CN1759183A - Method - Google Patents

Abstract

A method for the in situ production of an emulsifier in a foodstuff, wherein a lipid acyltransferase is added to the foodstuff. Preferably the emulsifier is produced without an increase or without a substantial increase in the free fatty acid content of the foodstuff. Preferably, the lipid acyltransferase is one which is capable of transferring an acyl group from a lipid to one or more of the following acyl acceptors: a sterol, a stanol, a carbohydrate, a protein or a sub-unit thereof, glycerol. Preferably, in addition to an emulsifier one or more of a stanol ester or a stanol ester or a protein ester or a carbohydrate ester or a diglyceride or a monoglyceride may be produced. One or more of these may function as an additional emulsifier.

Description

Method

CROSS-REFERENCE TO RELATED APPLICATION

The application with reference to following relevant in please: on July 20th, 1999 submitted to, serial application number is that 09/750,990 U. S. application and application number are 10/409,391 U. S. application.Each document (" document that application is quoted ") of quoting in each piece of each piece application and these applications, each piece institute of the present invention reference and every piece of document quoting, no matter in text or in the checking process of those applications, and the document of all support patentabilities that in these checking process, propose, be included in herein as a reference.This paper text has also been quoted various files (" at this reference document ").Each piece of writing " this paper reference document " and each piece are quoted in " this paper institute reference document " or the document of reference is included in herein as a reference.

TECHNICAL FIELD OF THE INVENTION

The present invention relates to use acyltransferase original position in food to produce the method for emulsifying agent.

The invention still further relates to and use acyltransferase original position in food to produce the method for emulsifying agent, wherein said method does not increase or does not increase substantially the free fatty acids in the described food when making this emulsifying agent of generation.

The invention still further relates to and use acyltransferase original position in food to produce the method for at least two kinds of emulsifying agents.

The invention still further relates to and use acyltransferase original position in food to produce the method for carbohydrate ester and/or sterol ester and/or stanol ester and/or protein ester and/or glyceryl ester and/or alcohol ester.

The present invention relates to contain the enzyme food composition and/or the feed enzyme composition of acyltransferase, and described composition purposes in the methods of the invention.

The invention still further relates to the method for identifying suitable acyltransferase of the present invention, and the acyltransferase of being identified as described above.

The present invention further also relates to immobilized acyltransferase.

Technical background

As everyone knows, Phospholipid hydrolase of in food or fodder industry, using for many years and lipase (the favourable purposes that is called lipolytic enzyme (EC.3.1.1.x).

For example, claim that in EP 0 585988 adding lipase in dough has the effect that promotes anti-corrupt (antistaling) effect.The lipase that prompting obtains from rhizopus arrhizus bacterium (Rhizopus arrhizus) with shortening/fat (shortening/fat) coupling the time, adds the quality that can improve the bread of being produced in the dough to.Be taught among the WO94/04035 in the dough and add lipase and can improve flexibility and not need to add in addition lipid or oils.Castello, P.ESEGP 89-10Dec.1999 Helsinki shows that exogenous lipase can change loaf volume.

Lipolytic enzyme (lipolytic enzyme) can go out the lipid hydrolysis in the food one or more lipid acid, makes to produce effectively (powerful) emulsifying agent molecule in the food, and this provides the function that commercial value is arranged.Provide that the molecule of significant emulsification property is a partial hydrolysate, such as lysophospholipid (lyso-phospholipid), haemolysis glycolipid (lyso-glycolipid) and monoglyceride (mono-glyceride) molecule.The polar lipid hydrolysate is concrete preferred as lysophospholipid and haemolysis glycolipid.When making bread, the emulsifying agent that described original position produces can play and the suitable effect of emulsifying agent (such as DATEM).

But the activity of lipolytic enzyme also causes the accumulation of free fatty acids, and this may produce undesirable action to food.The intrinsic activity of lipolytic enzyme has limited their function.

This area has been attempted several different methods and has been solved this technical problem.Yet these methods can cause in the food free lipid acid significantly to increase, and particularly for the high food of water content, include but are not limited to bread dough and yolk.

Phospholipid hydrolase, particularly Phospholipase A2 (E.C.3.1.1.4), in egg or egg based food are handled, use for many years (for example referring to US 4,034,124 and Dutihl ﹠amp; Groger 1981 J.Sci.FoodAgric.32,451-458), Phospholipid hydrolase accumulates the polarity lysolecithin with emulsifying agent effect in egg or the processing of egg based food, Phospholipid hydrolase is handled egg or egg based product can improve stability, thermostability during as thermal treatments such as pasteurizations, and have tangible densification.Egg based product includes but are not limited to cake, mayonnaise, salad cream, flavouring paste, ice-creams or the like.The application of Phospholipid hydrolase is accumulated free fatty acids.Accumulating of free fatty acids may obviously influence product fragrance, and in addition, accumulating of free fatty acids makes product be easy to oxidation, so shelf life of products is short, easy to change and other food critical nature such as taste and quality change.Recently, the lipolytic enzyme marketization with extensive substrate specificity is used to handle yolk and relevant food.Their advantage is the Phospholipase A2 unlike majority, and they are not to come from Mammals.But they can cause free fatty acids significantly to be accumulated, and are not only the hydrolysis that causes phosphatide, also comprise the hydrolysis that causes triglyceride level.

As above-mentioned, another field of lipase widespread use is the bread production.The eighties is early stage, and Phospholipid hydrolase just has been applied to baking process.

The substrate of lipase effect is a 1.5-3% endogenous wheat lipid in the wheat-flour, and described endogenous wheat lipid is the mixture of polarity and non-polar lipid.Polar lipid is divided into glycolipid and phosphatide.The glycerine of these lipids and two lipid acid and the esterification of a polar group institute constitutes.This polar group produces contribution to the surfactivity of these lipids.Enzymolysis to one of lipid acid in these lipids can make lipid have higher surfactivity.Known, the emulsifying agent that has a high surface such as DATEM etc. is added in the dough and can produces remarkable effect.

Yet lipase (E.C.3.1.1.X) uses in living Noodles product and can produce detrimental effect to yeast activity, and/or loaf volume is had a negative impact, and the negative impact of loaf volume is often explained so that dosage is excessive.The excessive gluten elastic force that causes of dosage descends, and this makes dough really up to the mark, and loaf volume is dwindled.In addition, or optional, these lipase can be degraded and be added shortening, grease and butterfat in the dough to, cause the taste of dough and bakery to degenerate.Excessive and the taste of dosage the accumulating that degenerate owing to free lipid acid in the dough.

According to EP 1 193 314, put down in writing among EP 0 977869 and the WO01/39602, in the process of making bread, use the lipolytic enzyme that acts on glycolipid very big benefit is arranged, its partial hydrolysate-haemolysis glycolipid has strong emulsifying effect, obviously causes accumulating the more a high proportion of positive emulsifying agent effect of comparing with free fatty acids bad.But enzyme has significant non-selective effect to triglyceride level, thereby produces unnecessary a large amount of free fatty acidies.

WO00/32758 has reported same discovery, except that to long-chain but not short chain fatty acid selectively the variant, also discloses the lipolytic enzyme variants that phosphatide and/or glycolipid is had enhanced activity.WO01/39602 also discloses a back characteristic, thinks to preventing that free short chain fatty acid from accumulating the taste that causes and degenerating particularly important.Yet, can produce a large amount of free fatty acidies.

Mention the high triglyceride activity problems at W002/094123, the use lipolytic enzyme acts on the polar lipid (as phosphatide and glycolipid) in the dough, and does not have activity substantially for triglyceride level or 1-monoglyceride.But can produce a large amount of free fatty acidies.

Some lipolytic enzyme presents low activity or non-activity to polar lipid (as glycolipid/phosphatide) when being in dissolved state.This zymoid is used and is considered to preferred, assembles producing optimal efficacy because this fermentoid can make the solvable lipid of high polarity (lyso-lipid).But free fatty acids also can be accumulated simultaneously.This selectivity function is Phospholipase A2 and the characteristics that are disclosed in the glycolipid among EP 0,977 869, EP 1 193 314 and the WO01/39602.The variant enzyme that has prepared low selectivity lipolytic enzyme compares the solvable lipid activity of polarity lower (WO03/060112) with its parent enzyme.But having significant free fatty acids generates.

Point out among the WO00/05396 to contain in a kind of course of processing of emulsifying agent food, food raw material contacts with enzyme, under the effect of enzyme, can just generate emulsifying agent from fatty acid ester, and second functional ingredient produces from second composition.WO00/05396 has also instructed the concrete purposes of lipase or lipase.But do not talk about the detailed directions of acyltransferase in WO00/05396, in addition, WO00/05396 speaks of, and uses esterase and lipase can cause significant free fatty acids to be accumulated in the high food of water content.

The shortcoming of using lipase to comprise that Phospholipid hydrolase and glycolipid enzyme are supervened can be caused by the free fatty acids accumulation that lipid discharges.In the past twenty years, lipolytic enzyme is limited in Application in Food to be because free fatty acids is deleterious accumulates and a kind of equilibrium relationship that exists between the generation of solvable lipid of active effect arranged.Though carried out a large amount of trials in this area, some of them have obviously been improved function, prior art none method can illustrate and solve root problem fully, promptly has free fatty acids to accumulate in a large number in the food with the lipolytic enzyme produced in situ.

Exist high-level free fatty acids (FFA) generally to be considered to mass defect in unprocessed raw material or the foods prods, foodstuff production merchant and human consumer have often stipulated the highest level of FFA in codex Alimentarius.Excessive FFA level may cause the defective on the organ sensation and/or on the function.

Lipolysis can cause the hydrolysis of food to be become sour, form special " soap " smell, this " soap " smell is particularly remarkable to the lipid acid of the important component medium chain degree (C8-C12) in food such as milk-product or the vegetables oil, although this lipid acid can not exist by high level.A more general sensory organ deficiency is because the associating effectiveness of lipolytic enzyme and oxidising process.It is more responsive when unsaturated fatty acids than it esterification takes place to the enzymatic oxidn effect when non-esterified in the acyl group lipid.

Confirmed that high-level FFA causes the food function defective, but still can not good explanation.Be not limited to theory, the lipid hydrolysis that does not change becomes carboxylic acid to make [H ⁺] increase, and produce and other compound or metal ion bonded carbonyl.Free fatty acids can also be by hydrophobic interaction and protein bound, combines with starch in cooking process (complex).FFA can also disturb the effect (AcademicPress 1983. for Lipid in Cereal Technology, P.J.Bames) of surfactant such as polar lipid and emulsifying agent

WO03/100044 discloses the acyltransferase that a class is known as PDAT (or ATWAX).These enzymes utilize monoglyceride or triglyceride as acceptor molecule, as donor molecule, produce following product with GranulestinLecithin (PC): soluble GranulestinLecithin, triacylglycerol and/or diacylglycerol.

In a specific embodiment, the present invention relates to whey-protein is mixed improvement in the food, provide and do not reduced the method that its quality for example improves output under the prerequisite of food compositions and the quality of product own.

The cheese composition usually by liquid milk products by comprising the process preparation of handling described liquid with condensing agent or peptizer.This condensing agent can be rennin (curding enzyme), acid, and perhaps suitable bacterial cultures, perhaps it comprises described culture.Casein, fat that the curdling piece that forms generally comprises through transforming comprise natural butter fat and work as the seasonings that uses bacterial cultures especially to need.The curdling piece can separate with liquid whey, contains the soluble proteins that not influenced by congealing reaction in the whey, does not therefore mix in the curdling piece.

Therefore whey is to produce the byproduct that the business method of cheese of food-is for example produced.On the traditional sense, whey is taken as useless refuse or is used as fertilizer or feed or be processed to food ingredient.

It is to cause the conventional inefficiency of producing of milk preparation such as cheese milk grumeleuse and make the major reason that protein solids all in the liquid mixes ultimate production reduction relevant in the gained cheese grumeleuse with initial breast that whey-protein can not be retained in the curdling piece fully.

Carry out many effort in order to whey-protein is covered in the cheese, for example by heat treated milk, the heat treated whey, or by filtering for example ultrafiltration.

But also induce piece record of whey-protein accumulative number relevant for using concrete proteolytic enzyme.The serine protease that comes from Bacillus licheniformis (Bacillus lichenformis) demonstrates the whey-protein accumulative ability (US 5,523,237) of inducing.

Yet also there are many difficult points in the interpolation whey-protein in the cheese such as making in production process.For example, whey-protein mixes in the cheese relevant with the decline of product taste and mouthfeel, further also can disturb the following process of condensing with product.Existing report adds cheese milk with proteolytic enzyme and is used for hydrolyzing lactoalbumin and causes caseic obvious hydrolysis, as Madsen, and J.S.﹠amp; Qvist, K.B. (1997) " Hydrolysisof milk protein by a Bacillus licheniformis protease specific for acidic aminoacid residues " (.J Food Sci.62,579-582) described in.

Therefore, need such method and composition in this area, it has improved whey-protein mixing in food when keeping organ sensation and other desired characteristic.This optimization can cause the raising of efficient, the raising of food output and the reduction of total raw material cost.

Lipase: cholesterol acyltransferase (cholesterol acyltransferase) has been known (referring to for example Buckley-Biochemistry Berkeley biological chemistry 1983,22,5490-5493).Particularly, have been found that glyceryl phosphatide: cholesterol acyltransferase (GCAT), it resembles plant and/or Mammals Yelkin TTS very much: cholesterol acyltransferase (LCAT), can the transfer of catalysis lipid acid between Yelkin TTS and cholesterol.

E Pudun (Upton) and Berkeley (Buckley) (TIBS 20, May 1995p 178-179) and cloth Rumi that section (Brumlik) and Berkeley (Buckley) (J.of Bacteriology Apr.1996p2060-2064) have instructed the lipase/acyltransferase that is derived from Aeromonas hydrophila (Aeromona hydrophila) acyl group can be transferred in water medium on the ethanol acceptor.

Brief summary of the invention

First aspect present invention provide a kind of in food original position produce the method for emulsifying agent, this method comprises that the acyltransferase of definition here adds the step in the food to.

On the other hand; the invention provides a kind of in food original position produce the method for emulsifying agent; generate under the situation that wherein said method makes the free fatty acids of described emulsifying agent in food not increase or not increase substantially, described method comprises adds a kind of acyltransferase in the food step.

On the other hand; the invention provides a kind of in food original position produce the method for emulsifying agent and sterol ester and/or stanol ester; generate under the situation that wherein said method makes the free fatty acids of described emulsifying agent in food not increase or not increase substantially, described method comprises adds a kind of acyltransferase in the food step.

On the other hand, the invention provides a kind of in food original position produce the method for emulsifying agent and sterol ester and/or stanol ester, described method comprises adds a kind of acyltransferase in the food step.

Another aspect of the present invention, provide a kind of in food original position produce the method for at least two kinds of emulsifying agents, described method comprises adds a kind of acyltransferase in the food step.

Another aspect of the present invention; provide a kind of in food original position produce the method for at least two kinds of emulsifying agents and sterol ester and/or stanol ester; generate under the situation that wherein said method makes the free fatty acids of described emulsifying agent in food not increase or not increase substantially, described method comprises adds a kind of acyltransferase in the food step.

Another aspect of the present invention provide a kind of in food original position produce the method for at least two kinds of emulsifying agents and sterol ester and/or stanol ester, described method comprises adds a kind of acyltransferase in the food step.

Another aspect of the present invention provide a kind of in food original position produce the method for carbohydrate ester, described method comprises adds a kind of acyltransferase in the food step.

Another aspect of the present invention provide a kind of in food original position produce the method for carbohydrate ester and emulsifying agent, described method comprises adds a kind of acyltransferase in the food step.

Another aspect of the present invention provide a kind of in food original position produce emulsifying agent; and the method for one or more carbohydrate esters, sterol ester, stanol ester, protein ester, monoglyceride or triglyceride, described method comprises adds a kind of acyltransferase in the food step.

Another aspect of the present invention provides a kind of production method that comprises a kind of food of emulsifying agent, and described method comprises that a kind of acyltransferase that will define adds the step in the food to here.

Another aspect of the present invention provides a kind of production method that comprises a kind of food of emulsifying agent; generate under the situation that wherein said method makes the free fatty acids of described emulsifying agent in food not increase or not increase substantially, described method comprises adds acyltransferase in the food step.

