A CN 1810839A
- Authority
- CN
- China
- Prior art keywords
- hepatitis
- sequence
- virus
- fusion protein
- virus fusion
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The present invention discloses one kind of anti-hepatitis B virus fusion protein and its coding gene and application. The anti-hepatitis B virus fusion protein has hepatitis B virus surface antigen, connecting peptide, thrombin recognizing site and thymulin connected serially between the amino end and the carboxyl end successively. The connecting peptide has the amino acid sequence GlyGlyGlySer; the thrombin recognizing site has the amino acid sequence ArgLys; and the thymulin has the amino acid sequence as shown in SEQ ID No. 2 of the sequence list. The anti-hepatitis B virus fusion protein of the present invention is used as hepatitis B treating vaccine.
Description
Technical field
The present invention relates to a kind of anti-hepatitis B virus fusion protein and encoding gene thereof and application, particularly a kind of anti-hepatitis B virus fusion protein of in debaryomyces hansenii, expressing and encoding gene thereof and be the vaccine of activeconstituents with this anti-hepatitis B virus fusion protein.
Background technology
The hepatitis B virus infectivity is quite strong, and is almost all-pervasive, and it is anti-to make people's air defense be unequal to.Because hepatitis B patient there is no obvious adverse reaction or subjective symptoms in early days, the state of an illness is chronic and invisible development, so that patient's diagnoses and treatment in time, incur loss through delay the state of an illness and caused the generation of liver cirrhosis even liver cancer, in this process, because patient fails to isolate, hepatitis B virus waits for an opportunity to spread, and endangers more people.According to the health ministry statistics, China's hepatitis B virus infection rate height, the hepatitis B virus carriers reaches 1.2 hundred million more than, and almost per 10 philtrums just have a people infected.Surplus chronic viral hepatitis B and liver cirrhosis patient have 3,000 ten thousand, and annual newly-increased patient 2,000,000.Annual number because of liver cirrhosis and liver cancer death surpasses 300,000.Present Hepatitis B virus vaccine can only play prophylactic effect, can not treat hepatitis B completely.So the production of therapeutic hepatitis B vaccine just becomes present top priority.
Medical circle generally believes before nineteen ninety-five, and vaccine is only made preventing disease and used.Along with the development of immunology research, it is found that the new purposes of vaccine, promptly can treat some refractory diseases.From then on, vaccine has had prevention and treatment dual function concurrently, and therapeutic vaccine belongs to the specificity active immunotherapy.Also began polypeptide with some gene fragment expression of hepatitis B virus in France, Japan in 1998 and add that the therapeutic vaccine of various different adjuvants preparations does clinical study, observe of the therapeutic action of this polypeptide vaccine the viral carrier of chronic viral hepatitis B.Its result discloses, and this vaccine has antivirus action to the hepatitis B virus transgenic mouse, single application particularly with hepatitis B virus resisting medicine combined utilization, the carrier has certain curative effect to chronic viral hepatitis B virus.The U.S. had developed new polypeptide therapeutic vaccine in 1999, and the immunological role of this therapeutic vaccine is furtherd investigate.Preliminary proof, therapeutic vaccine can be broken the topmost immunological response disorder of chronic hbv-infection patient, promptly hepatitis B virus and antigen thereof is not produced immunne response---immune tolerance state.
The liver chronic lesion changed very complexity after hepatitis B virus (HBV) infected human body, because the curative effect of anti-HBV medicine and various immunocyte and the immunocompetence factor have dependence, so there were many scholars to advocate to use conjoint therapy in recent years.People such as Henan Xinxiang College of Medical Science first affiliated hospital Sun Yi peak adopt Zadaxin, Hepatitis B virus vaccine, Interferon, rabbit three combination therapy chronic hepatitis B, its result shows, Interferon, rabbit has definite curative effect to be proved to chronic HBV infection, but because of its can't remove covalently closed circular DNA (
CCCDNA) reach the virogene that has been incorporated in the host DNA, so the recurrence rate height.His result of study shows, Zadaxin can the former activated T cell maturation of promoting mitosis, strengthens the secretion of collective's Interferon, rabbit and interleukin-2.Heavy dose of Zadaxin can be resisted chronic HBV infection patients serum immunosuppressive factor, recovers ConA and induces and suppress cell function; The result of treatment of strengthening Interferon, rabbit is all relevant with its promotion body cell immunity.Heavy dose of thymus gland Toplink is broken " immunological tolerance " of chronic HBV infection.Can further stimulate the specific cellular immunity of body with Hepatitis B virus vaccine, finally reach the purpose of removing HBV in the body better.The conclusion that people such as Ye Xinshui draw from the clinical observation of treatment chronic hepatitis B is, Zadaxin adds Hepatitis B virus vaccine and unites group 30 examples, Hepatitis B virus vaccine group 30 examples, protect liver and organize 20 examples, find by clinical observation, the HbeAg/Hbe turnover ratio is united group 46.7%, and Hepatitis B virus vaccine group 20% is united group and had significant difference (P＜0.05) for two groups than the back.The Zhai Zhizhen of central hospital of Qilu Petrochemical company treats chronic viral hepatitis B 76 examples with Zadaxin and Hepatitis B virus vaccine coupling, the result shows, two groups of HbeAg, HBVDNA negative conversion rate and anti-Hbe sun rate of rotation differences all have highly significant difference, the treatment group obviously is better than control group (P＜0.01), and the treatment group is not seen significant side effects in therapeutic process.Present known chronic hepatitis and hepatitis B virus carriers thereof lack isostructural anti-HBs antibody, and find to have the immunological tolerance phenomenon, with Zadaxin enhance immunity function, stimulate the body specific immune response with hepatitis B surface antigen, the two coupling can strengthen cellular immunization and humoral immune function simultaneously, regulate immunologic balance simultaneously, help suppressing or the intravital HBV of scavenging machine.Shortened the duration of service of Interferon, rabbit, avoided the generation of interferon antibody in the serum, many untoward reactions that the Interferon, rabbit prolonged application is produced are reduced.
Zadaxin is the polypeptide formulations of biologically active, has the enhancing cellular immune function, regulates the effect of immunological status.It has mainly acted on: 1) make the marrow liver cell be converted into T cell, 2 in thymus gland) improve the mature immunocompetent lymphocytic immunologic function that has.
At present Zadaxin is in a plurality of state approval productions, is used for antiviral and treatment such as tumour.But the Zadaxin of present clinical use mostly is the chemosynthesis product, and the price comparison costliness applies being restricted.At present a lot of scholars adopt the synthetic thymosin gene of the method for fusion rotein, and succeed and express.Because the Zadaxin monomer molecule is that 28 amino acid whose small molecules small peptides are only arranged, purifying is difficulty very, therefore is unfavorable for suitability for industrialized production.At present, many scholars utilize fusion rotein and string body method success expression Zadaxin, and the monomer analogue that is purified into is quite active with natural Zadaxin.For example, people such as the Shi Jihong of The Fourth Military Medical University are Zadaxin and sulphur hydrogen reduction protein fusion expression, and have obtained efficiently expressing, and biological activity is very high.
Domestic main employing be with Interferon, rabbit, Hepatitis B virus vaccine, Zadaxin three's co-therapy hepatitis B of joining together, a large amount of clinical experiments shows that this method is comparatively desirable aspect the treatment hepatitis B, but use three kinds of medicines comparatively complicated jointly, and Zadaxin is not easy to purifying.
Summary of the invention
An object of the present invention is to provide a kind of anti-hepatitis B virus fusion protein and encoding gene thereof.
Anti-hepatitis B virus fusion protein provided by the present invention is tight successively placed in-line hepatitis B virus surface antigen, connection peptides, zymoplasm recognition site and Zadaxin from aminoterminal to carboxyl terminal; The aminoacid sequence of described connection peptides is GlyGlyGlyGlySer; The aminoacid sequence of described zymoplasm recognition site is LysArg; Described Zadaxin have aminoacid sequence shown in sequence in the sequence table 2 (Shi Jihong etc., The Fourth Military Medical University, the clone of natural thymosin gene and the expression in intestinal bacteria thereof, Chinese biochemical drug magazine, 2003 the 24th volume second phases, 55-57).
Described hepatitis B virus surface antigen can be any one in existing ayw1, ayw2, ayw3, ayw4, adw2, adw4, ayr, adrq+ and the adrq-hypotype hepatitis B virus surface antigen; Be preferably adw2 hypotype hepatitis B virus surface antigen.
When described hepatitis B virus surface antigen was ayw2 hypotype hepatitis B virus surface antigen, described anti-hepatitis B virus fusion protein was HBVAg-Thy α
1, be protein with one of following aminoacid sequence:
1) the SEQ ID № in the sequence table: 4 amino acid residue sequence;
2) with SEQ ID № in the sequence table: the replacement of one or several amino-acid residue of amino acid residue sequence process of 4 and/or disappearance and/or interpolation and protein with hepatitis B virus resistance.
Wherein, sequence 4 is made up of 261 amino-acid residues in the sequence table.From the aminoterminal 1-226 of sequence 4 amino acids residue is adw2 hypotype hepatitis B virus surface antigen; From the aminoterminal 234-261 of sequence 4 amino acids residue is the protein sequence of Zadaxin; From the aminoterminal 232-233 of sequence 4 amino acids residue is the zymoplasm recognition site; From the aminoterminal 227-231 of sequence 4 amino acids residue is connection peptides (linker) sequence.
The encoding gene of above-mentioned anti-hepatitis B virus fusion protein (HBVAg-Thy α
1) also belong to protection scope of the present invention.
The encoding gene of above-mentioned anti-hepatitis B virus fusion protein can have one of following nucleotide sequence:
1) SEQ ID № in the sequence table: 3 dna sequence dna;
2) SEQ ID № in the code sequence tabulation: the polynucleotide of april protein sequence;
3) under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 3 dna sequence dnas hybridization that limit.
The rigorous condition of above-mentioned height can be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS, under 65 ℃, hybridize and wash film.
Wherein sequence 3 is made up of 783 deoxynucleotides in the sequence table, from 5 ' and the 1st to the 783rd deoxynucleotide of end is encoding sequence (ORF).The 1st to the 678th deoxynucleotide from 5 ' end is the encoding sequence of adw2 hypotype hepatitis B virus surface antigen, the 700th to the 783rd deoxynucleotide from 5 ' end is the encoding sequence of Zadaxin, from 5 ' the 679th to the 693rd deoxynucleotide of end is the encoding sequence of linker, is zymoplasm recognition site encoding sequence from the 694th to the 699th deoxynucleotide of 5 ' end.
Contain expression carrier of the present invention, clone and host bacterium and all belong to protection scope of the present invention.
Another object of the present invention provides a kind of vaccine that prevents and/or treats hepatitis B, and its activeconstituents is above-mentioned anti-hepatitis B virus fusion protein.
Described vaccine also comprises adjuvant, as aluminium adjuvant, propolis, chitosan etc.
Adjuvant commonly used is freund adjuvant (Freund adjuvant), its composition is 1 part in lanolin, 5 parts of Valelinum Liquidums normally, the ratio of lanolin and Valelinum Liquidum, optionally can be adjusted to 1: 2～9 (V/V), this is incomplete freund adjuvant, and adding 1～20mg bacille Calmette-Guerin vaccine at every milliliter of Freund just becomes Freund's complete adjuvant.
The described vaccine that prevents and/or treats hepatitis B can import body such as muscle, intracutaneous, subcutaneous, vein, mucosal tissue by the method for injection, injection, collunarium, eye drip, infiltration, absorption, physics or chemistry mediation; Or mixed by other materials or wrap up the back and import body.
The described consumption that prevents and/or treats the vaccine of hepatitis B be generally 0.06-0.6 μ g anti-hepatitis B virus fusion protein/kg body weight/time, be administered once, and generally needed 2-6 time altogether in every 7-30 days.
The present invention also provides a kind of method of expressing above-mentioned anti-hepatitis B virus fusion protein.
The method of the above-mentioned anti-hepatitis B virus fusion protein of expression provided by the present invention is in the encoding gene importing multiple-shaped nuohan inferior yeast with described anti-hepatitis B virus fusion protein, expresses obtaining anti-hepatitis B virus fusion protein.
The encoding gene of described anti-hepatitis B virus fusion protein can pass through expression vector pHMOXZR25S-HBVAg-Thy α
1Or pHFMDZR25S-HBVAg-Thy α
1Import in the multiple-shaped nuohan inferior yeast.
Described pHMOXZR25S-HBVAg-Thy α
1Or pHFMDZR25S-HBVAg-Thy α
1Method by electroporation imports multiple-shaped nuohan inferior yeast.
Described multiple-shaped nuohan inferior yeast can be AS2.2412 (available from DSMZ of Institute of Microorganism, Academia Sinica).
The present invention is with hepatitis B virus surface antigen, in yeast, carry out amalgamation and expression as adw2 hypotype hepatitis B virus surface antigen and Zadaxin, in order to make hepatitis B surface antigen and Zadaxin have correct space structure and biological function simultaneously, adopted little connection peptides GlyGlyGlyGlySer that hepatitis B virus surface antigen and Zadaxin are coupled together, and added zymoplasm recognition site LysArg, so that the two can separate in vivo, make hbsag gene serve as Hepatitis B virus vaccine, stimulate the body specific immune response, isolated Zadaxin can the enhance immunity function, the two coupling can strengthen cellular immunization and humoral immune function simultaneously like this, regulate immunologic balance simultaneously, help suppressing or the intravital HBV of scavenging machine, reach the effect of treatment hepatitis B.