Another aspect of the present invention provides a kind of production method that comprises the food of emulsifying agent and sterol ester and/or stanol ester; generate under the situation that wherein said method makes the free fatty acids of described emulsifying agent in food not increase or not increase substantially, described method comprises adds a kind of acyltransferase in the food step.

Another aspect of the present invention provides a kind of production method that comprises the food of emulsifying agent and sterol ester and/or stanol ester, and described method comprises adds a kind of acyltransferase in the food step.

Another aspect of the present invention provides a kind of production method that comprises the food of at least two kinds of emulsifying agents, and described method comprises adds a kind of acyltransferase in the food step.

Another aspect of the present invention provides a kind of production method that comprises the food of at least two kinds of emulsifying agents and sterol ester and/or stanol ester; generate under the situation that wherein said method makes the free fatty acids of described emulsifying agent in food not increase or not increase substantially, described method comprises adds a kind of acyltransferase in the food step.

Another aspect of the present invention provides a kind of production method that comprises the food of at least two kinds of emulsifying agents and sterol ester and/or stanol ester, and described method comprises adds a kind of acyltransferase in the food step.

Another aspect of the present invention provides a kind of production method that comprises the food of carbohydrate ester, and described method comprises adds a kind of acyltransferase in the food step.

Another aspect of the present invention provides a kind of production method that comprises the food of carbohydrate ester and emulsifying agent, and described method comprises adds a kind of acyltransferase in the food step.

Another aspect of the present invention provides a kind of production method that comprises the food of emulsifying agent and one or more carbohydrate esters, sterol ester, stanol ester, protein ester, monoglyceride or triglyceride, and described method comprises adds a kind of acyltransferase in the food step.

Another aspect of the present invention provides acyltransferase to be used for containing from the food raw material preparation purposes of the food of emulsifying agent, and wherein said emulsifying agent produces from the food raw material component by acyltransferase.

Another aspect of the present invention provides acyltransferase to be used for containing from the food raw material preparation purposes of the food of emulsifying agent; generate under the situation that wherein said method makes the free fatty acids of described emulsifying agent in food not increase or not increase substantially, wherein said emulsifying agent produces from the food raw material component by acyltransferase.

On the other hand; the invention provides the purposes that acyltransferase is used for containing from the food raw material preparation food of emulsifying agent and sterol ester and/or stanol ester; generate under the situation that wherein said method makes the free fatty acids of described emulsifying agent in food not increase or not increase substantially, wherein said emulsifying agent and/or sterol ester and/or stanol ester produce from the food raw material component by acyltransferase.

On the other hand; the invention provides the purposes that acyltransferase is used for containing from the food raw material preparation food of emulsifying agent and sterol ester and/or stanol ester, wherein said emulsifying agent and/or sterol ester and/or stanol ester produce from the food raw material component by acyltransferase.

On the other hand, the invention provides the purposes that acyltransferase is used for containing from the food raw material preparation food of at least two kinds of emulsifying agents, wherein said two kinds of emulsifying agents produce from the food raw material component by acyltransferase.

The present invention provides acyltransferase to be used for containing from the food raw material preparation purposes of the food of at least two kinds of emulsifying agents and sterol ester and/or stanol ester on the other hand; generate under the situation that wherein said method makes the free fatty acids of described emulsifying agent in food not increase or not increase substantially, one or both of described emulsifying agent and/or sterol ester and/or stanol ester produce from the food raw material component by acyltransferase.

The present invention provides acyltransferase to be used for containing from the food raw material preparation purposes of the food of at least two kinds of emulsifying agents and sterol ester and/or stanol ester on the other hand, and one or both of described emulsifying agent and/or sterol ester and/or stanol ester produce from the food raw material component by acyltransferase.

The present invention provides acyltransferase to be used for containing from the food raw material preparation purposes of the food of carbohydrate ester on the other hand, and wherein said carbohydrate ester produces from the food raw material component by acyltransferase.

On the other hand; the invention provides the purposes that acyltransferase is used for containing from the food raw material preparation food of at least a carbohydrate ester and other emulsifying agent, wherein said carbohydrate ester and emulsifying agent produce from the food raw material component by acyltransferase.

On the other hand; the invention provides the purposes that acyltransferase is used for containing from the food raw material preparation food of emulsifying agent and one or more carbohydrate esters, sterol ester, stanol ester, protein ester, monoglyceride or triglyceride, wherein said emulsifying agent and/or carbohydrate ester and/or sterol ester and/or stanol ester and/or protein ester and/or monoglyceride and/or triglyceride produce from the food raw material component by acyltransferase.

The present invention provide on the other hand a kind of in based on the food of eggs original position produce the method for emulsifying agent (preferred lysolecithin) and sterol ester; generate under the situation that wherein said method makes the free fatty acids of described emulsifying agent in food not increase or not increase substantially, described method comprises adds a kind of acyltransferase in the food step.

The present invention provide on the other hand a kind of in based on the food of eggs original position produce the method for emulsifying agent (preferred lysolecithin) and sterol ester, wherein said method comprises adds a kind of acyltransferase in the food step.

On the other hand; the invention provides a kind of production method of the food based on eggs; contain a kind of emulsifying agent (preferred lysolecithin) and sterol ester in the described food based on eggs; generate under the situation that wherein said method makes the free fatty acids of described emulsifying agent in food not increase or not increase substantially, described method comprises adds a kind of acyltransferase in the food step.

On the other hand; the invention provides a kind of production method of the food based on eggs; contain emulsifying agent (preferred lysolecithin) and sterol ester in the described food based on eggs, described method comprises adds a kind of acyltransferase in the food step.

The present invention also provides food available according to method of the present invention, that preferably obtain on the other hand.

On the other hand, the invention further relates to the enzyme food composition that comprises acyltransferase and/or feed enzyme composition and the described composition purposes in the bright method of we.

The present invention further provides a kind of discrimination method of acyltransferase of the present invention's of being suitable for application on the other hand, this method may further comprise the steps: use " the transferring enzyme assay method in the low moisture environment " (" Transferase Assay in a Low Water environment "), among " the transferring enzyme assay method in the high-moisture yolk " (" Transferase Assay in High Water Egg Yolk ") or " the transferring enzyme assay method in the buffered substrate " (" Transferase Assay in Buffered Substrate ") one or more are measured target enzyme, and select a kind of acyltransferase, this enzyme has following one or more character: (a) use " the transferring enzyme assay method in the low moisture environment " when detecting, be selected from 30 in process, has at least 1% relative transferase active after one of 20 or 120 minutes time; (b) in the yolk that contains 54% moisture, use " the transferring enzyme assay method in the high-moisture yolk " when detecting, have relative transferase active up to 100%; Perhaps (c) application " the transferring enzyme assay method in the buffered substrate " when detecting, has at least 2% acyltransferase activity.

The present invention also further provides a kind of acyltransferase that method of the present invention is identified of using.

On the other hand, the invention provides a kind of immobilized liposome acyltransferase of definition here.

Detailed description of the present invention

The term " acyltransferase " that this paper uses is meant a kind of enzyme that also has a lipase activity (enzyme nomenclature according to NK of international biochemical molecule biology federation recommends (EnzymeNomenclature Recommendations) (1992) to be categorized as E.C.3.1.1.x usually); this enzyme also has acyltransferase activity (being categorized as E.C.2.3.1.x usually); this endonuclease capable is transferred to one or more receptor substrates, for example one or more of following material with acyl group from a kind of lipid: sterol; stanol; carbohydrate; protein or its subunit or glycerine.

Preferably, used acyltransferase can be transferred to one or more following acyl acceptor substrates from lipid (as definition here) with acyl group in method of the present invention and/or purposes of the present invention: sterol, stanol, carbohydrate, protein or its subunit or glycerine.

" acyl acceptor " in aspect more of the present invention can be any compound that comprises hydroxyl, and for example the multivalence alcohols comprises glycerine, sterol, stanol, carbohydrate; Alcohol acid comprises tartaric acid, Citric Acid, tartrate, lactic acid and xitix; Protein or its subunit such as amino acid, protein hydrolystate and peptide class (protein of partial hydrolysis), and composition thereof and derivative.Preferred " acyl acceptor " is not water for the present invention.

In one embodiment, described acyl acceptor preferably is not monoglyceride and/or triglyceride.

On the one hand, described enzyme can preferably be transferred to sterol and/or stanol with acyl group from lipid.

On the one hand, described enzyme can preferably be transferred to carbohydrate with acyl group from lipid.

On the one hand, described enzyme can preferably be transferred to protein or its subunit with acyl group from lipid.Suitable protein subunit may be following one or more materials: amino acid, protein hydrolystate, peptide, dipeptides, oligopeptides, polypeptide.

Aptly, in protein or protein subunit, acyl acceptor can be one or more following component of protein or protein subunit: Serine, Threonine, tyrosine or halfcystine.

When protein subunit was amino acid, described amino acid was preferably any suitable amino acid.The amino acid that is fit to is preferably, for instance, and one or more in Serine, Threonine, tyrosine, the halfcystine.

On the one hand, described enzyme can preferably be transferred to glycerine with acyl group from lipid.

On the one hand, described enzyme can preferably be transferred to alcohol acid with acyl group from lipid.

On the one hand, described enzyme can preferably be transferred to multivalence alcohol with acyl group from lipid.

On the one hand, acyltransferase can also be transferred to sterol and/or stanol from lipid with acyl group, acyl group can also be transferred to following one or more materials from lipid: carbohydrate, protein, protein hydrolystate, glycerine.

Preferably; aspects more of the present invention; acyltransferase is following one or more lipids to its lipid substrates that works: phosphatide, and such as Yelkin TTS for example phosphatidylcholine, triacylglycerol, Val, triglyceride, or sugar ester such as digalactosyl diglyceride (DGDG).The lipid substrates of indication can be described as " lipid acry radical donor " herein, and the term Yelkin TTS of Ying Yonging comprises phosphatidylcholine, phosphatidylethanolamine here, phosphatidylinositols, phosphatidylserine and phosphatidyl glycerol.

In some respects, preferably, acyltransferase is a phosphatide to its lipid substrates that works, such as Yelkin TTS, and phosphatidylcholine for example.

In some respects, preferably, described lipid substrates is a glycolipid, for example DGDG.

Lipid substrates is the food lipid preferably, that is to say the lipid composition in the food.

In some respects, preferably, acyltransferase of the present invention can not or can not act on triglyceride level and/or 1-monoglyceride and/or 2-monoglyceride substantially.

Lipid substrates or lipid acry radical donor are preferably one or more lipids, and it is present in one or more following substrates: fat comprises lard (lard), Tallow Inedible Grade (tallow), butterfat (butter fat); Oil comprises from plam oil (palm oil), Oleum Helianthi (sunflower oil), soybean oil (soya bean oil), Thistle oil (safflower oil), Oleum Gossypii semen (cotton seed oil), peanut oil (ground nut oil), Semen Maydis oil (corn oil), sweet oil (olive oil), peanut oil (peanut oil), Oleum Cocois (coconut oil) and rapeseed oil (rape seed oil) and to extract or by they deutero-oil.Yelkin TTS from soybean, Semen Brassicae campestris or yolk also is the lipid substrates that suits.Lipid substrates also can be that oat lipid or other comprise the material based on plant of galactolipid.

On the one hand, the Yelkin TTS (as phosphatidylcholine) in the preferred yolk of lipid acry radical donor.

Aspect more of the present invention, lipid can be selected from the lipid that fatty acid chain length is a 8-22 carbon.

Aspects more of the present invention, lipid can be selected from the lipid that fatty acid chain length is a 16-22 carbon, the more preferably lipid of 16-20 carbon.

Aspects more of the present invention, lipid can be selected from the lipid of no more than 14 carbon of fatty acid chain length, is selected from the lipid of fatty acid chain length 4-14 carbon aptly, is suitably the lipid of 4-10 carbon, is suitably the lipid of 4-8 carbon.

Aptly; acyltransferase among the present invention can demonstrate the activity of one or more following lipase: glycolipid enzymic activity (E.C.3.1.1.26); triacylglycerol lipase activity (E.C.3.1.1.3), Phospholipase A2 activity (E.C.3.1.1.4), phospholipase A1 activity (E.C.3.1.1.32).Here the term of Ying Yonging " glycolipid enzymic activity " comprises " galactolipid enzymic activity ".

Aptly, the acyltransferase among the present invention has at least a or multiple following activity: glycolipid enzymic activity (E.C.3.1.1.26) and/or phospholipase A1 activity (E.C.3.1.1.32) and/or Phospholipase A2 activity (E.C.3.1.1.4).

For some aspects of the present invention, acyltransferase has glycolipid enzymic activity (E.C.3.1.1.26) at least.

Aptly, for some aspects, acyltransferase of the present invention can be transferred to following one or more receptor substrates from glycolipid and/or phosphatide with acyl group: sterol, stanol, carbohydrate, protein, glycerine.

Some aspects, preferred acyltransferase of the present invention can be transferred to sterol and/or stanol from glycolipid and/or phosphatide with acyl group, forms sterol ester and/or stanol ester at least.

Some aspects, preferred acyltransferase of the present invention can be transferred to carbohydrate from glycolipid and/or phosphatide with acyl group, forms carbohydrate ester at least.

Some aspects, preferred acyltransferase of the present invention can be transferred to protein from glycolipid or phosphatide with acyl group, forms soap albumin (or albumen lipid acid condenses (condensate)) at least.

Some aspects, preferred acyltransferase of the present invention can be transferred to glycerine from glycolipid and/or phosphatide with acyl group, forms triglyceride and/or monoglyceride at least.

Some aspects, preferred acyltransferase of the present invention does not show triacylglycerol lipase activity (E.C.3.1.1.3).

In some respects, described acyltransferase can be transferred to sterol and/or stanol from lipid with acyl group.Therefore, in one embodiment, " acyl acceptor " of the present invention not only can be sterol but also can be stanol, or the coupling thing of the two.

In one embodiment, Shi Yi sterol and/or stanol can comprise following one or more constitutional featuress:

I) 3-β hydroxyl or 3-α hydroxyl; And/or

Ii) the A:B of the A:B of cis position ring or trans position encircles or C ₅-C ₆Be undersaturated.

Suitable sterol acyl acceptor comprises cholesterol and plant sterol (phytosterol); α-Gu Zaichun (sitosterol) for example; β-Gu Zaichun; Stigmasterol (stigmasterol); ergosterol (ergosterol); Brassicasterin (campesterol); 5; 6-dihydro sterol; brassicasterol (brassicasterol); hitodesterol (spinasterol); β-spinasterol; γ-spinasterol; δ-spinasterol; fucosterol (fucosterol); dimosterol; aseosterol (ascosterol); serebisterol; Episterol (episterol); anasterol; phenylbutyramide (hyposterol); chondrillasterol; desmosterol (desmosterol); spongosterol (chalinosterol); poriferasterol (poriferasterol); clionasterol (clionasterol); steroline (sterol glycoside) and other natural or synthetic isomers and derivative.

In one aspect of the invention, aptly, more than one sterol and/or stanol can be used as acyl acceptor, and aptly, two or more sterol and/or stanol can be used as acyl acceptor.In other words, in one aspect of the invention, aptly, can produce more than one sterol esters and/or stanol fat.Aptly, when cholesterol was acyl acceptor, one or more other sterol and one or more stanol also can be used as acyl acceptor.Therefore, in one aspect, the invention provides the in-situ combination production method of cholesteryl ester and at least a sterol ester or stanol ester.In other words, aspect more of the present invention, acyltransferase can be transferred to cholesterol and at least a other sterol and/or at least a stanol from lipid with acyl group.

On the one hand, preferred sterol acyl acceptor is following one or more materials: α-Gu Zaichun, β-Gu Zaichun, Stigmasterol, ergosterol, Brassicasterin.

On the one hand, preferred described sterol acyl acceptor is a cholesterol.Under the situation of cholesterol as the acyl acceptor of acyltransferase, in the food amount of free cholesterol with handle with acyltransferase before food in free cholesterol compare and/or compare minimizing with the free cholesterol in the equivalent food of handling without acyltransferase.