The used adw2 hypotype hepatitis b virus surface antigen gene of the present invention is the main popular hbsag gene of present China (sequence 5 in the sequence table), thymosin gene is according to the design of the preferences of debaryomyces hansenii codon, add linker GlyGlyGlyGlySer and zymoplasm recognition site LysArg in the middle of both, the encoding gene of the fusion rotein of coding hepatitis B surface antigen and Zadaxin has been synthesized in design, can be in multiple-shaped nuohan inferior yeast the fusion rotein HBVAg-Thy α of hepatitis B surface expressed in high efficiency antigen and Zadaxin
1The immunologic competence of fusion rotein is identical with the immunogenicity of single hepatitis B surface antigen.Hepatitis B surface antigen of the present invention and thymic peptide fusion protein as one can be used as therapeutic hepatitis B vaccine.
Description of drawings
Fig. 1 is an expressed by Hansenula yeast carrier pHFMDZRA-M structure iron
Fig. 2 is an expressed by Hansenula yeast carrier pHMOXZRA-M structure iron
Fig. 3 is an expressed by Hansenula yeast carrier pHFMDZR25SA-M structure iron
Fig. 4 is an expressed by Hansenula yeast carrier pHMOXZR25SA-M structure iron
Fig. 5 is HBVAg-Thy α
1The electrophorogram that the PCR product is identified
Fig. 6 is HBVAg-Thy α
1Westen bloting figure
Embodiment
Experimental technique among the following embodiment if no special instructions, is ordinary method.
Percentage composition described in the following embodiment if no special instructions, is the quality percentage composition.
Embodiment 1, HBVAg-Thy α
1And the acquisition of encoding gene
One, adw2 hypotype hepatitis B virus surface antigen and Zadaxin fusion gene is synthetic
According to document (Shi Jihong etc., The Fourth Military Medical University, the clone of natural thymosin gene and the expression in intestinal bacteria thereof, China's biochemical drug magazine, 2003 the 24th volume second phases, 55-57) the protein sequence of Bao Dao Zadaxin (SEQ ID No.2 in the sequence table is made up of 28 amino acid) and its albumen is optimized is transformed into the nucleotide sequence (5 of sequence 1 ' end 22-105 position deoxynucleotide in sequence table) of multiple-shaped nuohan inferior yeast preference Zadaxin.(contain 681 bases at the proteic encoding gene of adw2 hypotype hepatitis B virus surface antigen S, SEQ ID No.5 in the sequence table) and between the above-mentioned synthetic thymosin gene sequence added the linker sequence, the zymoplasm recognition site, pass through gene machine, newly-designed hbsag gene of synthetic and Zadaxin fusion gene show that through order-checking this gene has the nucleotide sequence of SEQ No.3 in the sequence table.
With this hbsag gene and Zadaxin fusion gene called after HBVAg-Thy α
1Its sequence total length amounts to 783 polynucleotide, deoxynucleotide is the hbsag gene encoding sequence from 5 ' end 1-678 position, from 5 ' end 679-693 position is the linker sequence, from 5 ' end 694-699 position is the zymoplasm recognition site, and deoxynucleotide is the nucleotide sequence of multiple-shaped nuohan inferior yeast preference Zadaxin from 5 ' end 700-783 position.The proteins encoded HBVAg-Thy α 1 of HBVAg-Thy α 1 has the amino acid residue sequence of SEQ No.4 in the sequence table.From the aminoterminal 1-678 of sequence 4 amino acids residue is hepatitis B surface antigen adw2; From the aminoterminal 700-783 of sequence 4 amino acids residue is Zadaxin; From the aminoterminal 694-699 of sequence 4 amino acids residue is the zymoplasm recognition site; From the aminoterminal 679-693 of sequence 4 amino acids residue is connection peptides.
Two, contain HBVAg-Thy α
1The structure of expression vector and HBVAg-Thy α
1Expression
1, the structure of FMD promoter vector and MOX promoter vector
(building process of pHFMDZ-A and pHMOXZ-A is seen document Houhui Song to pHFMDZ-A and pHMOXZ-A, Yong Li, Weihuan Fang, Yunfeng Geng, Xu Wang, Min Wang, Bingsheng Qiu, Development of a set of expression vectors in Hansenula polymorpha, Biotechnology Letters, Volume 25, and Issue 23, and Dec 2003,1999-2006) transform and obtain new FMD promoter vector pHFMDZR25SA-M and MOX promoter vector pHMOXZR25SA-M, these two carriers contain autonomously replicating sequence, HARS (SEQ ID No.6 in the sequence table) and 25SrDNA (SEQ ID No.7 in the sequence table), and these two original papers can improve the copy number of goal gene; And the terminator sequence AOX-TT of pHFMDZ-A and pHMOXZ-A replaced respectively become FMD-TT sequence (SEQ ID No.8 in the sequence table) and MOX-TT sequence (SEQ ID No.9 in the sequence table), make itself and promotor more supporting.PHFMDZR25SA-M and pHMOXZR25SA-M without linearizing, can directly carry out electroporation with plasmid and transform in the process of electroporation transformed yeast.The method that makes up is as follows:
1) design primer (table 1) is from debaryomyces hansenii genome amplification HARS, 25SrDNA, FMD-TT and MOX-TT sequence
The primer sequence of table 1. amplification HARS, 25SrDNA, FMD-TT and MOX-TT sequence
| HARS-up(BglII) | 5’G A AGATCTGTCGACGAACCCGCGTTTGAGT3’ BglII |
| HARS-down(BamHI) | 5’CG GGATCCGTCGACTCCCGCGACTCGGC3’ BamHI |
| 25S-up(BglII) | 5‘GTA
AGATCTGACTACTGGCAGGATCAAC3’ |
| 25S-down(BamHI) | 5‘GT AGGATCCGTTTAGACCGTCGTGAGAC3‘ BamHI |
| FMD-TT-UP(XbalI) | 5’GC TCTAGAGGAGGAGCTGATTGGATCTAGATGA 3’ XbalI |
| FMD-TT-down(BamHI) | 5’GA GGATCCCGTTCCCGTGTAGACGTTGGTAT 3’ BamHI |
| MOX-TT-up(XbalI) | 5‘GC TCTAGACGTGGAAGGACATACCGCTTTTGAG’3’ XbalI |
| MOX-TT-down(BamHI) | 5‘CG GGATCCATTCCCGAGTCTGTTCTTGGATGG‘3 BamHI |