The stanol acyl acceptor that is fit to comprises plant sterol, for example β-Gu Zaichun or ss-Sitosterol.

On the one hand, preferably, described sterol and/or stanol acyl acceptor are sterol and/or the stanol except that cholesterol.

In some respects, the food according to the inventive method preparation can be used for reducing serum cholesterol and/or low-density lipoprotein.Serum cholesterol is relevant with human some disease with low-density lipoprotein, such as atherosclerosis and/or heart trouble.Therefore, it is contemplated that, can be used for reducing the risk of these diseases of trouble according to the food of the inventive method preparation.

Therefore, in one aspect of the invention, provide the food among the present invention to be used for the treatment of and/or the atherosis and/or cardiopathic purposes of prevention of arterial.

Aspect another, the invention provides a kind of medicament that contains food of the present invention.

Aspect another, the invention provides a kind of method of the human and animal's for the treatment of and/or preventing patient disease, described method comprises the food among the present invention who gives patient's significant quantity.

Aptly, sterol and/or stanol " acyl acceptor " can naturally be present in the described food.Described sterol and/or stanol selectively add in the food.Under the situation of sterol and/or stanol being added in the described food, can before adding acyltransferase of the present invention, simultaneously, and/or in food, add sterol and/or stanol afterwards.Suitably, method of the present invention can be included in and add before the enzyme of the present invention or simultaneously exogenous sterol/stanol (is specially plant sterol/phytostanol) add in the food.

In some respects, before adding acyltransferase of the present invention or simultaneously, the sterol of one or more in the described food may be converted to one or more stanol.Any proper method that sterol is changed into stanol all can be used, and for example, can implement described conversion by the chemical hydrogenation effect.This conversion can be carried out before acyltransferase of the present invention adds or in the acyltransferase of the present invention interpolation.The suitable enzyme that sterol is changed into stanol has instruction in WO00/061771.

The present invention can suit to be applied to original position generation phytostanol ester in food.The phytostanol ester has the saturating lipoid film solvability of increase, bioavailability, and be good for one's health more (referring to for example WO92/99640).

In specific embodiments more of the present invention, stanol ester and/or sterol ester can be a kind of seasonings and/or texturizer.Present invention includes seasonings and/or organized processing agent (texturiser) that original position produces in these embodiments.

Aspect more of the present invention, acyltransferase of the present invention can utilize carbohydrate as acyl acceptor.The carbohydrate acyl acceptor can be in the following material one or more: monose, disaccharides, oligosaccharides or polysaccharide.Preferred carbohydrate is one or more in the following material: glucose, fructose, anhydrofructose, maltose, lactose, sucrose, semi-lactosi, wood sugar, wood oligose (xylooligosacharide), pectinose, Fructus Hordei Germinatus oligose (maltooligosaccharide), tagatose (tagatose), microthecin, ascopyrone P, ascopyrone T, cortalcerone.

Aptly, carbohydrate " acyl acceptor " can naturally be present in the food.Selectively, carbohydrate can be added in the food.When in food, adding carbohydrate, can be before the acyltransferase in adding the present invention, add carbohydrate simultaneously and/or afterwards.

The carbohydrate ester can be used as valuable emulsifying agent in food.Therefore, when acting as of enzyme transferred to acyl group on the sugar, present invention includes and in food, produce the second original position emulsifying agent.

In some embodiments, acyltransferase can utilize sterol and/or stanol and carbohydrate as acyl acceptor.

For the food that comprises eggs, the acyltransferase that utilization can be transferred to acyl group on carbohydrate and sterol and/or the stanol is useful especially.Particularly, the particularly existence of glucose of sugar often is considered to be no advantage in eggs and the egg food.Yolk can comprise as many as 1% glucose.Usually, eggs or can handle to remove part or all of glucose with glucose oxidase based on the food of eggs.Yet in the present invention, this unnecessary sugar can be easy to remove by the esterification generation sugar ester of sugar.

Aspect more of the present invention, acyltransferase of the present invention can utilize protein as acyl acceptor.Suitable protein can be one or more protein in milk-product and/or meat product for example in the food.Only as an example, suitable protein may be the protein in curdling piece or the whey, as lactoglobulin.Other suitable protein comprises lipid transfer protein in ovalbumin from eggs, gliadin (gliadin), glutenin (glutenin), puroindoline, the cereal and the myosin in the meat.

Therefore in the present invention, can realize the beneficial property that one or more are following: original position produces emulsifying agent and does not increase free fatty acid content; Free lipid acid accumulation descends in the food; Free cholesterol level in the food descends; Sterol ester and/or stanol ester increase; Serum cholesterol and/or low-density lipoprotein descend; The carbohydrate ester increases; Unnecessary uncombined carbon hydrate reduces.

Advantage of the present invention is, original position produces emulsifying agent and do not increase or do not increase substantially the content of free lipid acid in the food in food.The generation of free fatty acids is deleterious to food.Particularly, in free fatty acids and the food smell degenerate (off-odour) and/or taste degenerate (off-flavour) relevant, also have other harmful effect in addition, for example comprise in the cheese soapy flavor or the like being arranged.Preferably, method provided by the invention prepares emulsifying agent in position, reduces and/or eliminates wherein accumulating of free fatty acids.Be not limited to theory,, the lipid acid on the lipid transferred to acyl acceptor, for example on sterol and/or the stanol with acyltransferase according to of the present invention.Therefore, the free fatty acids aggregate level in the food can not increase or only be increased to inapparent level.This and the situation of utilizing lipase (E.C.3.1.1.x) original position to produce emulsifying agent form sharp contrast.Particularly, the use of lipase can make the lipid acid that dissociates in the food roll up, and this point is deleterious.The accumulation of free lipid acid accumulation of free fatty acids when using lipase (being specially phospholipase A) to replace acyltransferase among the present invention is compared among the present invention, reduces and/or elimination.

Utilize acyltransferase that acyl group is transferred to sterol and/or stanol, useful especially to the food that contains eggs.Particularly, find to utilize that the acyltransferase of definition here handles based on the food of eggs with conventional Phospholipid hydrolase LipopanF for example ^(Novozymes A/S, Denmark), Lecitase Ultra ^(Novozymes A/S Denmark) or from the egg based food that the Lipomod 22L of Biocatalysts handles compares, and obviously has better characteristic.

Preferably, acyltransferase of the present invention can characterize with following standard:

(i) this enzyme has the activity (may be defined as the transesterify activity) that shifts acyl group, the acyl moiety on the original ester bond of lipid acry radical donor is transferred to formed new ester on the acyl acceptor thus; With

(ii) this enzyme comprises aminoacid sequence motif GDSX, and wherein X is one or more following amino-acid residue L, A, V, I, F, Y, H, Q, T, N, M or S.

Preferably, the X in the GDSX motif is L, and like this, enzyme of the present invention preferably comprises amino acid motif GSDL.

The GDSX motif is to be made of four kinds of conserved amino acids.Preferably, the Serine in the described motif is the catalytic Serine of acyltransferase.Aptly, the Serine in the GDSX motif can with the Aeromonas hydrophila lipolytic enzyme in the corresponding position of Ser-16, as the instruction of Brumlik and Buckley (Journal of Bacteriology Apr.1996, Vol.1, No.7, p 2060-2064).

For determining whether a kind of protein contains GDSX motif of the present invention, and the hiding markov model collection of illustrative plates (model profile) (HMM collection of illustrative plates) in this sequence preference and the Pfam database compares.

Pfam is the database of protein domain family.The hiding Markov model collection of illustrative plates (HMM collection of illustrative plates) that Pfam is included as auxiliary (curated) multiple sequence comparison of each family and is used for identifying these structural domains of new sequence.Introduction to Pfam sees Bateman A etc. (2002) NucleicAcids Res, 30; 276-280.Hide the Markov model and be applied in many databases that are intended to protein is classified, summary is seen Bateman A and Haft DH (2002) Brief Bioinform3; 236-245.

http：//www.nchi.nlm.nih.gov/entrez/query.fcgi？cmd＝Retrieve?&?db＝PuhMed &?list?uids＝12230032?&?dopt＝Abstract

http：//www.ncbi.nlm.nih.gov/entrez/query.fcgi？cmd＝Retrieve?&?db＝PubMed &?list?uids＝11752314?&?dopt＝Abstract

How detailed explanation and these models of hiding the Markov model are used referring to Durbin R Eddy S and Krogh A (1998) Biological sequence analysis in the Pfam database; Probabilistic models of proteins and nucleic acids.Cambridge University Press, ISBN 0-521-62041-4 (Durbin R, Eddy S, with Krogh A (1998) biological sequence analysis, protein and Nucleotide probability model, Cambridge University publishes, ISBN 0-521-62041-4.The Hammer routine package can be from University of Washington, St Louis, and USA obtains.

Selectively, the GDSX motif can illustrate the R by Durbin, Eddy S and Krogh A (1998) Biological sequence analysis by using the identification of Hammer software package; Probabilistic models of proteins and nucleic acids.Cambridge University Press, ISBN 0-521-62041-4 (Durbin R, Eddy S, with Krogh A (1998) biological sequence analysis, protein and Nucleotide probability model, Cambridge University publishes, ISBN 0-521-62041-4) and reference wherein provide, and in this specification sheets about the data of HMMER2.

The PFAM database can pass through, and for example, the several servers that are positioned at following network address at present conduct interviews:

http：//www.sanger.ac.uk/Software/Pfam/index.shtml

http：//pfam.wustl.edu/

http：//pfam.jouy.inra.fr/

http：//pfam.cgb.ki.se/

Database provides gopher, can import protein sequence at this.The default parameters of application data base is analyzed the existence of Pfam structural domain in the protein sequence.The GDSX structural domain is the zone of having set up in database, and therefore this structural domain that exists in any search sequence can obtain identification.Database will return the comparison of Pfam00657 consensus sequence and search sequence.

Multiple ratio is right, comprises that aeromonas salmonicida or Aeromonas hydrophila can obtain by following method.

A) manual method

By said procedure, can obtain the comparison of target protein and Pfam00657 consensus sequence and the comparison of acquisition P10480 sequence and Pfam00657 consensus sequence; Or

B) pass through database

After identifying the Pfam00657 consensus sequence, the seed comparison (seed alignment) that database provides option to show search sequence and Pfam00657 consensus sequence, P10480 is the part of this seed comparison, and is expressed as GCAT_AERHY.Search sequence and P10480 will show at the same window.

The Aeromonas hydrophila reference sequence:

The residue of Aeromonas hydrophila GDSX lipase is numbered in NCBI file P10480; numbering in the described text is meant the numbering that is provided by this document; it is used for determining concrete amino-acid residue in the present invention; described concrete amino-acid residue is present in the acyltransferase of the present invention in preferred specific embodiments.

Implement Pfam comparison (Figure 33 and 34)

Following conservative residue can be identified, and is present in preferred embodiments in the applied enzyme of the compositions and methods of the invention.

1 district-GDSX district

hid?hid?hid?hid?Gly?Asp?Ser?hid

28?29 30 31 32 33 34 35

2 districts-GANDY district

hid?Gly?hid?Asn?Asp?hid

130?131?132?133?134?135

3 districts-HPT district

His

309

Wherein ' hid ' is meant and is selected from Met, Ile, Leu, Val, Ala, Gly, Cys, His, Lys, Trp, the hydrophobic residue of Tyr or Phe.

Preferably, the acyltransferase that is applied in composition/method of the present invention can be compared with the Pfam00657 consensus sequence.

Preferably, show the GDSL among the present invention or the existence of GDSX structural domain with the positive coupling of the hiding markov model collection of illustrative plates (HMM collection of illustrative plates) of pfam00657 structural domain family.

Preferably, when comparing with the Pfam00657 consensus sequence, the acyltransferase that is applied in composition/method of the present invention contains at least one, and is preferred more than one, preferred following column region more than two, GDSx district, GANDY district, HPT district.Aptly, acyltransferase contains GDSx district and GANDY district.Selectively, described enzyme contains GDSx district and HPT district.Preferably, described enzyme contains at least one GDSx district.

Preferably, when comparing, be applied to enzyme in composition/method of the present invention and reference Aeromonas hydrophila peptide sequence and be SEQ ID No.32 and contain at least one relatively the time with the Pfam00657 consensus sequence, preferred more than one, preferred more than two, preferred more than three, preferred more than four, preferred more than five, preferred more than six, preferred more than seven, preferred more than eight, preferred more than nine, more than preferred ten, preferred more than 11, preferred more than 12, preferred more than 13, preferred following amino-acid residue: 28hid more than 14,29hid, 30hid, 31hid, 32gly, 33Asp, 34Ser, 35hid, 130hid, 131Gly, 132hid, 133Asn, 134Asp, 135hid, 309His.

The pfam00657GDSX structural domain is to have the unique identification that this region protein and other enzyme are distinguished.

The Pfam00657 consensus sequence is expressed as the SEQ ID No.1 of Fig. 1.This is to derive out from the evaluation of the 6th edition database Pfam00657 family, and this paper also is called pfam00657.6.

Consensus sequence can upgrade by new edition Pfam database.

For example, Figure 33 and 34 shows the pfam comparison of 00657 family in the 11st edition database, and this paper also is called pfam00657.11.

Find all to have GDSx district, GANDY district and HPT district in the Pfam00657 family in the database of two versions (release).The pfam database of other version can be used to identify pfam00657 family.

Preferably, acyltransferase of the present invention can characterize with following standard:

(i) this enzyme has the activity (may be defined as transesterification activity) that shifts acyl group, the acyl moiety on the original ester bond of lipid acry radical donor is transferred to formed new ester on the acyl acceptor thus;

(ii) this enzyme comprises aminoacid sequence motif GDSX, and wherein X is one or more following amino-acid residue: L, A, V, I, F, Y, H, Q, T, N, M or S;

(iii) this enzyme comprises His-309 or comprises histidine residues corresponding to the His-309 position of Aeromonas hydrophila lipolytic enzyme, and described Aeromonas hydrophila lipolytic enzyme is (SEQ ID No.2 or SEQID No.32) as shown in Figure 2.Preferably, the amino-acid residue of GDSX motif is L.

In SEQ ID No.2 or SEQ ID No.32, preceding 18 amino-acid residues form signal sequence.The His-309 of full length sequence (protein that comprises signal sequence) is equal to the His-291 in this protein maturation part (sequence that does not promptly contain signal sequence).

Preferably; acyltransferase of the present invention comprises following catalysis triplet: Ser-34; Asp-134 and His-309 or comprise the position and correspond respectively to Ser-34 in the Aeromonas hydrophila lipolytic enzyme shown in Fig. 2 (SEQ ID No.2) or Figure 28 (SEQ ID No.32), the serine residue of Asp-134 and His-309, asparagicacid residue and histidine residues.As mentioned above, in sequence shown in SEQ ID No.2 or the SEQ ID No.32, preceding 18 amino-acid residues form signal sequence.The Ser-34 of full length sequence (protein that comprises signal sequence), Asp-134 and His-309 are equal to protein maturation partly Ser-16, Asp-116 and the His-291 of (sequence that does not promptly contain signal sequence).In the Pfam00657 consensus sequence shown in Fig. 1 (SEQ IDNo.1), the avtive spot residue is corresponding to Ser-7, Asp-157 and His-348.

Preferably, acyltransferase of the present invention can characterize with following standard:

(i) this enzyme has the activity (may be defined as transesterification activity) that shifts acyl group, thus the acyl moiety on the original ester bond of the first lipid acry radical donor is transferred to acyl acceptor and forms new ester; And

(ii) this enzyme comprises Gly-32 at least, Asp-33, Ser-34, Asp-134 and His-309 or comprise the position and correspond respectively to Gly-32 in the Aeromonas hydrophila lipolytic enzyme shown in Fig. 2 (SEQ ID No.2) or Figure 28 (SEQ ID No.32), Asp-33, Ser-34, the glycine of Asp-134 and His-309, aspartic acid, Serine, aspartic acid and Histidine.