With HARS upstream and downstream primer (HARS-up and HARS-down), 25S upstream and downstream primer (25S-up and 25S-down), FMD-TT upstream and downstream primer (FMD-TT-up and FMD-TT-down) and MOX-TT upstream and downstream primer (MOX-TT-up and MOX-TT-down) in the table 1, with the debaryomyces hansenii genome as template, increase respectively HARS, 25SrDNA, FMD-TT and MOX-TT sequence.The program of amplification is, after 94 ℃ of 5min heat denatured, 94 ℃ of 1min, 56 ℃ of 45sec, 72 ℃, 1min, after 30 circulations again 72 ℃ extend 10min.The purpose fragment that obtains of amplification is carried out after rubber tapping is reclaimed behind the electrophoresis again, and the double enzyme site according to design carries out double digestion, after enzyme is cut again rubber tapping reclaim standbyly, obtain the FMD-TT of 25SrDNA, 556bp of HARS, 2807bp that the purpose fragment is respectively 512bp and the MOX-TT of 382bp.With pHFMDZ-A (Houhui Song, Yong Li, Weihuan Fang, Yunfeng Geng, Xu Wang, Min Wang, Bingsheng Qiu, Development of a set ofexpression vectors in Hansenula polymorpha, Biotechnology Letters, Volume25, Issue 23, Dec 2003,1999-2006) reclaim the big fragment of 3035bp with rubber tapping behind XbaI and the BamHI double digestion rear electrophoresis, the product of recovery be connected with FMD-TT PCR product behind the BamHI double digestion through XbaI, to connect the product transformed into escherichia coli again, utilize resistance (zeocin) substratum to screen, carry out PCR with FMD-TT upstream and downstream primer and identify positive colony, show the connection product called after pHFMDZA-M that contains FMD-TT identifying through PCR.With pHFMDZA-M BglII single endonuclease digestion, reclaim linearizing enzyme behind the electrophoresis and cut product, with its with carry out isocaudarner with the HARS PCR product behind BglII and the BamHI double digestion and be connected, connect like this that BamHI site on the original HARS primer in back is destroyed to be fallen, only remaining BglII site, to connect the product transformed into escherichia coli again, on the resistance substratum, cultivate, utilize the HARS primer to identify positive colony, evaluation is shown the connection product called after pHFMDZRA-M (Fig. 1) that contains HARS, the positive colony that obtains is carried out the BglII single endonuclease digestion again, reclaim linearizing enzyme behind the electrophoresis and cut product, it is connected with PCR product with the BglII and the 25SrDNA of BamHI double digestion, with the same transformed into escherichia coli of product after connecting, on the resistance substratum, cultivate, utilize 25SrDNA upstream and downstream primer to identify positive colony, evaluation is shown the connection product called after pHFMDZR25SA-M (Fig. 3) that contains 25SrDNA.The building process of MOX promoter vector is with the building process of above-mentioned carrier, to be connected to pHMOXZ-A (the Houhui Song of XbalI and BamHI double digestion through the PCR product of the MOX-TT terminator of XbalI and BamHI double digestion, Yong Li, Weihuan Fang, Yunfeng Geng, Xu Wang, Min Wang, Bingsheng Qiu, Development of a set of expression vectors in Hansenula polymorpha, Biotechnology Letters, Volume 25, Issue 23, Dec 2003,1999-2006), the carrier called after pHMOXZA-M that contains MOX-TT, with pHMOXZA-M BglII single endonuclease digestion, reclaim linearizing enzyme behind the electrophoresis and cut product, with its with carry out isocaudarner with the HARS PCR product behind BglII and the BamHI double digestion and be connected, connect like this that BamHI site on the original HARS primer in back is destroyed to be fallen, only remaining BglII site, to connect the product transformed into escherichia coli again, on the resistance substratum, cultivate, utilize the HARS primer to identify positive colony, evaluation is shown the connection product called after pHMOXZRA-M (Fig. 2) that contains HARS, the positive colony that obtains carries out the BglII single endonuclease digestion again, the enzyme that reclaims linearize behind the electrophoresis is cut product, it is connected with PCR product with the BglII and the 25SrDNA of BamHI double digestion, with the same transformed into escherichia coli of product after connecting, on the resistance substratum, cultivate, utilize 25SrDNA upstream and downstream primer to identify positive colony, evaluation is shown the connection product called after pHMOXZR25SA-M (Fig. 4) that contains 25SrDNA.
For easy to connect, by pcr amplification at HBVAg-Thy α
15 ' end has added the EcoRI restriction enzyme site, 3 ' end added the NotI restriction enzyme site, primer sequence is:
The upstream primer sequence is: HBsAg-up-ECoRI:5 ' CG GAATTCATGGAGAACATCACATCAGG3 '
The downstream primer sequence is: TA4 ' cgggatccgcggccgcgttctcagcctcctcaacaacctccttcttc3 '
Its amplification system is 50ul, and amplification program is 94 ℃ of 5min, 94 ℃ of 1min, 56 ℃ of 45sec, 72 ℃, 1min, after 30 circulations again 72 ℃ extend 10min.Pcr amplification obtains 5, and ' end has added the EcoRI restriction enzyme site, and 3 ' end has added the HBVAg-Thy α of NotI restriction enzyme site
1Fragment.With this HBVAg-Thy α
1Fragment is inserted into respectively between the EcoRI and NotI enzyme recognition site of pHMOXZR25SA-M (Fig. 4) and pHFMDZR25SA-M expression vector (Fig. 3) after cutting with EcoRI and NotI enzyme.Contain HBVAg-Thy α showing through order-checking
1PHMOXZR25SA-M called after pHMOXZR25S-HBVAg-Thy α; Contain HBVAg-Thy α showing through order-checking
1PHFMDZR25SA-M called after pHFMDZR25S-HBVAg-Thy α
1
2, pHMOXZR25S-HBVAg-Thy α
1With pHFMDZR25S-HBVAg-Thy α
1Expression in the multiple-shaped nuohan inferior yeast bacterium
Different with other methanol yeast (as pichia pastoris phaff), the recombinant expression vector that the contriver makes up directly adopts the electroporation conversion method to transform multiple-shaped nuohan inferior yeast without linearizing.
The present invention improves the electroporation conversion method of (Faber, Haima et al., 1994), and (transformation efficiency is up to 10 promptly to have avoided the short circuit phenomenon in the electroporation process to improve transformation efficiency again
6).Experimental procedure after the improvement is as follows:
Choose multiple-shaped nuohan inferior yeast (Hansenula polymorpha) AS2.2412 (available from DSMZ of Microbe Inst., Chinese Academy of Sciences) mono-clonal in 5ml YPD liquid nutrient medium, 37 ℃ of overnight incubation, get 2ml bacterium liquid and add the pre-temperature of 200ml to 37 ℃ YPD, 37 ℃ are cultured to OD
600Between=the 1.2-1.5 (about 6h).The centrifugal 5min of room temperature 6000rpm abandons supernatant, with 500mlTED (100mmol/L Tris-HCl; 50mM EDTA; 25mmol/L DTT, pH=8.0) suspension cell.At 37 ℃ of shaking tables, 200rpm shakes 15min, and 4 ℃ of 6000rpm are centrifugal, 5min, abandon supernatant, the sucrose of the 270mmol/L of usefulness 200ml precooling is suspension cell gently, 4 ℃ of 6000rpm, centrifugal, 5min abandons supernatant, and the sucrose of the 270mmol/L of usefulness 100ml precooling is suspension cell gently, 4 ℃ of 6000rpm, centrifugal, 5min abandons supernatant, with the sucrose of the 270mmol/L of 1ml precooling suspension cell gently, be distributed into the 100ul/ pipe ,-80 ℃ of preservations add 10ul plasmid DNA (pHMOXZR25S-HBVAg-Thy α in the competent cell of 100ul
1Or pHFMDZR25S-HBVAg-Thy α
1), add behind the mixing gently in the electric shock cup in 2mm aperture, shock parameters: 50uF, 100 Ω, 1.5KV adds YPDTM (1% yeast extract of 940ul immediately after the electric shock; 1% peptone; 2% glucose; 1mmol/L MgCL
2), draw to the tubule of 2-5ml, 37 ℃ of shaking tables, 200rpm cultivates 1h.Get 100ul and be applied to the YPD flat board that contains Zeocin microbiotic (final concentration 100ug/ml), cultivated 2-3 days for 37 ℃, large, medium and small three kinds of dissimilar bacterium colonies on flat board, occur.Picking colony carries out PCR with following two pairs of primers and identifies recon, extracts macrocolony zymic genomic dna, utilizes PCR method to detect HBVAg-Thy α
1Whether insert the yeast genes group, primer is:
HBsAg-up-EcoRI：5’CGGAATTCATGGAGAACATCACATCAGG3’
TA4-down:5 ' cgggatccgcggccgcgttctcagcctcctcaacaacctccttcttc3 ', the response procedures of PCR is: 94 ℃ of 5min, 94 ℃ of 1min, 56 ℃ of 45sec, 72 ℃, 1min, after 30 circulations again 72 ℃ extend 10min.The amplification obtain 783bp product the electrophoresis detection collection of illustrative plates as shown in Figure 5, swimming lane M is MakerIII molecular weight standard (is Time Inc. available from Tsing-Hua University sky) among Fig. 5, swimming lane 1 is to contain pHMOXZR25S-HBVAg-Thy α
1Positive colony, swimming lane 2 is pHFMDZR25S-HBVAg-Thy α
1Positive colony, picking is measured correct transformant clone through PCR and is fermented as seed.
With seed in the YPD liquid nutrient medium 37 ℃ cultivate 12h after, be inoculated in the fresh YPD fermention medium according to 5% ratio (volume ratio), cultivated 48 hours, add methyl alcohol, making its final concentration is 0.5～1% (V/V), after cultivating 48～72 hours again, the results fermented liquid, 4 ℃ of centrifugal 3min of 12000rpm collect thalline, with the PBS thalline that suspends, smudge cells, better for crushing effect, can in thalline, add granulated glass sphere.After the fragmentation, the centrifugal 3min results of 12000rpm supernatant obtains HBVAg-Thy α
1Fusion rotein is to HBVAg-Thy α
1Fusion rotein carries out SDS-PAGE and western-blotting analyzes.This experiment mainly is the expression that detects hepatitis B surface antigen, and wherein, used one anti-ly be the antibody of hepatitis B surface antigen among the western-blotting, and this antibody comes from the hepatitis B surface detection kit, and this test kit purchase is from magnificent biotech firm.The result that western-blotting analyzes sees Fig. 6, among Fig. 6 swimming lane 1 be the hepatitis B standard substance as positive control, swimming lane 2 is to contain pHMOXZR25S-HBVAg-Thy α
1Positive colony, swimming lane 3 is pHFMDZR25S-HBVAg-Thy α
1Positive colony.Connected the immunocompetence that Zadaxin does not influence hepatitis B antigen as can be seen in the hepatitis B surface back from westernblotting, the expression that two clones are successful hbsag gene, and show pHMOXZR25S-HBVAg-Thy α
1Expression amount than higher.In addition, except that with the methanol induction fermentation, the multiple-shaped nuohan inferior yeast expression system also can ferment with the glucose induction of the glycerine or 1% (V/V) of 1% (V/V).
3. the antigenic activity of expression product is identified
With EcoRI/NotI double digestion pHFMDZR25SA-M, pHMOXZR25SA-M, reclaim enzyme and cut back linearize product, and then be connected, thereby Yeast expression carrier pHFMDZR25S-HBVAg, the pHMOXZR25S-HBVAg of hbsag gene have been obtained to contain with the good hbsag gene of EcoRI/NotI double digestion.PHFMDZR25S-HBVAg, pHMOXZR25S-HBVAg, pHFMDZR25S-HBVAg-Thy α
1, pHMOXZR25S-HBVAg-Thy α
1Method according to step 2 transforms multiple-shaped nuohan inferior yeast (Hansenula polymorpha) AS2.2412, and the transformant that obtains after screening carries out activity identification behind the method abduction delivering according to step 2, and concrete grammar is as follows:
To collect thalline behind the centrifugal 3min of the process 12000rpm of the tunning behind the abduction delivering.With ultrasonic disruption cell behind the PBS suspension thalline.The centrifugal 3min of 12000rpm collects supernatant.The supernatant of gained is carried out the immunocompetent detection of hepatitis B surface antigen by hepatitis B virus surface antigen diagnostic kit (euzymelinked immunosorbent assay (ELISA)) program that Huamei Bio-Engrg Co., produces, and its detected result explanation does not influence the expression of hbsag gene and the immunogen activity of hepatitis B surface antigen having linked after the Zadaxin.
To not connect the barms (change the transformant of pHFMDZR25S-HBVAg and change the transformant of pHMOXZR25S-HBVAg) of the hepatitis B surface antigen of Zadaxin and be connected with barms (the commentaries on classics pHFMDZR25S-HBVAg-Thy α of the hepatitis B surface antigen of Zadaxin
1Transformant and change pHMOXZR25S-HBVAg-Thy α
1Transformant) respectively select for use simultaneously three clones to carry out the test tube fermentation, different induction times (table 2, table 3, table 4 and table 5) sampling is adopted in the fermentation back, get 50 μ l supernatants behind the smudge cells and carry out its enzyme linked immunosorbent detection, its ELLISA detected result is shown in table 2, table 3, table 4 and table 5:
Table 2.pHFMDZR25S-HBVAg tunning detected result
| Bacterial classification clone 1 | OD 4500.186(30h) | OD 4500.496(50h) |
| Bacterial classification clone 2 | OD 4500.367(30h) | OD 4500.941(50h) |
| Bacterial classification clone 3 | OD 4500.278(30h) | OD 4500.876(50h) |
Table 3.pHFMDZR25S-HBVAg-Thy α
1The tunning detected result
| Bacterial classification clone 1 | OD 4500.083(30h) | OD 4500.291(50h) |
| Bacterial classification clone 2 | OD 4500.198(30h) | OD 4500.679(50h) |
| Bacterial classification clone 3 | OD 4500.302(30h) | OD 4500.889(50h) |
Table 4.pHMOXZR25S-HBVAg tunning detected result
| Bacterial classification clone 1 | OD 4500.272(30h) | OD 4500.414(50h) |
| Bacterial classification clone 2 | OD 4500.505(30h) | OD 4500.793(50h) |
| Bacterial classification clone 3 | OD 4500.378(30h) | OD 4500.776(50h) |
Table 5.pHMOXZR25S-HBVAg-Thy α
1The tunning detected result
| Bacterial classification clone 1 | OD 4500.300(30h) | OD 4500.462(50h) |
| Bacterial classification clone 2 | OD 4500.298(30h) | OD 4500.679(50h) |
| Bacterial classification clone 3 | OD 4500.298(30h) | OD 4500.587(50h) |
The result shows, connected the expression that does not influence hbsag gene behind the thymosin gene in the hepatitis B surface antigen back, the amount of different induction time tunnings is different, induces 50 hours tunning obviously more than inducing 30 hours tunning.Expression product all has the antigenic activity of hepatitis B surface antigen.