Aptly, acyltransferase of the present invention can and preferably obtain from following organism from one or more genus: Aeromonas (Aeromonas); streptomyces (Streptomyces); Saccharomycodes (Saccharomyces); lactococcus (Lactococcus); Mycobacterium (Mycobacterium); streptococcus belongs to (Streptococcus); lactobacillus (Lactobacillus); desulfiting Pseudomonas (Desulfitobacterium); bacillus (Bacillus); campylobacter (Campylobacter); Vibrio (Vibrionaceae); rod Pseudomonas (Xylella); sulfolobus genus (Sulfolobus); Aspergillus (Aspergillus); Schizosaccharomyces (Schizosaccharomyces); Listerella (Listeria); Neisseria gonorrhoeae (Neisseria); Mesorhizobium; Lei Er Bordetella (Ralstonia); Flavobacterium (Xanthomonas) and mycocandida (Candida).

Aptly, acyltransferase of the present invention can and preferably obtain from following one or more organisms: Aeromonas hydrophila (Aeromonas hydrophila); aeromonas salmonicida (Aeromonas salmonicida); streptomyces coelicolor (Streptomyces coelicolor); streptomyces rimosus (Streptomyces rimosus); mycobacterium (Mycobacterium); micrococcus scarlatinae (Streptococcus pyogenes); Lactococcus lactis (Lactococcus lactis); thermophilus streptococcus (Streptococcus thermophilus); lactobacterium helveticus (Lactobacillus helveticus); dehalogenation desulfiting bacterium (Desulfitobacterium dehalogenans); genus bacillus (Bacillus sp); campylobacter jejuni (Campylobacter jejuni); vibrios (Vibrionaceae); xyllela fastidiosa (Xylellafastidiosa); solfatara sulfolobus (Sulfolobus solfataricus); yeast saccharomyces cerevisiae (Saccharomycescerevisiae); terreus (Aspergillus terreus); schizosaccharomyces pombe (Schizosaccharomycespombe); harmless Listera spp (Listeria innocua); bacterium monocytogenes (Listeria monocutogenes); Neisseria meningitidis (Neisseria meningitidis); Mesorhizobium loti; blue or green withered Lei Er Salmonella (Ralstonia solanacearum); xanthomonas campestris (Xanthomonas campestris); carpetweed Xanthomonas campestris (Xanthomonas axonopodis); Candida parapsilosis (Candida parapsilosis).

On the one hand, preferably, the acyltransferase among the present invention can and preferably obtain from one or more Aeromonas hydrophilas or aeromonas salmonicida.

Aptly, acyltransferase of the present invention comprises one or more following amino acid sequences.

(i) shown in the SEQ ID No.2 the aminoacid sequence (see figure 2)

The (ii) aminoacid sequence (see figure 3) shown in the SEQ ID No.3

The (iii) aminoacid sequence (see figure 4) shown in the SEQ ID No.4

The (iv) aminoacid sequence (see figure 5) shown in the SEQ ID No.5

(the v) aminoacid sequence (see figure 6) shown in the SEQ ID No.6

(the vi) aminoacid sequence shown in the SEQ ID No.12 (seeing Figure 14)

(the vii) aminoacid sequence shown in the SEQ ID No.20 (seeing Figure 16)

(the viii) aminoacid sequence shown in the SEQ ID No.22 (seeing Figure 18)

(ix) aminoacid sequence shown in the SEQ ID No.24 (seeing Figure 20)

(xi) aminoacid sequence shown in the SEQ ID No.26 (seeing Figure 22)

(xii) aminoacid sequence shown in the SEQ ID No.28 (seeing Figure 24)

(xiii) aminoacid sequence shown in the SEQ ID No.30 (seeing Figure 26)

(ixi) aminoacid sequence shown in the SEQ ID No.32 (seeing Figure 28)

(xiv) aminoacid sequence shown in the SEQ ID No.34 (seeing Figure 30)

Perhaps with SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQID No.6, SEQ ID No.12, SEQ ID No.20, SEQ ID No.22, SEQ ID No.24, SEQID No.26, SEQ ID No.28, SEQ ID No.30, SEQ ID No.32, or any one sequence shown in the SEQ ID No.34 has 75% or the aminoacid sequence of higher identity.

Aptly; acyltransferase of the present invention or comprise SEQ ID No.2 or SEQID No.3 or SEQ ID No.32 or SEQ ID No.34 shown in aminoacid sequence; perhaps comprising with the aminoacid sequence shown in SEQ ID No.2 or SEQ ID No.3 or SEQ ID No.32 or the SEQ ID No.34 has more than 75% or 75%; more than preferred 80% or 80%; more than preferred 85% or 85%; more than preferred 90% or 90%, preferred 95% or the aminoacid sequence of 95% above identity.

In order to reach purpose of the present invention, the degree of identity depends on the number of identical sequence element.According to the present invention, the identity degree can be measured aptly by computer program known in the art, the GAP that described program provides such as the GCG routine package (Program Manual for the Wisconsin Package, Version 8, and August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, US53711) (Needleman ﹠amp; Wunsch (1970), J.of Molecular Biology48,443-45), utilize following setting to carry out peptide sequence relatively: GAP generates point penalty 3.0 and GAP extends point penalty 0.1.

Aptly; acyltransferase of the present invention comprises one section aminoacid sequence; this sequence and SEQ ID No.2; SEQ ID No.3, SEQ ID No.4, SEQ ID No.5; SEQ ID No.6; SEQ ID No.12, SEQ ID No.20, SEQ ID No.22; SEQ ID No.24; SEQ IDNo.26, SEQ ID No.28, SEQ ID No.30; any one section sequence shown in SEQ ID No.32 or the SEQ ID No.34 has more than 80% or 80%; more than preferred 85% or 85%, more preferably more than 90% or 90%, the more preferably identity more than 95% or 95% also.

Aptly, acyltransferase of the present invention comprises one or more in the following amino acid sequences:

(a) aminoacid sequence shown in the 1-100 amino-acid residue of SEQ ID No.2 or SEQ ID No.32;

(b) aminoacid sequence shown in the 101-200 amino-acid residue of SEQ ID No.2 or SEQ ID No.32;

(c) aminoacid sequence shown in the 201-300 amino-acid residue of SEQ ID No.2 or SEQ ID No.32; Or

(d) the arbitrary amino acid sequence with above-mentioned (a)-(c) definition has more than 75% or 75%, more than preferred 85% or 85%, and more preferably more than 90% or 90%, the more preferably aminoacid sequence of 95% or 95% above identity also.

Aptly, acyltransferase of the present invention comprises one or more in the following amino acid sequences:

(a) aminoacid sequence shown in the amino-acid residue 28-39 of SEQ ID No.2 or SEQ ID No.32;

(b) aminoacid sequence shown in the amino-acid residue 77-88 of SEQ ID No.2 or SEQ ID No.32;

(c) aminoacid sequence shown in the amino-acid residue 126-136 of SEQ ID No.2 or SEQ ID No.32;

(d) aminoacid sequence shown in the amino-acid residue 163-175 of SEQ ID No.2 or SEQ ID No.32;

(e) aminoacid sequence shown in the amino-acid residue 304-311 of SEQ ID No.2 or SEQ ID No.32; Or

(f) the arbitrary amino acid sequence with above-mentioned (a)-(e) definition has more than 75% or 75%, more than preferred 85% or 85%, and more preferably more than 90% or 90%, the more preferably aminoacid sequence of 95% or 95% above identity also.

Aptly, acyltransferase of the present invention can comprise that one or more sequences in the following nucleotide sequences are expressed and the aminoacid sequence that produces.

(a) the nucleotide sequence (see figure 9) shown in SEQ ID No.7;

(b) the nucleotide sequence (see figure 10) shown in SEQ ID No.8;

(c) nucleotide sequence (seeing Figure 11) shown in SEQ ID No.9;

(d) nucleotide sequence (seeing Figure 12) shown in SEQ ID No.10;

(e) nucleotide sequence (seeing Figure 13) shown in SEQ ID No.11;

(f) nucleotide sequence (seeing Figure 15) shown in SEQ ID No.13;

(g) nucleotide sequence (seeing Figure 17) shown in SEQ ID No.21;

(h) nucleotide sequence (seeing Figure 19) shown in SEQ ID No.23;

(i) nucleotide sequence (seeing Figure 21) shown in SEQ ID No.25;

(j) nucleotide sequence (seeing Figure 23) shown in SEQ ID No.27;

(k) nucleotide sequence (seeing Figure 25) shown in SEQ ID No.29;

(l) nucleotide sequence (seeing Figure 27) shown in SEQ ID No.31;

(m) nucleotide sequence (seeing Figure 29) shown in SEQ ID No.33;

(n) nucleotide sequence (seeing Figure 31) shown in SEQ ID No.35;

(o) or

With SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQID No.11, SEQ ID No.13, SEQ ID No.21, SEQ ID No.23, SEQ ID No.25, SEQ ID No.27, SEQ ID No.29, SEQ ID No.31, the nucleotide sequence that any sequence shown in SEQ ID No.33 or the SEQ IDNo.35 has 75% or 75% above identity.

Aptly, nucleotide sequence can with SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No.13, SEQ ID No.21, SEQID No.23, SEQ ID No.25, SEQ ID No.27, SEQ ID No.29, SEQ ID No.31, any sequence shown in SEQ ID No.33 or the SEQ ID No.35 has more than 80% or 80%, more than preferred 85% or 85%, more preferably more than 90% or 90%, the more preferably identity more than 95% or 95% also.

On the one hand, acyltransferase of the present invention can be Yelkin TTS: cholesterol acyltransferase (LCAT) or its variant (for example variant of molecular evolution generation).

Suitable LCAT known in the art can obtain from following one or more organisms, for example: Mammals, rat, mouse, chicken, drosophila melanogaster (Drosophila melanogaster), plant comprise Arabidopis thaliana (Arabidopsis) and rice (Oryza sativa), nematode, fungi and yeast.

In a specific embodiments of acyltransferase of the present invention; described acyltransferase can and preferably obtain from the coli strain E.TOP 10 (E.coli strains TOP 10) that contains pPet12aAhydro and pPet12aASalmo; this bacterial strain is by Copenhagen, Denmark K; DK-1001; (the Danisco A/S of Langebrogade l of the Danisco of Langebrogade 1; DK-1001Copenhagen K; Denmark); be preserved in holy horse No. 23 state-run industry in Qia Er street in Britain Scotland Aberdeen and (the National Collection of Industrial of marine microorganism preservation company limited (NCIMB) according to budapest treaty on December 22nd, 2003 about the microbial preservation (the Buddapest Treaty on the International Recognitionof the Deposit of Microorganisms for the purpose of Patent Procedure) of the international endorsement that is used for patented procedure; Marine andFood Bacteria (NCIMB) 23St.Machar Street; Aberdeen Scotland; GB), preserving number is respectively NCIMB 41204 and NCIMB 41205.

Preferably, when implementing method of the present invention, under the situation that does not increase or do not increase substantially the free fatty acids in the food, produce product.

Term used herein " transferring enzyme " can exchange with term " acyltransferase ".

Aptly, following one or more reactions of acyltransferase catalysis of the present invention's definition: transesterification (interesterification), transesterification (transesterification), alcoholysis effect, hydrolytic action.

Term " transesterification " refers to the enzyme catalysis of acyl group between lipid donor and lipid acceptor and shifts, and lipid donor wherein is not the free acyl group.

This paper term " transesterification " refers to acyl group and goes up through enzyme catalysis from lipid donor (except free fatty acids) and transfer to acyl acceptor (except water).

The term " alcoholysis effect " that the present invention uses refer to by with the enzymatic lysis of the covalent linkage of the reaction acid derivative of alcohol roh, make a product combine and another product combines with pure OR group with the H of alcohol.

The term " alcohol " that the present invention uses refers to the alkylate that comprises hydroxyl.

The term " hydrolytic action " that the present invention uses refers to the enzyme catalysis transferance of acyl group from lipid to water molecules OH group.The acyl migration that is caused by hydrolytic action needs the separation of water molecules.

Term used herein " does not increase or does not increase substantially free fatty acids " and refer to acyltransferase of the present invention and preferably has 100% transferase active (be about to 100% acyl group transfer to acyl acceptor from acry radical donor, no hydrolysis activity); But this enzyme can be transferred to acyl acceptor with the acyl group that is present in the lipid acry radical donor less than 100%.In this case; preferred acyltransferase activity accounts at least 5% of total enzyme activity, and more preferably at least 10%, more preferably at least 20%; more preferably at least 30%; more preferably at least 40%, more preferably at least 50%, more preferably at least 60%; more preferably at least 70%; more preferably at least 80%, more preferably at least 90%, and more preferably at least 98%.% transferase active (being the per-cent that transferase active accounts for total enzyme activity) can be measured by following scheme:

Measure the percentile experimental design of transferase active:

After the enzymatic reaction, available CHCl ₃: CH ₃OH2: 1 extracts the food that has added acyltransferase of the present invention, separates the organic phase that comprises lipid matter, and can analyze by GLC and HPLC according to the detailed step of describing hereinafter.By the analysis of GLC and HPLC, determine free fatty acids and one or more sterol/stanol ester class; The carbohydrate ester; The protein ester; Triglyceride; Or the amount of direactive glyceride.Do not add the control food methods analyst of the same race of enzyme of the present invention.

Calculate:

Can calculate the increasing amount of free fatty acids and/or sterol/stanol ester class and/or carbohydrate ester and/or protein ester and/or triglyceride and/or direactive glyceride from the result of GLC and HPLC analysis.

Δ % lipid acid=% lipid acid (enzyme)-% lipid acid (contrast); Mv lipid acid=lipid acid molecular-weight average

A=Δ % sterol ester/Mv sterol ester (wherein Δ % sterol ester=% sterol/stanol ester (enzyme)-% sterol/stanol ester (contrast), the molecular-weight average of Mv sterol ester=sterol/stanol ester), this is applicable to that acyl acceptor is sterol and/or stanol ester;

B=Δ % carbohydrate ester/Mv carbohydrate ester (Δ % carbohydrate ester=% carbohydrate ester (enzyme)-% carbohydrate ester (contrast) wherein; Mv carbohydrate ester=carbohydrate ester molecular-weight average), this is applicable to that acyl acceptor is a carbohydrate.

C=Δ % protein ester/Mv protein ester (wherein Δ % protein ester=% protein ester (enzyme)-% protein ester (contrast), Mv protein ester=protein ester molecular-weight average), this is applicable to that acyl acceptor is an albumen; With

The absolute value of D=triglyceride and/or direactive glyceride/Mv triglyceride/direactive glyceride (wherein Δ % triglyceride and/or monoglyceride=% triglyceride and/or monoglyceride (enzyme)-% triglyceride and/or monoglyceride (contrast); Mv triglyceride/monoglyceride=the ester of glycerine two and/or the molecular-weight average of monoglyceride), this is applicable to that acyl acceptor is a glycerine.

Transferase active calculates with the percentage that accounts for total enzyme activity:

^*Refer to suitable time deletion.

If the free fatty acids in the food increases, preferably they do not increase substantially, promptly do not reach conspicuous level.Our meaning is that the increase of free fatty acids can the negative impact food quality.

Aspects more of the present invention; the meaning that the term that uses " does not increase free fatty acids " substantially is that the food handled with acyltransferase of the present invention or the free fatty acids amount in the composition are less than the free fatty acids amount that produces in when the enzyme that uses except that acyltransferase of the present invention food or the compound; the free fatty acid content that produces during for example with Phospholipid hydrolase that uses routine such as LipopanF  (Novozymes A/S, Denmark) compares.

This paper term " original position " meaning is that emulsifying agent and/or sterol/stanol ester class and/or carbohydrate ester and/or protein ester and/or monoglyceride or triglyceride produce in food or food fraction.This is opposite with following situation: emulsifying agent and/or sterol/stanol ester class and/or carbohydrate ester and/or protein ester and/or monoglyceride or triglyceride separate preparation with food, and add in the food in being equal to preparation process as (formed) product that forms.In other words; term " original position " meaning that the present invention uses is by acyltransferase of the present invention is added in the food; or be added in the food composition/material that constitutes described food, emulsifying agent and/or sterol/stanol ester class and/or carbohydrate ester and/or protein ester and/or monoglyceride or triglyceride can produce from food ingredient.Composition in the food can be suitably the substrate of enzyme.If necessary, the composition in the food can by add one or more identical with composition in the described food or with being present in composition in the described food different compositions is replenished.For avoiding producing query, in one embodiment, the inventive method can be a kind of in food original position produce the method for emulsifying agent and/or sterol ester and/or stanol ester and/or carbohydrate ester and/or protein ester and/or monoglyceride or triglyceride, rather than preparation is used for being added to subsequently the method for the emulsifying agent of food and/or sterol ester and/or stanol ester (for example being to separate and/or the form of purifying).