Sequence table
<160>9
<210>1
<211>105
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>1
ggcggcggcg gctctaagag atctgacgct gctgttgaca cttcttctga gattactact 60
aaggacttga aggagaagaa ggaggttgtt gaggaggctg agaac 105
<210>2
<211>28
<212>PRT
＜213〉Genus Homo people (Homo sapiens)
<400>2
Ser Asp Ala Ala Val Asp Thr Ser Ser Glu Ile Thr Thr Lys Asp Leu
1 5 10 15
Lys Glu Lys Lys Glu Val Val Glu Glu Ala Glu Asn
20 25
<210>3
<211>783
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>3
atggagaaca tcacatcagg attcctagga cccctgctcg tgttacaggc ggggtttttc 60
ttgttgacaa gaatcctcac aataccgcag agtctagact cgtggtggac ttctctcaat 120
tttctagggg gatcacccgt gtgtcttggc caaaattcgc agtccccaac ctccaatcac 180
tcaccaacct cctgtcctcc aatttgtcct ggttatcgct ggatgtgtct gcggcgtttt 240
atcatattcc tcttcatcct gctgctatgc ctcatcttct tattggttct tctggattat 300
caaggtatgt tgcccgtttg tcctctaatt ccaggatcaa caacaaccag tacgggacca 360
tgcaaaacct gcacgactcc tgctcaaggc aactctatgt ttccctcatg ttgctgtaca 420
aaacctacgg atggaaattg cacctgtatt cccatcccat cgtcctgggc tttcgcaaaa 480
tacctatggg agtgggcctc agtccgtttc tcttggctca gtttactagt gccatttgtt 540
cagtggttcg tagggctttc ccccactgtt tggctttcag ctatatggat gatgtggtat 600
tgggggccaa gtctgtacag catcgtgagt ccctttatac cgctgttacc aattttcttt 660
tgtctctggg tatacattgg cggcggcggc tctaagagat ctgacgctgc tgttgacact 720
tcttctgaga ttactactaa ggacttgaag gagaagaagg aggttgttga ggaggctgag 780
aac 783
<210>4
<211>261
<212>PRT
＜213〉artificial sequence
<220>
<223>
<400>4
Met Glu Asn Ile Thr Ser Gly Phe Leu Gly Pro Leu Leu Val Leu Gln
1 5 10 15
Ala Gly Phe Phe Leu Leu Thr Arg Ile Leu Thr Ile Pro Gln Ser Leu
20 25 30
Asp Ser Trp Trp Thr Ser Leu Asn Phe Leu Gly Gly Ser Pro Val Cys
35 40 45
Leu Gly Gln Asn Ser Gln Ser Pro Thr Ser Asn His Ser Pro Thr Ser
50 55 60
Cys Pro Pro Ile Cys Pro Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe
65 70 75 80
Ile Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe Leu Leu Val
85 90 95
Leu Leu Asp Tyr Gln Gly Met Leu Pro Val Cys Pro Leu Ile Pro Gly
100 105 110
Ser Thr Thr Thr Ser Thr Gly Pro Cys Lys Thr Cys Thr Thr Pro Ala
115 120 125
Gln Gly Asn Ser Met Phe Pro Ser Cys Cys Cys Thr Lys Pro Thr Asp
130 135 140
Gly Asn Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala Phe Ala Lys
145 150 155 160
Tyr Leu Trp Glu Trp Ala Ser Val Arg Phe Ser Trp Leu Ser Leu Leu
165 170 175
Val Pro Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr Val Trp Leu
180 185 190
Ser Ala Ile Trp Met Met Trp Tyr Trp Gly Pro Ser Leu Tyr Ser Ile
195 200 205
Val Ser Pro Phe Ile Pro Leu Leu Pro Ile Phe Phe Cys Leu Trp Val
210 215 220
Tyr Ile Gly Gly Gly Gly Ser Lys Arg Ser Asp Ala Ala Val Asp Thr
225 230 235 240
Ser Ser Glu Ile Thr Thr Lys Asp Leu Lys Glu Lys Lys Glu Val Val
245 250 255
Glu Glu Ala Glu Asn
260
<210>5
<211>681
<212>DNA
＜213〉hepatitis B virus (Hepatitis B virus)
<400>5
atggagaaca tcacatcagg attcctagga cccctgctcg tgttacaggc ggggtttttc 60
ttgttgacaa gaatcctcac aataccgcag agtctagact cgtggtggac ttctctcaat 120
tttctagggg gatcacccgt gtgtcttggc caaaattcgc agtccccaac ctccaatcac 180
tcaccaacct cctgtcctcc aatttgtcct ggttatcgct ggatgtgtct gcggcgtttt 240
atcatattcc tcttcatcct gctgctatgc ctcatcttct tattggttct tctggattat 300
caaggtatgt tgcccgtttg tcctctaatt ccaggatcaa caacaaccag tacgggacca 360
tgcaaaacct gcacgactcc tgctcaaggc aactctatgt ttccctcatg ttgctgtaca 420
aaacctacgg atggaaattg cacctgtatt cccatcccat cgtcctgggc tttcgcaaaa 480
tacctatggg agtgggcctc agtccgtttc tcttggctca gtttactagt gccatttgtt 540
cagtggttcg tagggctttc ccccactgtt tggctttcag ctatatggat gatgtggtat 600
tgggggccaa gtctgtacag catcgtgagt ccctttatac cgctgttacc aattttcttt 660
tgtctctggg tatacatttg a 681
<210>6
<211>512
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>6
gtcgacgaac ccgcgtttga gtacttgctc aagctttctg gtagacgttg tagtactcat 60
gaaacaagcc ttagcactct gatctgtttc tcttgggtag cggtgagtgg tttattggag 120
ttcactggtt tcagcaaatc tgtcatctag acaatattgt tactaaattt ttttgaacat 180
acaattgttc gtaattcatc tattattata catcctcgtc agcaatttct ggcagacgga 240
gtttactaca acgtctttga gtatgaggcc gagaaatcca gctctgtggc catactcagt 300
cttgacagcc tgctgatgtt ggctgcgttc aacgcaataa gcgtgtcctc cgactccgag 360
ttgtgctcgt tatcgtcgtt ctcatcctcg gaaaaatcac acgaaagaac atactcacca 420
gtaggctttc tggtccctgg ggcacggctg tttctgacgt attccggcgt tgataatagc 480
tcgaaagtga acgccgagtc gcgggagtcg ac 512
<210>7
<211>2807
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>7
agactactgg caggatcaac cagataacta tctgatgtta ggccggaacc taacaagcgc 60
ttcccgctaa acagcccgag agctgtccag cagacaaagc agcagatatt attatcagtt 120
cgcaatcaag attccaagag aaatctcaat cggcagaagc ccaccgcgcc ggccgcttta 180
ctggccctcg cagagactaa ctgcatccat atagccctct ttgagttctc ccgaataatt 240
tccgcaaaat cattttggca gctgataacg ctaccaaaag tttttacatc attatcctgg 300