In another embodiment, the lipase acyltransferase can use in food processing, but does not remain in the food.For example, the lipase acyltransferase can be immobilized, can be re-used.

Preferably, acyltransferase of the present invention can be at the polarity environment, and preferred aqueous environments is transferred to sterol and/or stanol and/or carbohydrate and/or albumen and/or glycerine with acyl group from lipid in the preferred food containing water.Suitable aqueous environments can be that the damping fluid of water maybe can be the water that contains of food.The term of this paper " aqueous environments " preferably refers to such environment, and there is not organic solvent in it, does not preferably have polar organic solvent, more is preferably not have not edible organic solvent.Term " aqueous environments " specifically finger does not add exogenous organic solvent, does not preferably add the environment of polar organic solvent.Term organic solvent used herein does not comprise food oil, does not preferably comprise the food oil that contains a large amount of non-polar lipid.Edible organic solvent except the term organic solvent is answered in one embodiment is as ethanol, propylene glycol and/or glycerine.The aqueous environments that the present invention suits can comprise volume percent less than 80% organic solvent, volume percent is less than 70% organic solvent, volume percent is less than 50% organic solvent, volume percent is less than 30% organic solvent, preferably contain volume percent less than 15% organic solvent, more preferably contain volume percent less than 5% organic solvent.Suitable food should contain the organic solvent of 1-5%, as ethanol.But, when containing such organic solvent in the food, preferably in food endogenous generation it.In other words, when containing such organic solvent in the food, preferred organic is not exogenous organic solvent.

The term of Ying Yonging " food " is meant the material that is suitable for the mankind and/or animal edible herein.

Aptly, the term of herein using " food " can refer to the food that certain form is convenient to eat.Yet optional or further, the term of Ying Yonging " food " also can refer to the foodstuff materials that one or more are used to prepare food herein.Only as an example, term food comprises the bakery of being made by dough, also comprises the used dough of the above-mentioned bakery of preparation.

The preferred aspect of the present invention provides a kind of food that defined in front, this food is selected from one or more following food: eggs, egg based product (includes but are not limited to mayonnaise, salad cream, sauce (sauce), ice-creams, powdered egg, improvement yolk and the product for preparing thus), bakery (comprises bread, cake, sweet flour products, the stratiform millet cake, liquid batter (batter), muffin, doughnut, biscuit (biscuit), barm biscuit (cracker) and cookies), confectionery (confectionary) (comprise chocolate, candy (candy), caramel (caramel), halawa, chewing gum comprises sugar-free chewing gum and contains sugared sweet chewing gum, bubble gum, soft bubble gum, chewing gum and pudding), frozen product (comprises sorbet (sorbet), preferred freezing milk-product (dairy) (comprise ice-creams, ice milk)), milk-product (comprise cheese, butter, milk, the rare cream of coffee (coffee cream), beat blistered rare cream (whipped cream), egg milk custard (custard cream), milk beverage and sour milk), wood this (mousse), vegetables milk greasy filth (whipped vegetable cream) through beating, meat product (meat product (processed meat products) that comprises processing), edible oil ﹠ fat, inflation with vacuum through beating food, oil-in-water emulsion, water-in-oil emulsion, oleomargarine, shortening (shortening) and smear (spread) comprise low fat and utmost point low fat smear; Condiment (dressings), mayonnaise, sauce (dip), the oily sauce of suckling (cream based sauce), the oily soup of suckling (cream based soup), soft drink, seasoning breast and flavouring paste.

The suitable food of the present invention can be a kind of " purified diet (fine foods) ", comprises cake, strudel (pastry), confectionery, chocolate, the strange sugar of method (fudge) etc.

The one side of food of the present invention can be dough products or baked goods, bread for example, fried food product, snack, cake, pie, the chocolate little side's cake (brownie) of English walnut, cookies, noodles, snack is such as barm biscuit, graham cracker (graham cracker), rusk (pretzel), potato chips, spaghetti (pasta).

On the other hand, food of the present invention can be plant-derived food compositions, for example flour, premixture (pre-mix), oil, fat, theobroma oil, accent coffee white oil (coffee whitener), salad cream, oleomargarine, smear, peanut butter, shortening, ice cream, cooking oil.

On the other hand, food of the present invention can be a kind of milk-product, comprise butter, milk, cream, cheese-as natural, through imitated cheese processing and artificial, it can present various ways (comprise shred (shredded), block (blocked), laminar (sliced) or rub broken shape (grated) with the hands), cream cheese, ice cream, refrigerated dessert, sour milk, yogurt drink, butter fat, dehydration milk fat, other milk-product.Endonuclease capable of the present invention improves the stability of fat in the milk-product.

When the generation of the free fatty acids in the cheese and " soap " when taste is relevant, it is particularly advantageous utilizing the present invention to prepare cheese.Therefore, use the cheese that acyltransferase of the present invention helps preparing does not have " soap " taste.

On the other hand, food of the present invention can be a kind of food that contains the composition of animal-origin, for example finished meat product, cooking oil, shortening.

On the other hand, food of the present invention can be soft drink, fruit, fruit mix, vegetables or grape wine.The plant sterol that can contain in some cases, the interpolation that is up to 20g/l in the described soft drink.

On the other hand, food of the present invention can be a kind of animal-feed.This animal-feed can be rich in phytosterol and/or phytostanols, preferred β-Gu Zaichun/stanol.Aptly, this animal-feed can be a kind of poultry feed.When described food was poultry feed, the present invention just can be used for reducing the cholesterol level of feeding the egg that poultry produced of having raised feed of the present invention.

Preferably, described food is selected from one or more in the following food: eggs, egg based product-comprise mayonnaise, salad cream, sauce, ice cream, powdered egg, improvement yolk and goods thereof.

Preferably, food of the present invention is food containing water.This suitable food can moisture 10-98%, 14-98%, 18-98%, 20-98%, 40-98%, 50-98%, 70-98%, 75-98% aptly aptly aptly aptly aptly aptly aptly.

In some respects, the preferred food of the present invention is not a kind of pure vegetables oil, such as sweet oil, sunflower seed oil, peanut oil, rapeseed oil.For fear of producing query, food of the present invention can oil-containing in the present invention is aspect some, but preferably, food mainly is not made of oil or oily mixture.For some aspects of the present invention, preferably this food comprises and is lower than 95%, preferably is lower than 90%, preferably is lower than 85%, preferably is lower than 80% lipid.Therefore, for some aspects of the present invention, oil can be the moiety of food, but preferred described food product bodies is not an oil.

Claim of the present invention should comprise each based food of listing above.

When producing the carbohydrate ester according to the present invention, preferred described carbohydrate ester is oligosaccharides ester, monose ester or two sugar esters.

Aptly, when producing the carbohydrate ester according to the present invention, the carbohydrate ester can be following one or more: glucose ester, fructose ester, anhydrofructose ester, Fructus Hordei Germinatus sugar ester, lactose ester, gala sugar ester, wood sugar ester, wood oligose ester (xylooligosaccharide ester), Arabic sugar ester (arabinose ester), wheat oligosaccharides ester (maltooligosaccharide ester), tagatose ester (tagatoseester), sucrose ester, microthecin ester, ascopyrone P ester, ascopyrone T ester or cortalcerone ester.

The carbohydrate ester that preferably produces according to the present invention be following one or more: carbohydrate monoesters (carbohydrate mono-ester), sugar monoesters (sugar mono-ester), the oligosaccharides monoesters, the trisaccharide monoesters, the disaccharides monoesters, the monose monoesters, the glucose monoesters, the fructose monoesters, the anhydrofructose monoesters, the maltose monoesters, the lactose monoesters, the semi-lactosi monoesters, the wood sugar monoesters, the wood oligose monoesters, the pectinose monoesters, wheat oligosaccharides monoesters, the tagatose monoesters, sucrose monoester, the microthecin ester, ascopyrone P ester, ascopyrone T ester, or cortalcerone ester.

In a specific embodiments, microthecin ester, ascopyrone P ester, ascopyrone T ester and/or cortalcerone ester can be used as biocide and work.Alternatively or further, microthecin ester, ascopyrone P ester, ascopyrone T ester and/or cortalcerone ester can be used as antioxidant and/or emulsifying agent one or two work.

Preferably, carbohydrate ester of the present invention formation (if any) do not rely on UDP-glucose.

Preferably, food of the present invention does not comprise UDP-glucose or only comprises the not UDP-glucose of significant quantity.

Aptly, emulsifying agent of the present invention can for example be following one or more: triglyceride, monoglyceride such as 1-monoglyceride or lysolecithin such as lyso-phosphatidylcholine (lysophosphatidylcholine), as digalactosyl monoglyceride (DGMG).Described emulsifying agent preferably produces from described lipid acry radical donor after removing (remove) one or more acyl group from the lipid acry radical donor.The term lysolecithin that this paper uses comprises lyso-phosphatidylcholine, lysophosphatidyl ethanolamine (lysophosphatidylethanolamine), hemolytic phosphatidyl inositol (lysophosphatidylinositol), hemolytic phosphatidylserine (lysophosphatidylserine) and lysophosphatidyl glycerol (lysophosphatidylglycerol).

When a kind of of emulsifying agent is the carbohydrate ester, that second kind of emulsifying agent can be one or more in the following emulsifying agent of giving an example: triglyceride, monoglyceride such as 1-monoglyceride, lyso-phosphatidylcholine or digalactosyl monoglyceride (DGMG).Second emulsifying agent preferably produces from described lipid acry radical donor after removing one or more acyl group from the lipid acry radical donor.Term lyso-phosphatidylcholine and term lysolecithin synonym that this paper uses, and the two can substitute mutually in asking in basis.

Preferred second emulsifying agent is DGMG.Aptly, DGMG is generated in-situ by removing acyl group from DGDG, and the acyl group of this removal is transferred to formation carbohydrate ester on the carbohydrate.

When a kind of of emulsifying agent is protein ester and/or triglyceride and/or monoglyceride, that second kind of emulsifying agent can be one or more in for example following emulsifying agent: triglyceride, monoglyceride such as 1-monoglyceride, lyso-phosphatidylcholine or digalactosyl monoglyceride (DGMG).Second emulsifying agent preferably produces from described lipid acry radical donor after removing one or more acyl group from the lipid acry radical donor.Term lyso-phosphatidylcholine and lysolecithin synonym that this paper uses, and the two can substitute mutually in this application.

In a specific embodiments; acyltransferase of the present invention can be applied among the preparation method of food such as cooking oil, oleomargarine or smear; described natural food comprises or has added glycerine, at least a phosphatide (for example Yelkin TTS) and/or glycolipid (for example digalactosyl diglyceride), and optional plant sterol or phytostanol.

When as cooking oil or oleomargarine, this food can have the anti-stick pot of enhanced (antiplattering) character.Further or selectable, this food can have one or more useful technological properties, enhanced oxidation stability (oxidative stability) for example, the emulsifying property of improvement, or health advantages.

In a specific embodiments, acyltransferase of the present invention can be used to prepare low fat food, for example low fat smear, low fat salad cream, low fat mayonnaise, low fat oleomargarine etc.Compare with the Equivalent that fat is higher, reduced lipid content in these low fat foods usually by adding emulsifying agent and extra water.

Found that the acyltransferase of using in the present composition and the method compares with lipolytic enzyme and have unique character, on they obviously preferentially transfer to acceptor beyond the water with acyl group from lipid, even under the condition that has big water gaging to exist, also be like this.Compare discovery with enzyme of the prior art, the acyltransferase of using among the present invention exist 6%, 54%, 73%, 89% with the condition of about 95% water under have high relative transferase active (relative transferase activity).Tested lipolytic enzyme does not in fact have significantly transferase active relatively under these water concentration conditions.

The lipase activity of enzyme and acyltransferase activity can use following measuring method to assess.Can obtain/identify to have the acyltransferase of the enzyme characteristic of this paper definition by this method.

Transferring enzyme assay method in the buffered substrate (referring to embodiment 12)

Playing acyltransferase does can identify out with the assay method routine of instruction among the embodiment 12 in order to the enzyme that is used for the present composition and method.This measuring method will be called " the transferring enzyme assay method in the buffered substrate " hereinafter.The acyltransferase that in embodiment 12 the present invention is come from aeromonas salmonicida is analyzed and the lipolytic enzyme of the certain limit that do not relate to the present invention compares.Has only LIPOPAN in the lipolytic enzyme as can be seen ^F (Novozymes, Denmark) has transferase active, therefore only has lower level (1.3%).

The enzyme that is suitable for using in the compositions and methods of the invention can utilize in the transferring enzyme assay method in the buffered substrate and come routine to determine.Use this measuring method (wherein water content is very high by-about 95%); the acyltransferase that the present invention uses is to have 2% acyltransferase activity (transferase active relatively) at least; preferred at least 5% relative transferase active; preferred at least 10% relative transferase active, the enzyme of preferred at least 15%, 20%, 25%, 26%, 28%, 30%, 40%, 50%, 60% or 75% relative transferase active.The acyltransferase that the present invention suits can have less than 28%, less than 30%, preferably less than 40%, 50%, 60%, 70%, 80%, 90% or 100% acyltransferase activity.

Transferring enzyme assay method in the high-moisture yolk (referring to embodiment 11)

As the replacement (or additional) of " the transferring enzyme assay method in buffered substrate " (referring to top described), the used acyltransferase of the present invention can be identified with " the transferring enzyme assay method in the high-moisture yolk " of embodiment 11 instructions.

In a specific embodiment; the acyltransferase that the inventive method and/or composition are suitable for is so a kind of enzyme; when the transferring enzyme assay method in using high-moisture yolk detected in the yolk of water content 54%, described enzyme had the highest 100% relative transferase active.In fact, the experiment of carrying out in high-moisture yolk shows that in the beginning of experiment, initial transferring enzyme speed is 100% transferase active as calculated, does not promptly observe hydrolytic activity.Opposite, lipolytic enzyme in contrast is LIPOPAN ^F and Phospholipase A2 are at moisture 54% yolk or be rich in the yolk (be moisture 73% or 89% yolk) of moisture and do not demonstrate detectable transferase active.Preferably, the increase of water content does not significantly reduce the per-cent acyltransferase activity of used acyltransferase in the inventive method or the composition.

In a preferred specific embodiments; when the transferring enzyme assay method in the use high-moisture yolk detects in the yolk of water content 54%; after donor molecule (being phosphatide) consumes 10%; the initial percentage transferase active (prima facies is to transferase active) that the used acyltransferase of the present invention has is at least 0.1% relative transferase active; preferred at least 1% relative transferase active; preferred at least 5% relative transferase active; preferred at least 10% relative transferase active; preferred at least 20% relative transferase active; preferred at least 30% relative transferase active; preferred at least 40% relative transferase active; preferred at least 50% relative transferase active; preferably at least 60%, preferably at least 70%, preferably at least 80%; preferably at least 90%; preferably at least 95%, preferably at least 99%, preferably approximately 100% acyltransferase activity.

In a preferred embodiment; when the transferring enzyme assay method in the use high-moisture yolk detects in the yolk of water content 54%; after donor molecule (being phosphatide) consumes 10%; used acyltransferase has the transferase active that can survey in the present composition and the method; i.e. relative transferase active between 0.1 to 100%; preferred at least 1% relative transferase active; preferred at least 5% relative transferase active; preferred at least 10% relative transferase active; preferred at least 20% relative transferase active; preferred at least 30% relative transferase active; preferred at least 40% relative transferase active, preferably at least 45%; 50%; 60%; 70%; 80% or 90% relative transferase active.Aptly; when the transferring enzyme assay method in using high-moisture yolk detects in the yolk of water content 54%; after donor molecule (being phosphatide) consumed 10%, acyltransferase of the present invention can have and is less than 45%, 47%, 50%, 60%, 70%, 80%, 90% or 100% per-cent acyltransferase activity (transferase active relatively).

In a preferred embodiment; when the transferring enzyme assay method in the use high-moisture yolk detects in the yolk of water content 73%; after donor molecule (being phosphatide) consumes 10%; used acyltransferase has the transferase active that can survey in the present composition and the method; i.e. relative transferase active between 0.1 to 100%; preferred at least 1% relative transferase active; preferred at least 5% relative transferase active; preferred at least 10% relative transferase active; preferred at least 20% relative transferase active; preferred at least 30% relative transferase active; preferred at least 40% relative transferase active, preferably at least 45%; 50%; 58%; 60%; 70%; 80% or 90% relative transferase active.Aptly; when the transferring enzyme assay method in using high-moisture yolk detects in the yolk of water content 73%; after donor molecule (being phosphatide) consumed 10%, acyltransferase of the present invention can have and is less than 45%, 47%, 50%, 58%, 60%, 70%, 80%, 90% or 100% per-cent acyltransferase activity (transferase active relatively).

In preferred specific embodiments; when the transferring enzyme assay method in the use high-moisture yolk detects in the yolk of water content 89%; after donor molecule (being phosphatide) consumes 10%; used acyltransferase has the transferase active that can survey in the present composition and the method; i.e. relative transferase active between 0.1 and 100%; preferred at least 1% relative transferase active; preferred at least 5% relative transferase active; preferred at least 10% relative transferase active; preferred at least 20% relative transferase active; preferred at least 30% relative transferase active; preferred at least 40% relative transferase active, preferably at least 45%; 50%; 60%; 70%; 80% or 90% relative transferase active.Aptly; when the transferring enzyme assay method in using high-moisture yolk detects in the yolk of water content 73%; after donor molecule (being phosphatide) consumed 10%, acyltransferase of the present invention can have and is less than 45%, 47%, 50%, 60%, 70%, 80%, 90% or 100% per-cent acyltransferase activity (transferase active relatively).

In preferred specific embodiments; according to the transferring enzyme assay method in the high-moisture yolk; the acyltransferase of using in the present composition neutralization method has significant transferase active relatively (promptly two kinds of water-contents all at least 0.1%); have suitable relative transferase active in the yolk of water content 54% and water content 73%, mensuration is to carry out after donor molecule (being phosphatide) consumes 10%.

In preferred specific embodiments; according to the transferring enzyme assay method in the high-moisture yolk; the acyltransferase of using in the present composition neutralization method has significant transferase active relatively (promptly two kinds of water-contents all at least 0.1%); have suitable relative transferase active in the yolk of water content 54% and water content 89%, mensuration is to carry out after donor molecule (being phosphatide) consumes 10%.

In preferred specific embodiments; according to the transferring enzyme assay method in the high-moisture yolk; the acyltransferase of using in the present composition neutralization method has significant transferase active relatively (promptly two kinds of water-contents all at least 0.1%); have suitable relative transferase active in the yolk of water content 73% and water content 89%, mensuration is to carry out after donor molecule (being phosphatide) consumes 10%.

The relative transferase active (% acyltransferase activity) that term " suitable relative transferase active " the expression enzyme that this paper uses has is in the higher yolk of water-content than in the lower yolk of water-content; at least low by 2%, preferably hang down 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% at least.

Transferring enzyme assay method in the low moisture environment

As " the transferring enzyme assay method in the high-moisture yolk " and/or " the transferring enzyme assay method in the buffered substrate " substitute or additional, the acyltransferase that uses among the present invention can be identified by " the transferring enzyme assay method in the low moisture environment ".

In order to judge whether a kind of enzyme is to belong to according to acyltransferase of the present invention, can carry out " the transferring enzyme assay method in the low moisture environment ", promptly be taught in moisture 6% the oiliness environment as embodiment 22.This example explanation acyltransferase of the present invention in the oiliness environment of water-content 6% has high relative transferase active, and the lipolytic enzyme of prior art has hydrolytic activity.

In one embodiment, the suitable acyltransferase of using in the present composition and/or the method is the enzyme with " the transferring enzyme assay method in the low moisture environment " test, when measuring after 30,20 or 120 minutes; its relative transferase active at least 1%, preferably at least 2%, preferably at least 5%; preferably at least 10%; preferably at least 20%, preferably at least 30%, preferably at least 40%; preferably at least 50%; preferably at least 60%, preferably at least 70%, preferably at least 75%.Aptly, when measuring after 10,20,30 or 120 minutes, acyltransferase of the present invention can have to be less than 30%, 40%, 50%, 60%, 70% or 80% activity with " the transferring enzyme assay method in the low moisture environment ".

As mentioned above, the lipase acyltransferase among the present invention can be that acyl acceptor is identified with the cholesterol with " the transferring enzyme assay method in the buffered substrate " or " the transferring enzyme assay method in the low moisture environment ".Certainly; those skilled in the art can recognize easily; by analytical method is significantly revised, " the transferring enzyme assay method in the buffered substrate " or " the transferring enzyme assay method in the low moisture environment " can be used for determining the activity of acyltransferase to any lipid acry radical donor or the combination of any acyl acceptor.If necessary; the technician can be simply with optional acry radical donor substrate (as glycolipid; triglyceride level) replace acry radical donor substrate (as phosphatide) and/or with optional acyl acceptor substrate (as carbohydrate; protein; other sterol, stanol or glycerine) replacement acyl acceptor substrate (as cholesterol).

Term used herein " high-moisture " means any substrate or food, and its water-content is preferably greater than 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% greater than 2%.

Term used herein " low moisture " means any substrate or food, and its water-content is less than 6%, preferably less than 5%, 4%, 3%, 2%, 1% or 0.5%.

Preferably, can in food, implement method of the present invention and/or purposes in following temperature, for example, 15-60 ℃, preferred 20-60 ℃, preferred 20-50 ℃, preferred 20-45 ℃, preferred 20-40 ℃.In some respects, for example in dough, the temperature of food was between 20 to 40 ℃ when the acyltransferase reaction preferably took place.For others, for example for milk-product such as cheese, the optimal temperature of food can be between 30 to 60 ℃.In others, for example for mayonnaise, the optimal temperature of food can be between 20 to 40 ℃.More preferably should be between 25 to 30 ℃.

Preferably, the emulsifying agent that produces according to the present invention accounts for the 5wt% of food weight or below the 5wt%.

Preferably, the emulsifying agent that produces according to the present invention accounts for 0.01 to 4wt% of food weight.

Preferably, the emulsifying agent that produces according to the present invention accounts for 0.01 to 2wt% of food weight.

Preferably, the emulsifying agent that produces according to the present invention accounts for 0.01 to 1wt% of food weight.

Preferably, the emulsifying agent that produces according to the present invention accounts for 0.01 to 0.5wt% of food weight.

Preferably, the emulsifying agent that produces according to the present invention accounts for 0.01 to 0.3wt% of food weight.

The method that suits according to the present invention comprises makes enzyme deactivation or sex change, makes the enzyme that comprises inactivation or denatured form in the food.Aptly, described enzyme can be able to sex change with baking or with pasteurization.

The present invention can further comprise the purposes of acyltransferase in food and/or feed enzyme composition that this paper defines, and can comprise the food and/or the feed enzyme composition of the acyltransferase that wherein contains this paper definition.Such composition can comprise one or more other enzymes, and for example the present invention is cited.Perhaps, enzyme composition of the present invention can with other food ingredient/foodstuff additive described herein (comprising other enzyme composition) coupling.By acyltransferase of the present invention is formulated in food and/or the feed composition, described enzyme can be used for being able to stabilization before food and/or the fodder production, so that prolonged preservation (under optimum conditions).In addition, enzyme composition of the present invention provides the enzyme of suitable form, its can be safely at food and/or feed or be used for food and/or the preparation process of the component of feed goods " original position " is used.These compositions can be with fluid, and semi-fluid or solid/particle form exists.

In one embodiment, Shi Yi enzyme food composition can be dough conditioning composition (dough improving composition).Dough conditioning composition can comprise other enzyme that other beneficiating ingredient such as emulsifying agent and/or the present invention are enumerated.

Enzyme food is sold to stablize liquid enriching agent or solid particulate form.The food prepared therefrom enzyme composition loss of enzyme activity amount in transportation, storage, use that makes drops to minimum.Enzyme usually is in wet, heat or the well-oxygenated environment in the food and drink production process.Preparation is by resisting main deactivation power: sex change, catalytic site inactivation and proteolysis, come enhanced stability.When a kind of tertiary protein structure physical property unfolding under heat or chemical stress effect of enzyme, sex change has just taken place in enzyme.The enzyme just very easily concurrent raw egg white matter of inactivation hydrolysis of unfolding Once you begin.In order to minimize unfolding, the makers-up can change proteic environment and induce protein structure closely; Effective means is " preferentially to remove " water as sugar, polyhydroxy-alcohol and processable salt from protein surface by the compound that adds associated water.The best approach that prevents the avtive spot inactivation is to guarantee the level abundance of any essential cofactor, adds reversible inhibitor, and removes oxidisability or have the reactive behavior kind from preparation.

Except enzyme stability; preparation also requires to satisfy the less important demand of several keys; comprise the preservation that prevents microbial contamination; avoid physical property precipitation or haze (haze) to form; make sensitization dust or aerocolloidal formation drop to minimum and reach best aesthetic standard such as color and luster and smell.These problems are many to be solved well by paying close attention to " upstream " as far as possible, is included in fermentation or enzyme removal process selection of raw material.Downstream process such as diafiltration, absorption, chromatography, crystallization and extraction can be used for removing the impurity relevant with color and luster, smell and precipitation.The risk of physical sedimentation can by utilize hydrophilic solvent such as glycerine or propylene glycol to prepare near the enzyme iso-electric point to drop to minimum.The technician also can effectively add the moderate hydrotropy salt of level, avoids saltouing or avoids " oppositely salt hydrotropy (reversesalting-in) ".For preventing microbial contamination, can unite and use filtration, acidifying, and make the free-water minimization; Biocide can be effective, but be used to control or the scope of the chemical substance accepted of killing microorganisms more and more is subjected to the restriction of health and safety standard.

Up to now, two kinds produce the strongest particulate method of wear resistance is high-shear granulation method and fluidized bed spray coating method, for example see T.Becker: " Separation and Purification Processes forRecovery of Industrial Enzymes " (" separation and purification process that industrial enzyme reclaims ") in R.K.Singh, S.S.H.Rizvi (eds.): Bioseparation Processes in Foods (the bioseparation process of food), Marcel Dekker, New York, pp.427-445.These methods are used various tackiness agents, and Drug coating, particle form are learned and produced non-friable particle, and this particle also plays a protective role to enzyme in storage, but allows them in use easily to be discharged in the solution.

Can prepare the food enzyme composition that comprises acyltransferase of the present invention with standardized compounding process such as spraying drying or liquid dosage.

Acyltransferase of the present invention can be expressed at any suitable expressive host.Acyltransferase for example of the present invention can be expressed subtilis (Baacillus subtilis); and can pass through ultrafiltration process and/or ethanol precipitation and/or centrifuging purifying, then can use starch (maltodextrin) to carry out spraying drying as the carrier of enzyme.Enzyme after spray-dried is standardized as the PLU activity of regulation by adding other powder type carrier.Relevant technologies is very clear and definite and conventional in the art.

Perhaps, the acyltransferase that the present invention uses, for example, the acyltransferase of the exogenous generation of the present invention, in case purified, can be stable in the suitable formulations liquid, as based on those of glycerine.Other method for preparing stabilized enzyme preparations is described in EP 0 770 037 and EP 0 702 712 to some extent.

Other enzyme coupling that pulverous acyltransferase also can be listed with this paper prepares and has the active enzyme composition that product description limits.

Usually the dosage of food zymin is that per 1000 kilograms of food 10 restrain 1000 grams, and preferred per 1000 kilograms of food 50 restrain 200 grams, and preferred per 1000 kilograms of food 75 restrain 125 grams.

The preferred enzyme of the present invention is present in the food with the form of inactivation or sex change.

In one embodiment, the preferred on-fixedization of enzyme of the present invention, be specially and be not fixed on the solid carrier.

In a selectable specific embodiments, described enzyme can be immobilized.

Immobilized acyltransferase can use immobilization technology preparation well known in the art.There is the method for a large amount of immobilized enzymes of well-known to those skilled in the art preparation this area, and (technology described in for example following document: EP 0 746 608; Or Balcao VM, Paiva AL, Malcata FX., Enzyme MicrobTechnol.1996 May 1; 18 (6): 392-416; Or ReetzMT, Jaeger KE.Chem Phys Lipids.1998 Jun; 93 (1-2): 3-14; Or BornscheuerUT, Bessler C, Srinivas R, Krishna SH.TrendsBiotechnol.2002 Oct; 20 (10): 433-7 (every piece is included in herein as reference).

In one embodiment, food of the present invention can comprise the food ingredient of using the preparation of immobilized liposome acyltransferase, but does not comprise the acyltransferase in food ingredient or the food.For example described food can comprise one or more following materials: emulsifying agent, more than one emulsifying agent, one or more seasoningss, one or more structure-reinforced dose and/or one or more sterol esters, and as plant sterol ester or phytostanol ester.

Enzyme of the present invention can use jointly with one or more conventional emulsifiers, and described emulsifying agent comprises for example monoglyceride, the tartaric glycerine monofatty ester of two acetoxy groups and two glyceryl ester, and Yelkin TTS, and for example it derives from soybean.

Enzyme of the present invention can use jointly with one or more other suitable food grade enzyme.Like this, in the scope that the present invention relates to, except that enzyme of the present invention, also have a kind of other enzyme to add in the food at least.These other enzymes comprise starch degrading enzyme such as endo-amylase (endoamylase) or exoamylases (exoamylase), Starch debranching enzyme (pullulanase), debranching factor (debranching enzyme), hemicellulase (hemicellulase)-comprise zytase (xylanase), cellulase (cellulose), lipase, Phospholipid hydrolase and proteolytic enzyme.

Enzyme of the present invention can use jointly with one or more other suitable food grade enzyme.Like this, in the scope that the present invention relates to, except that enzyme of the present invention, also have a kind of other enzyme to add in the food at least.These other enzymes comprise starch degrading enzyme such as endo-amylase or exoamylases, Starch debranching enzyme, debranching factor, hemicellulase-comprise zytase, cellulase, oxydo-reductase-as glucose oxidase, pyranose oxidase, Thiol oxidase (sulfyhydryl oxidase) or carbohydrate oxidase-as the oxydase of oxidation maltose for example hexose oxidase (HOX), lipase, Phospholipid hydrolase and hexose oxidase and proteolytic enzyme.

In a preferred specific embodiments, acyltransferase is united use with the lipase with following one or more lipase activities: glycolipid enzymic activity (E.C.3.1.1.26), triacylglycerol lipase activity (E.C.3.1.1.3), Phospholipase A2 activity (E.C.3.1.1.4) or phospholipase A1 activity (E.C.3.1.1.32).Aptly, lipase is being known in the art, and comprises following lipase with the way of example explanation: LIPOPAN ^F and/or LECITASE ^ULTRA (Novozymes A/S, Denmark), (for example phospholipase A 2 is from the LIPOMOD of Biocatalysts for Phospholipase A2 ^TM22L is from the LIPOMAX of Genecor ^TM), LIPOLASEO ^(Novozymes A/S, Denmark), the lipase of instruction in WO03/97835, EP0 977869 or EP 1 193 314.The coupling of acyltransferase of the present invention and lipase is particularly preferred in the production of cake and confectionery for example at dough products or bakery or at meticulous food.

The use of uniting of lipase and enzyme of the present invention especially has superiority under some situations about accumulating of free fatty acids may needing, for example can produce in the cheese of required fragrance at free fatty acids, or in the preparation of meticulous food.Those skilled in the art can the proportional lipolytic enzyme of coupling, for example LIPOPAN ^F and/or LECITASE ^ULTRA (Novozymes A/S, Denmark), (for example phospholipase A 2 is from the LIPOMOD of Biocatalysts for Phospholipase A2 ^TM22L is from the LIPOMAX of Genecor ^TM), LIPOLASE ^(Novozymes A/S, Denmark), at WO03/97835, EP0 977869 or EP 1 193, the lipase of instruction in 314, so that ideal hydrolysis and transferase active ratio to be provided, this can bring the combination (for example those listed content in " technique effect ") in this article of preferred technique effect in the food or technique effect.