aaggaagtta caagcagaaa catcacgtag taaaaaaaaa ctacggctat gcttcgctgc 360
agactcccaa attcgtcttt agtagagttc ttgccatagg ctagtaatcc actaaatcca 420
tcagtgctca cacacaaaaa taattagaaa tttggtatga gactgttcag gctactcagg 480
ccatcaaaaa ttattttttt gtgaccgccc aagatcaccc atgttgaatt agccttgaga 540
gaaagtgtat ctgacgataa caactttact ctctccacta atcaacgagg ccttgaagag 600
ttcttttcag aactcccttt cgaagatcga accccaaacg cgcagaagct ttcgcttctt 660
cacattcagt tttcaaatct tcttttatgc tttcgcatga aagtccatcc gcatctctca 720
cgtataattt cctctccaat ataatttatt ccaaaatttc catagttatg catttacttt 780
tttttcgcaa ctctctccag ctttttatat ttttcatttc gattctaatt ctataccatc 840
tccaaatatt attcccccga cgtatttctt tgtaccacga aatttttact tcgtgccacc 900
ccctactacg cgacaaccaa aaaattaaag atactcaaaa aaccacaatc tcgtcactgg 960
aatatggagt ttctacgctt tgcagtcaat tccctttaac attgacattg tgcaggtctc 1020
caaattgaca ttcatacaat ccatgccggt tcttcatttt tcaacaggag atcctcttct 1080
aatttccaat ttctccatct ttttaattct cctacgtaga atcgtcaaac cactcataca 1140
atatcacttc agtacatcct tcatctacgg ttacagtggt cttctctatc atccatcata 1200
ctatctcacc taccaagaaa aaaaaaaaat attatggtta cgcatttcgt tctacaacag 1260
ctgccaccac cagccaacag ttagttgaaa agtacttctc ccttgctaaa tccatatccc 1320
ccactcgttt ccatactctt tcggttgcgg ccatatctag cagaaagcac cgtttcccgt 1380
ccgatcaact gtagttaagc tgctaagagc ctgaccgagt agtgtagtgg gagaccatac 1440
gcgaaactca ggtgctgcaa tctttttttt ttttattatt tttttttccc ttccctccag 1500
tccaacgcgg tctcgaggtc gcgttctgca tcaatccatt gtctatccaa acgtctatat 1560
atatatgccc acctcttcca cacctatctt ttttttcctc ccagcacgta gagaagagtg 1620
gtcgccaatc ctaatccctc cgacttcttc ttgtaatcct gcctttagga agagcagcaa 1680
cagtggtatg gtgcaaaaag tcttcattca tcctttacca ctaccacttt ttttgccggc 1740
tcttccaggc accttgtagc acctctttca actctgccac catctctata cttaaatttt 1800
cctttccagc gccagataac aaacaggacg tgtgccacac actttgcatc acagaatatc 1860
tgtcgattct gcctactttt gttagcttag ttgcccgtat cgtactcact tttcatacga 1920
caaccatcaa ttaccataca ttttttttca tttaccttct attttactat ggtacagaat 1980
atctgtcatt tgtcagagct caggacactt ctattggcca atatcacccg aaatgtttga 2040
gctagatatc cttacaccac ttcactactc acatcgaaaa ttcaatctaa attattgaag 2100
gcttgctacc aaaaaaaaat aaagaaaaat aaaaaaaaaa aatcatatcc ctgaaaaata 2160
catgataata ataataagta ggaaaaaaaa aaaaattaga aaaataatgc tggttcctct 2220
cctcgactca aatgtttttt ttatacacca tccagaattg ttccacgcac gacctctgct 2280
tcaaaaaaat taaaaatctc ctctaaaaga cacccggcta ccaccaagta atatctctta 2340
ggggagattg tgttgtgtaa acacaaacaa atcggacaac tgaggcttaa tctcagcaga 2400
tcgtaacaac aaggctactc tactgcttac aataccccgt tgtacattta agtcgtatgc 2460
aaaggattta tcctcgcgca taatgacatt gctatccacc ggcaagcact taaaaccttt 2520
ccgttaaaag caccattgcc agcctgctat ggttcagcga cacagagtgc cttattcgta 2580
tccaactaaa atgtgcgagg gcaagaaatc atcgctttct agcatggatt ctgacttaga 2640
ggcgttcagc cattatccag cagatggtag cttcgcggca atgcctgatc agacagccgc 2700
aaaaaccaat tatctgaatg aacggttcct ctcgtactaa gttcaattac tattgcgata 2760
acattcatca gtagggtaaa actaacctgt ctcacgacgg tctaaac 2807
<210>8
<211>556
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>8
agcggtcttg gaggagctga ttggatctag atgaaatagg aaatataatt atggctctac 60
tgcgctgcgt aaacgtcact gtaggcgatt tcgcttagcc caagtccgcg atgcggtccg 120
acgacaccag agcgcgtcca cctcctgtgc gccgcaccgc ccccaaagga ggttgcggct 180
gtgcggctcg acgcgaccaa aaaaataagc gtcaaaagga ggtgtcaggg aagcacgccg 240
tggggctcga gatatataaa gcgcagcgta gctttgtctg tcttgctaat gagcgacgac 300
caagccttgg aaattttcct gaaatccccc gtcacccagg acatgatcca ccacttggtg 360
acggtcacct tacaggttct gccttgcgag tcctccaaga ccatcaccca gaaagtcaag 420
tcttcagccg acacagagcc cgtgctcaag accaagccgc tgccctcgct gcatgacttt 480
caccaagctc gtccgctata ccaacgtcta cacgggaacg ttgatgtcga ccatcgtgtt 540
cctcaacaga ctncaa 556
<210>9
<211>382
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>9
tctagacgtg gaaggacata ccgcttttga gaagcgtgtt tgaaaatagt tctttttctg 60
gtttatatcg tttatgaagt gatgagatga aaagctgaaa tagcgagtat aggaaaattt 120
aatgaaaatt aaattaaata ttttcttagg ctattagtca ccttcaaaat gccggccgct 180
tctaagaacg ttgtcatgat cgacaactac gactcgttta cctggaacct gtacgagtac 240
ctgtgtcagg agggagccaa tgtcgaggtt ttcaggaacg atcagatcac cattccggag 300
attgagcagc tcaagccgga cgttgtggtg atatcccctg gtcctggcca tccaagaaca 360
gactcgggaa tatctcggat cc 382
Claims (10)
1, a kind of anti-hepatitis B virus fusion protein is tight successively placed in-line hepatitis B virus surface antigen, connection peptides, zymoplasm recognition site and Zadaxin from aminoterminal to carboxyl terminal; The aminoacid sequence of described connection peptides is GlyGlyGlyGlySer; The aminoacid sequence of described zymoplasm recognition site is LysArg; The aminoacid sequence of described Zadaxin is shown in sequence in the sequence table 2.
2, anti-hepatitis B virus fusion protein according to claim 1 is characterized in that: described anti-hepatitis B virus fusion protein is the protein with one of following aminoacid sequence:
1) the SEQ ID № in the sequence table: 4 amino acid residue sequence;
2) with SEQ ID № in the sequence table: the replacement of one or several amino-acid residue of amino acid residue sequence process of 4 and/or disappearance and/or interpolation and protein with hepatitis B virus resistance.
3, the encoding gene of claim 1 or 2 described anti-hepatitis B virus fusion proteins.
4, encoding gene according to claim 3 is characterized in that: the encoding gene of described anti-hepatitis B virus fusion protein has one of following nucleotide sequence:
1) SEQ ID № in the sequence table: 3 dna sequence dna;
2) SEQ ID № in the code sequence tabulation: the polynucleotide sequence of april protein sequence;
3) under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 3 dna sequence dnas hybridization that limit.
5, contain claim 3 or 4 described expression carrier, clone or host bacterium.
6, a kind of vaccine that prevents and/or treats hepatitis B, its activeconstituents are claim 1 or 2 described anti-hepatitis B virus fusion proteins.
7, a kind of method of expressing claim 1 or 2 described anti-hepatitis B virus fusion proteins is in the encoding gene importing multiple-shaped nuohan inferior yeast with described anti-hepatitis B virus fusion protein, expresses obtaining anti-hepatitis B virus fusion protein.
8, method according to claim 7 is characterized in that: the encoding gene of described anti-hepatitis B virus fusion protein is by expression vector pHMOXZR25S-HBVAg-Thy α
1Or pHFMDZR25S-HBVAg-Thy α
1Import in the multiple-shaped nuohan inferior yeast.
9, method according to claim 8 is characterized in that: described pHMOXZR25S-HBVAg-Thy α
1Or pHFMDZR25S-HBVAg-Thy α
1Method by electroporation imports multiple-shaped nuohan inferior yeast.
10, method according to claim 9 is characterized in that: described multiple-shaped nuohan inferior yeast is AS2.2412.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100078694A CN100368438C (en) | 2006-02-21 | 2006-02-21 | Anti-hepatitis B virus fusion protein and its coding gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100078694A CN100368438C (en) | 2006-02-21 | 2006-02-21 | Anti-hepatitis B virus fusion protein and its coding gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1810839A true CN1810839A (en) | 2006-08-02 |
| CN100368438C CN100368438C (en) | 2008-02-13 |
Family
ID=36843973
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2006100078694A Expired - Fee Related CN100368438C (en) | 2006-02-21 | 2006-02-21 | Anti-hepatitis B virus fusion protein and its coding gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100368438C (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102199217A (en) * | 2011-04-01 | 2011-09-28 | 中国人民解放军第三军医大学 | Hepatitis B virus multi-epitope fusion protein and preparation method and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1113952A (en) * | 1994-06-23 | 1995-12-27 | 北京医科大学 | Interleukin 2-hepatitis B virus pro-S antigen coalescence protein and its preparing method and application |
| CN1191271C (en) * | 2001-03-21 | 2005-03-02 | 中国科学院上海生物化学研究所 | Thymic peptide fusion protein as one new interferon and its prepn. and use |
| CN1523040A (en) * | 2003-09-05 | 2004-08-25 | 重庆康尔威药业股份有限公司 | Fusion protein of human thymosin alpha1 and human composite interferon and preparation thereof |
-
2006
- 2006-02-21 CN CNB2006100078694A patent/CN100368438C/en not_active Expired - Fee Related
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102199217A (en) * | 2011-04-01 | 2011-09-28 | 中国人民解放军第三军医大学 | Hepatitis B virus multi-epitope fusion protein and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100368438C (en) | 2008-02-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN85106190A (en) | The production of hepatitis B virus surface antigen | |
| CN101054582A (en) | A-type kreotoxin receptor combination region Hc, coding protein and application thereof | |
| CN1990869A (en) | Chicken infectivity bursa of Fabricius virus VP2 cDNA, its expression vector, expressed recombinant protein and application thereof | |
| CN1283780C (en) | Method for constructing genetic engineering fungus of monascus with no citrinin | |
| CN1990871A (en) | Preparation method of recombinant human plasminogen Kringle 5(hk5) | |
| CN1705747A (en) | Vector for anti-HPV vaccine and transformed microorganism by the vector | |
| CN1807452A (en) | Helicobacter Pylori urease B subunit Th epitope peptide, its coding DNA, vaccine and uses | |
| CN1255540C (en) | Vaccine-induced hepatitis B viral strain and uses thereof | |
| CN1733798A (en) | Hepatitis B virus surface L protein related peptide | |
| CN1874787A (en) | Composition for the prophylaxis/treatment of HBV infections and HBV-mediated diseases | |
| CN101036784A (en) | Toxicity T cell position vaccine of the cell for treating Hepatitis B and the preparing method | |
| CN1833723A (en) | Chain coccus recombination subunit vaccine and prepn. thereof | |
| CN1657102A (en) | SARS-Cov gene vaccine based on epi-position and its contruction | |
| CN101057975A (en) | Cocktail vaccine for anti immune tolerance and immunodeficiency virus and its application | |
| CN1810839A (en) | Anti-hepatitis B virus fusion protein and its coding gene and application | |
| CN1171636C (en) | Hepatitis B DNA vaccine | |
| CN1258317A (en) | Process for expression of genes of dengue viruses | |
| CN1030093A (en) | The production of peptide | |
| CN1268392C (en) | Vaccine of recombined albumen for preventing and treating infection of human C type hepatitis virus and its usage | |
| CN1289146C (en) | Nucleic acid vaccin for preventing and treating hepatitis B virus inflammation and its preparation | |
| CN1246459C (en) | Human composite alpha-interferon engineered gene, its expression and production thereof | |
| CN1298388C (en) | Herpes simplex virus II type DNA vaccine | |
| CN1864746A (en) | Gene engineered poly-valence subunit vaccine of Hp AhpC and preparation method thereof | |
| CN1737147A (en) | Heat shock protein 65- multiple epitope hepatitis B virus core antigen recombinant protein (HSP65-HBcAg) | |
| CN1966074A (en) | Combined vaccine for anthrax and black death |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080213 |