Traditional cake industry uses the cake modifying agent having high-quality cake aspect taste, structure, cating quality and the outward appearance to improve cake output and to guarantee.These cake modifying agents generally are based on as spray-dried emulsifying agent on the carrier of starch and maltodextrin etc.Some cake modifying agents also are the gel form based on emulsifying agent, sugar and water.It is most important that these cake modifying agents are produced the high quality cake for cake making enterprise.But the cake modifying agent contains emulsifying agent and other has " non-natural " composition of E numbering.Because the human consumer requires to reduce the quantity of E numbering, cake making enterprise does not use emulsifying agent and takes other alternate method to produce the high quality cake with regard to needs.

A kind of alternative method is to use a kind of enzyme when producing cake, i.e. the acyltransferase or the enzyme composition of the present invention of this paper qualification.

Acyltransferase that this paper limits and/or enzyme food composition of the present invention can use when producing meticulous food such as cake.In such example, following ingredients can form in meticulous food.

I) sugar ester and lysolecithin (come from the carbohydrate in the cake prescription and form Yelkin TTS in the egg of cake prescription integral part); And/or

Ii) the peptide of acidylate and lysolecithin are (in albumen lipid acid polycondensate forming process; lipid acid is transferred to albumen or peptide from Yelkin TTS; this albumen lipid acid polycondensate is considered to highly effective emulsifying agent (Herstellung und Anvendungmoglichkeiten vonEiweiss-Fettsaurekondensaten.Andreas Sander; Eberhard Eilers; AndreaHeilemann; Edith von Kreis.Fett/lipid 99 (1997) Nr.4,115-120)).

It is generally acknowledged when some meticulous food of preparation, specifically is higher fatty acid meticulous food, as cake, needs some lipid acid to accumulate.Therefore, combined utilization lipolytic enzyme and acyltransferase as herein described are especially useful for producing higher fatty acid meticulous food.Perhaps, can select other free fatty acids or fatty acid saponification thing (E470a), and with described acyltransferase combined utilization.

Food of the present invention comprises one or more following additives aptly:

Soybean protein material; Carotenoid; flavonol (flavenoid); antioxidant and plant chemical ingredient (specifically are anthocyanonide; carotenoid; bioflavonoids (bioflavinoid); gsh; catechin; isoflavones; Lyeopene (lycopene); ginsenoside (ginsenoside); Bai Songsu (pycnogenol); alkaloid (alkaloid); pygeumafricaum (pygeum) plant sterol; sulforaphen (sulphoraphone); resvertrol (resveretol); Semen Vitis viniferae extract or contain the food of stanol ester class); VITAMIN (specifically is a vitamins C; vitamin A; vitamin B3; vitamins D; vitamin-E; thiamines (thiamine); riboflavin; nicotinic acid; pyridoxol (pyridoxine); cyanocobalamin (cyanocobalamin); folic acid; vitamin H; pantothenic acid or vitamin K); mineral substance (specifically is a calcium; iodine; magnesium; zinc; iron; selenium; manganese; chromium; copper; cobalt; molybdenum or phosphorus); lipid acid (specifically is gamma-linoleic acid (linoleic acid); ucospentaenoic acid or docosahexenoic acid); oil (borage oil (borage oil) particularly; high carotenoid canola oil (high carotenoid canola oil) or Semen Lini oil (flax seed oil)); amino acid (specifically is tryptophane; Methionin; methionine(Met); phenylalanine; Threonine; Xie Ansuan; leucine; Isoleucine; L-Ala; arginine; Aspartic Acid; Gelucystine; halfcystine; L-glutamic acid; glutamine; glycine; Histidine; proline(Pro); oxyproline; Serine; taurine or tyrosine); enzyme ((specifically is bromeline (bromelain); papoid; amylase; cellulase or ubiquinone); xylogen; stanol ester or harmless bacterium (specifically are Lactobacterium acidophilum (Lactobacillus acidophilus); lactobacillus delbruockii subspecies bulgaricus (Lactobacillusbulgaricus); bifidus (Lactobacillus bifidus); plant lactobacillus (Lactobacillusplantarum) or faecium (Streptococcus faecium)), folic acid and soluble fiber.

Technique effect:

Unexpectedly, acyltransferase has significant acyltransferase activity in food.This activity has beyond thought advantageous application in the preparation method of food.

The present invention is based on beyond thought discovery, acyltransferase promptly of the present invention can carry out the carbohydrate esterification by alcoholysis effect (alcoholosis) in the higher food of water content, promptly shifts acyl group from lipid.If prior art prompting this kind of enzyme is brought into play function fully by this way, (promptly in the low or anhydrous environment of water content) so can only play a role in solvent environment.

The invention provides one or more following specifically is unexpected technique effect in the mayonnaise at egg-products: the thermostability of improving in pasteurizing process; The sensory organ characteristic of improving, the viscosity of improvement (consistency).

The invention provides one or more following unexpected technique effect in dough and/or baked product: the specific volume (specific volume) of the dough of improvement or baked product (for example bread and/or cake); The dough stability of improving; The crust scoring (for example thinner and/or more crisp bread crust) that improves; The dough flesh scoring that improves (for example more uniform dough flesh distribution and/or meticulousr dough flesh structure and/or more softish dough flesh); The outward appearance of improving (for example smooth surface is not steeped or the hole, does not perhaps steep basically or the hole); Spoiled minimizing; The pliability of improving; The smell that improves; The taste that improves.

The present invention can provide useful effect, described effect comes from the formation of high surface material in the food and does not form a large amount of free fatty acidies basically, can reduce the oxidation capacity of food when storage like this, this is because free fatty acids is easier to oxidized than corresponding fatty acid ester.

Aptly, the present invention can be provided at one or more the following unexpected technique effects in the food: the stability of the outward appearance of improvement, the mouthfeel of improvement, raising specifically is the thermostability that improves, the taste of improvement, the pliability of raising, the elasticity of improvement, the emulsifying effect of improvement.

Aptly, the invention provides at milk-product unexpected technique effect below one or more in the ice cream for example: the mouthfeel of improvement (oiliness of better suckling mouthfeel), the taste that improves, the pre-arcing characterisitics of improvement.

Aptly, the invention provides unexpected technique effect below in egg or eggs product one or more: the raising of emulsifying stability, the raising of thermostability, the local flavor of improvement, the stench of reduction, the thickening characteristic of improvement, the viscosity of improvement.

The concrete technique effect relevant with the application of acyltransferase in food products preparation of this paper definition can be set forth in the following form:

	Food	Effect
				1	Bread, muffin and fried bagel	Strengthen the intensity and the mechanical resistance of dough, strengthen the volume of water-retaining capacity, increase baked goods, keep the pliability of bread crumb
2	Freezing dough	Anti-corrupt when refrigeration
			3	Spongy cake	Make good cake volume and consistent soft degree
4	Biscuit, barm biscuit and cookies	Give birth to the stable lipomul of preparation, prevent adhesion with machine.Prevent the high-fat foods frosting.
			5	Batter and breading	Improve the structure of fried food product
6	Noodles	Prevent that dough from adhering on the machine.Improve water content, reduce cooking loss.
			7	Instant noodles	Prevent adhesion between the noodles
8	Spaghetti	Adhesion when the dough conditioning agent prevents to cook
			9	Egg milk custard	Make the more sliding cream texture that has more of starch paste, and anti-dehydration
10	The coffee whitening agent	Prevent oily water separation
			11	Stirring-type cheese	Stable emulsion is provided
12	Coca-Cola	Prevent and reduce frosting
			13	Caramel, rock sugar and nougat	Improve the emulsifying effect of the sugar and the oil of fusing, prevent separating of oil
14	Meat product, sausage	Improve the storage capacity of sausage and compression ham, prevent meat stick with paste with pate in the separating of oil phase

Aptly, the present invention can provide following one or more unexpected technique effects in cheese: the improvement of the decline of (oiling-off) effect of going rancid in the cheese, the increase of cheese productive rate, taste, stink reduce, " soap " flavor reduces.

In foodstuff production, specifically be in the production of cheese, use acyltransferase of the present invention and have significant advantage aspect the ability that reclaims soluble protein from milk-product.For example, in producing, removes from whey (i.e. the water sample part of residual milk after the curdling piece forms) in cheese near 20% of whole milk proteinss.Comprise the solubility milk-protein in the whey, hydrophobin is retained in the curdling piece.The acyltransferase of the application of the invention can be transferred to protein (specifically be whey-protein, for example lactoglobulin (lactoglobulin)) from lipid (preferably from glycolipid or phosphatide) with acyl group and form albumen lipid acid polycondensate.Therefore, produce a kind of product, it more hydrophobic and also can be retained in the curdling piece but not in whey wash-out.In this way, more milk-proteins are retained in the final product, promptly final milk-product such as cheese.

On the one hand, the present invention's part is based on improving food such as cheese yield by using acyltransferase.Additionally or can be alternatively, flavour of food products, quality, antioxidative stabilizer (oxidativestability) and/or effective period of food quality can improve.Additionally or can be alternatively, food can have the cholesterol levels of reduction or the plant sterol ester of raising/stanol ester content.

Do not expect to be confined to certain concrete theory, think that the increase of food output is that acyl migration by whey-protein and peptide causes, and cause the precipitation capacity of the whey-protein of whey-protein hydrophobicity in the cheese curd and acidylate to significantly improve.

In biosystem, for example, the deposition of embrane-associated protein and enzyme can obtain by two kinds of different mechanisms.Embrane-associated protein or have a some amount stride film or hydrophobic domain, or optionally have the lipid acid that is connected with polypeptide chain.Lipid acid has the carbochain of 14 or 16 carbon atoms usually.Lipid acid and polypeptide chain are covalently bound at three place's different positionss, and the amino amino end is as amido linkage, and cysteine residues connects as thioesters (thioester), or Serine or Threonine connect as ester.An each peptide molecule only lipid acid is essential for protein is mixed in the cytolemma.

When lipid acid when being covalently bound to non-membranin, its physics will obviously change with characteristic function.WO97/14713 has described soybean protein and gluten by (LipozymeTM Novozymes) handles the lipid acid that changes in acyl derivative and the organic solvent with the lipase that is derived from meter black wool mould (Mucor miehei).Acyltransferase of the present invention is used in low moisture or the high moisture environments and produces acylated protein.

We notice that the albumen of acidylate forms amphipathic mixture, can be used for multiple makeup.The albumen of acidylate can form gel (but combination water is to keep humidity) and have emulsifying property, has extraordinary activity in the intermediate phase between water and lipid.

Therefore, one aspect of the present invention can provide the make-up composition of the acyltransferase that comprises this paper definition.

In addition, the present invention also provides the purposes of acyltransferase in the production cosmetic compositions of this paper definition.

On the other hand, the present invention also provides the method for original position generation protein ester in make-up composition, and this method comprises that the acyltransferase that this paper is defined adds the step in the make-up composition (or its component) to.

Multiple food proteins can be water-soluble, therefore is suitable for carrying out in-situ modification by lipase acyltransferase (lipase acyltransferase).In cheese was produced, beta-lactoglobulin entered isolated fraction and is lost.Using after lipase acyltransferase or its variant carry out acidylate, initial result shows that beta-lactoglobulin is deposited in the casein micelles surface in thick matter rennin (rennet) process of setting.Beta-lactoglobulin has three potential acylation sites (serine residue) on three surface rings.Cow's milk comprises the Yelkin TTS of capacity, and Yelkin TTS is acyltransferase carries out acidylate to beta-lactoglobulin suitable substrate.The lysolecithin that forms can have additional emulsifying effect.

With use do not have acyltransferase activity lipolytic enzyme for example triacylglycerol lipase compare with Phospholipid hydrolase, can see that using acyltransferase of the present invention has tangible improvement.

Advantage

Represent that from the emulsifying agent of at least a food raw material composition original position generation and the generation of sterol/stanol ester food raw material will comprise a kind of additional raw material of less amount at least.Because the improvement aspect the accessibility of producing, this is useful.For example, need not to carry out the further course of processing or additionally add additional composition, or additional emulsifying agent." additive " that further, can comprise less amount in the food.The minimizing of additive or removal are that the human consumer wants, and the frequent requirement of the interpolation of additive must be indicated in the product composition list so that allow the human consumer know and be known.Therefore, the present invention has more advantage.

Benefit of the present invention can be the deleterious increase that the emulsifier production of original position generation in the food does not bring free fatty acid content in the food.

Original position produces from least a food raw material composition two kinds of emulsifying agents and/or a kind of carbohydrate fat show that food raw material contains a kind of additional raw material of less amount at least.

In addition, when acyltransferase acted on glycolipid, original position produced emulsifying agent DGMG and the deleterious increase that do not bring free fatty acid content in the food valuably.Therefore, reduce because the deleterious effect that the increase of free fatty acids produces includes but not limited to reduce " soap " taste in the cheese, prevent in dough and the baking wheaten food in the excess use.

In some respects, the invention has the advantages that and reduced in the food free cholesterol level.

On the other hand, the invention has the advantages that and increased the content of sterol ester/sterol ester in the food.Some sterol esters and/or sterol ester can be effective seasonings and/or quality modifying agent.The present invention not only can original position generate emulsifying agent, and can original position generate seasonings and/or quality modifying agent in food.More known sterol esters/sterol ester can reduce serum cholesterol and/or low-density lipoprotein if add in the food.Therefore, the present invention can be used to produce the food that contains high-level sterol ester and/or stanol ester.

In some respects, particularly, advantage is to have removed when enzyme of the present invention is applied to product based on eggs unnecessary uncombined carbon hydrate.

Valuably, food emulsifier character also is enhanced, and has brought the improvement of outward appearance and/or enhancing and/or the improvement of structure and/or the reinforcement of conforming enhancing and/or thermostability of controllability, does not have negative impact and suit one's taste.

In addition, in some embodiments, advantageously, when self uses lipase, can overcome observed " overdose " effect effectively by adding enzyme of the present invention.This gives the credit to small part and does not produce free fatty acids or only have the free fatty acids of extremely low amount to produce when using enzyme of the present invention.

Separate

On the one hand, preferably, polypeptide or protein that the present invention uses are unpack formats.Term " isolating " meaning is that sequence is substantially devoid of at least a other composition at least, and this composition combines in this sequence is natural, and finds at nature.

Purifying

On the one hand, preferably, polypeptide or protein that the present invention uses are the purifying types.Term " purifying " meaning is the sequence state that is in relative purifying-as about at least 51% purity or about at least 75% purity, about at least 80% purity, about at least 90% purity, about at least 95% purity, about at least 98% purity.

The nucleotide sequence of clones coding polypeptide of the present invention

Coding have this paper definition specific nature polypeptide or be fit to the nucleotide sequence of adorned polypeptide, can from the cell that produces aforementioned polypeptides or organism, separate.There is multiple different known method separating nucleotide sequence this area.

For example, genomic dna (genomic DNA) and/or cDNA storehouse can be used by chromosomal DNA that is derived from the organism that produces polypeptide or messenger RNA(mRNA) and be made up.If polypeptid acid sequence is known, oligonucleotide probe that can complex sign, and be used to discern peptide coding type clone from the genomic library of organism preparation.Alternative, the oligonucleotide probe that comprises with the mark of another known polypeptide gene homologous aminoacid sequence can be used to discern the peptide coding clone.In the example of back, use the hybridization and the wash conditions of low preciseness.

Alternative, peptide coding the clone can differentiate by genomic DNA fragment is inserted in expression vector such as the plasmid, the genome dna library that use obtains (genomic DNA library) transforms the bacterium that does not contain enzyme, bacterium after will transforming is then coated and contains a kind of enzyme agar plate that is suppressed by polypeptide, thereby the clone of express polypeptide is identified.

As other selection, the nucleotide sequence of coded polypeptide can prepare with the standard method of determining is synthetic, this standard method is (1981) Tetrahedron Letters 22 such as Beucage S.L. for example, phosphoramide (phosphoroamidite) method that p1859-1869 describes, or (1984) EMBO such as Matthes J.3, the method that p801-805 describes.In the phosphoramide method, oligonucleotide is synthesized (for example in the automated DNA synthesizer), purifying, annealing, connects and is cloned in the suitable carrier.

Nucleotide sequence can be blended genome and synthetic source, blended is synthetic originates with cDNA, or blended genome and cDNA source, it can prepare by the fragment of using standard technique to connect synthetic DNA, genomic dna (genomic DNA) or cDNA source (suitable).Each junction fragment is corresponding to positions different in the whole nucleotide sequence.Dna sequence dna also can pass through polymerase chain reaction (PCR) and use specific primer preparation, and for example US 4,683, described in 202 or at Saiki R K etc. (Science (1988) 239, described in pp487-491).

Nucleotide sequence

The present invention also comprises the nucleotide sequence coded polypeptide of the specific nature with this paper definition.Term used herein " nucleotide sequence " refers to oligonucleotide sequence or polynucleotide sequence, its variant, homolog, fragment and its derivative (for example its part).This nucleotide sequence can be the source of genomic, synthetic or reorganization, no matter be represent synonym chain or antisense strand, it can be two strands or strand.

Term of the present invention " nucleotide sequence " comprises genomic dna, complementary DNA (cDNA), synthetic DNA, and RNA.The present invention is DNA preferably, more preferably the cDNA of encoding sequence.

In the embodiment preferred, in being attached to the physical environment that also has it, during with sequence that it combines, coding has the nucleotide sequence itself that this paper defines the polypeptide of concrete property and does not contain the natural nucleus glycoside acid sequence that exists under the natural condition.For ease of reference, we claim this embodiment preferred to be " non-natural nucleotide sequence ".Under this condition, term " natural nucleotide sequence " is meant the complete nucleotide sequence in himself natural surroundings, and condition is to be operably connected with the complete promotor of its natural institute's bonded, and described promotor also is present in himself natural surroundings.Therefore, polypeptide of the present invention can be expressed by the nucleotide sequence that is present in the natural biology body, but nucleotide sequence wherein is not subjected to the control of bonded promotor natural with it in this organism.

Preferred polypeptide is not a kind of natural polypeptides.Under this condition, term " natural polypeptides " is meant the complete polypeptide in a kind of natural surroundings that is in himself, and condition is that it is expressed by its natural nucleotide sequence.

Usually, the nucleotide sequence of polypeptide of coding with specific nature of the present invention definition can prepare by recombinant DNA technology (being recombinant DNA).Yet, in selectable embodiment of the present invention, all or part of of described nucleotide sequence can be used chemical process known in the art synthetic (with reference to (1980) Nuc Acids Res Symp Ser 215-23a nd HornT et al (1980) Nuc Acids Res Symp Ser 225-232 such as Caruthers MH).

Molecular evolution

In case the nucleotide sequence of codase is separated, the nucleotide sequence of the codase of perhaps inferring is identified that it is desirable revising selected nucleotide sequence, and for example making the nucleotide sequence sudden change in order to prepare enzyme of the present invention is desirable.

Sudden change can be introduced by the synthetic oligonucleotide.These oligonucleotide comprise the aminoacid sequence that is positioned at required mutational site flank.

Suitable method by Morinaga etc. in that (Biotechnology (1984) 2, and is open in p646-649).The method record of the another kind of nucleotide sequence of introducing codase of will suddenly change Nelson and Long (Analytical Biochemistry (1989), 180, p147-151).

As substituting of rite-directed mutagenesis, for example top described, can introduce sudden change at random, the GeneMorph PCR sudden change test kit that for example uses commercial reagents box such as Stratagene to produce, or variation (Diversify) the PCR random mutation test kit of Clontech production.EP 0 583 265 relates to the optimization to PCR-based d mutagenesis, and it can combine with the application of mutant DNA analogue (for example those materials of describing among the EP 0 866 796).Error-prone PCR (Error prone PCR) technology is suitable for producing the acyltransferase variant with preferred feature.WO0206457 relates to the lipase molecular evolution.

Obtain the fragmentation of the same aminoacid sequence of the third method right and wrong of new sequence, or use any amount of restriction enzyme, or use enzyme such as DNase I, and re-assembly encode functional protein whole aminoacid sequences.Perhaps, can introduce one or more unrecognizable aminoacid sequences, and re-assembly encode functional protein the process of whole aminoacid sequences in introduce sudden change.DNA reorganization and DNA family reorganization (DNA shuffling and family shuffling) technology are suitable for producing the mutant of the acyltransferase with preferred characteristics.The method of suitable realization " reorganization " is open by EPO 752 008, EP1 138 763, EP1 103 606.As US 6,180,406 and WO01/34835 described, reorganization also can combine with other form of dna mutation.

Therefore, can be in vivo or at external a large amount of rite-directed mutagenesis or random mutation, the coded polypeptide that improves with the diverse ways screening function subsequently of in nucleotide sequence, producing.Use the recombination method (see WO00/58517, US 6,344,328, and US 6,361,974) of silico and exo mediation, for example, molecular evolution can be finished under the mutant that produces keeps situation with the very low homology of known enzyme or albumen.The mutant of these acquisitions and known transferring enzyme have significant structure proximate, but have very low amino acid sequence homology.

As a unrestriced example, additionally, the sudden change of peptide sequence or natural mutation can be integrated into or wild-type or other sudden change or natural mutation in be used to produce new mutant.This new mutant is also screened to come out to improve the function of coded polypeptide.

By above-mentioned application of mentioning and similar molecular evolution method, can be under without any situation about the known knowledge of protein structure or function, differentiate and select to have the mutant of preferred character enzyme of the present invention, can produce uncertain but useful sudden change or mutant simultaneously.The example that a lot of relevant enzyme activity optimizations or change are arranged in the application of the relevant molecular evolution in this area.These examples comprise, but be not limited to following one or more, optimization is in host cell or the expression of external optimization or activity, increase enzymic activity, change zymolyte and/or product specificity, improve or reduce enzyme or stability of structure, (for example temperature, pH, zymolyte) enzymic activity/specific change under preferred envrionment conditions.

Use the molecular evolution instrument enzyme is changed to improve the function of enzyme, this is obvious for those skilled in the art.

Aptly, the acyltransferase that uses among the present invention can be a kind of mutant, promptly compares with its parental generation enzyme, can comprise at least one amino-acid substitution, disappearance or interpolation.Mutant enzyme keeps the homology with its parental generation enzyme at least 1%, 2%, 3%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99%.Suitable parental generation enzyme can comprise any enzyme with esterase or lipase activity.Preferably, the parental generation enzyme is consistent with the Pfam00657 consensus sequence.

In a preferred embodiment, the acyltransferase mutant is in GDSx, GANDY and HPT block reservation or mix one or more at least Pfarm00657 conserved sequence amino-acid residues.

Enzyme; for example in water surrounding, do not have or the lipase of low lipid acyltransferase activity can be used the molecular evolution instrument and suddenlys change; introduce or the enhancing transferase active, therefore produce the acyltransferase that is applicable to the compositions and methods of the invention with remarkable transferase active.

Aptly, being used for acyltransferase of the present invention can be a kind of mutant, and this mutant is compared with its parental generation enzyme, and for polar lipid, preferred phosphatide and/or glycolipid have the enhanced enzymic activity.Preferably, this mutant preferably shows low or non-activity for solvability (lyso) polar lipid.For polar lipid, the enhanced activity of phosphatide and/or glycolipid may be the result of hydrolytic action and/or transferase active.

Compare with its parental generation enzyme, be used for acyltransferase mutant of the present invention and may have weakened activity triglyceride level and/or monoglyceride and/or triglyceride.

Aptly, the enzyme mutant body is to triglyceride level and/or monoglyceride and/or triglyceride non-activity.

Perhaps, the enzyme mutant body that the present invention uses can have the activity of enhanced to triglyceride level, and/or also strengthen activity to following one or more materials, polar lipid, phosphatide, Yelkin TTS, phosphatidylcholine, glycolipid, digalactosyl monoglyceride, single galactosyl monoglyceride.

Known acyltransferase mutant and one or more mutant are applicable to method of the present invention and purposes and/or be used for enzyme composition of the present invention.As just giving an example, the acyltransferase mutant of describing in following reference goes for the present invention: Hilton ﹠amp; Buckley JBiol.Chem.1991 Jan 15:266 (2): 997-1000; J.Biol.Chem.1994Jan such as Robertson 21; 269 (3): 2146-50; J.Bacteriol such as Brumlik 1996 Apr; 178 (7): 2060-4; Protein Sci.1998 Mar such as Peelman; 7 (3): 587-99.

Aminoacid sequence

The present invention also comprises the amino acid sequence of polypeptide of the concrete property with this paper definition.

Term used herein " aminoacid sequence " and term " polypeptide " and/or term " protein " synonym.In some cases, term " aminoacid sequence " and term " peptide " synonym.

Aminoacid sequence can perhaps can maybe can prepare by using the DNA recombinant technology by synthetic preparation from suitable source preparation/separation.

Aptly, the aminoacid sequence of mentioning herein can obtain from the polypeptide of isolated this paper instruction by standard technique.

Below be to measure a kind of proper method of determining aminoacid sequence in the isolated polypeptide:

The polypeptide of purifying can be frost drying, and the starting material of 100 μ g frost dryings are dissolved in the mixing solutions that 50 μ l are made up of 8M urea and 0.4M bicarbonate of ammonia, pH8.4.50 ℃ of sex change reduction of dissolved protein 15 minutes cover the dithiothreitol (DTT) of adding 5 μ l 45mM then with nitrogen.After being cooled to room temperature, in room temperature, dark, the iodo-acid amide of adding 5 μ l 100mM was derived cysteine residues 15 minutes in the nitrogen environment.

The water of 135 μ l is added above-mentioned reaction mixture with the 5 μ g Methionin-C endoproteinases that are dissolved in 5 μ l water, and 37 ℃ digested 24 hours in nitrogen environment.

The polypeptide that obtains by reversed-phase HPLC at VYDAC carbon-18 post (0.46 * 15cm; 10 μ m; The Separation Group, California USA) separates, and makes the solvent B:0.1%TFA in the solvent orange 2 A in the water: 0.1%TFA and the acetonitrile.Before the N-terminal order-checking, can utilize the same solution system to carry out stratographic analysis again to the polypeptide of selecting by Develosil carbon-18 post.Can (Applied Biosystems, California USA) utilize the liquid Rapid Cycle of pulse, use Applied Biosystems 476A sequenator to check order according to the technical specification of manufacturer.

Sequence identity or sequence homology

The invention still further relates to aminoacid sequence (back is called " homologous sequence ") with the nucleotide sequence of the specific nature amino acid sequence of polypeptide with this paper definition or any this peptide species of coding have to a certain degree sequence identity or the purposes of the sequence of sequence homology.Here, term " autoploid " refers to and is tried aminoacid sequence and tried the entity that nucleotide sequence has certain homology.Here, term " homology " can be equal to " identity ".

Homologous amino acid sequence and/or nucleotide sequence should provide and/or encode and keep functionally active and/or zymosthenic polypeptide.

In this article, specify homologous sequence to comprise and tried sequence and have at least 75,85 or 90% consistence, preferred 95 or 98% conforming aminoacid sequence.Usually, homologous sequence comprises the avtive spot identical with being tried aminoacid sequence etc.Though homology also can be considered to similarity (amino-acid residue that promptly has similar chemical property/function), in the context of the present invention, preferably explain homology with the identity of sequence.

In the context of the present invention, specify homologous sequence to comprise that the nucleotide sequence (main body sequence) with code book invention polypeptide has at least 75,85 or 90% identity, the nucleotide sequence of preferred 95 or 98% identity.Usually, homologous sequence comprises coding avtive spot identical with being tried sequence and other sequence.Though homology also can be considered to similarity (amino-acid residue that promptly has similar chemical property/function), in the context of the present invention, preferably explain homology with the identity of sequence.

The homology comparison can with the naked eye be carried out, or more generally, compares by the sequence alignment software with easy acquisition.This commercially available computer software can calculate the % homology between two or more sequences.

The % homology can be calculated in adjacent sequence, and promptly a sequence is alignd with another, each amino acid of a sequence directly with another amino acid comparison, whenever next residue.This is called as " no gap " and arranges.Usually, this no gap is only arranged fewer relatively purpose residue is carried out.

Though this is a kind of very simple and stable method, but for example can not consider otherwise same sequence centering, insertion and disappearance will cause the amino-acid residue of back not align, and therefore when overall comparison has been finished, most likely cause percent homology to descend significantly.Therefore, for many sequence comparative approach that the generation optimal arrangement designs are considered the insertion and the disappearance that may exist, and can too not reduce whole homology score.This is by insertion " breach " in sequence, and maximization local homology realizes.

But, these more complicated methods are given the breach that each occurs with " breach point penalty " (" gap penalties ") on arranging, make identity amino acid for similar number, have the comparison that the comparison (reflect two and be compared dependency higher between the sequence) of the least possible breach number Duos than the breach number and can obtain higher mark.The point penalty of the existence of general " affine breach cost " (" Affine gap costs ") breach of using is higher, and less to each the follow-up residue point penalty behind the breach.This is the breach points-scoring system of common application.High breach point penalty produces certainly has optimizing the arrangement of of less breach.Most of alignment problems allow the breach point penalty is changed.Yet, preferably use default value when using these softwares to carry out the sequence comparison.For example, when using GCG Wisconsin best-fit (Bestfit) routine package, default aminoacid sequence breach point penalty is each breach-12 and each extension-4.

Calculate maximum homology per-cent and at first need to consider the breach point penalty, produce optimal arrangement, realize that the suitable computer program of arranging like this is GCG Wisconsin best-fit routine package (1984 Nuc.Acids Research such as Devereux, 12 p387).Other can carry out the correlated software instances of sequence, includes but are not limited to, and the blast program bag is (referring to Ausubelet al 1999 ShortProtocols in Molecular Biology, 4 ^ThEd-Chapter 18), FASTA (Altschul etal 1990J.Mol.Biol.403-410) and GENEWORKS compare tool group.BLAST and FASTA can off line and online retrievings (with reference to Ausubel etc. 1999, pages 7-58 to 7-60).Yet, preferably use GCG best-fit program in some applications.The new tool of a BLAST 2Sequence by name also can be used for comparison protein and nucleotide sequence (referring to FEMS Microbiol Lett1999174 (2): 247-50; FEMS Microbiol Lett1999 177 (1): 187-8 and tatiana ﹠amp; Commat; Ncbi.nlm.nih.gov)

Although final percent homology can be measured in the mode of identity, alignment problem generally is not based on the paired comparison of all or noon (all-or-nothing).As an alternative, it is widespread usage that proportional similarity is divided matrix number, and this matrix is to each paired comparisons assignment based on chemical similarity and evolutionary distance.An example of usual a kind of like this matrix of using is exactly the default matrix of BLOSUM62 matrix-blast program assembly.If (expecting further details, referring to user manual) can be provided, the mark comparison sheet of the common application of GCG Wisconsin program or disclosed default value or applied customization.In some applications, preferably use the disclosed default value of GCG routine package, perhaps under the situation of using other software, use default matrix, as BLOSUM62.

Selectively, percent homology can be at DNASIS ^TM(Hitachi Software) calculates by utilizing multiple contrast characteristic, and this is based on a kind of CLUSTAL (Higgins DG ﹠amp that is similar to; Sharp PM (1988), Gene 73 (1), algorithm 237-244).

In case software has produced best comparison, just can sequence of calculation percent homology, preferred sequence identity per-cent.Usually software carries out the comparison of partial sequence, produces the numeric type result.

Sequence also can have deletion, insertion or the replacement of amino-acid residue, and this can produce a reticent variation and cause generating the material that is equal on the function.As long as material keeps second in conjunction with active, the purpose aminoacid replacement can based on residue polarity, electric charge, solubleness, hydrophobicity, wetting ability and/or amphipathic aspect the approximation of character carry out.For example, electronegative amino acid comprises aspartic acid and L-glutamic acid; Positively charged amino acid comprises Methionin and arginine; Have similar wetting ability and have the amino acid of uncharged polar head group, comprise leucine, Isoleucine, Xie Ansuan, glycine, L-Ala, l-asparagine, glutamine, Serine, Threonine, phenylalanine and tyrosine.

Can guard replacement, described in for example following table.Same district in second hurdle can replace mutually with the amino acid in the delegation in the preferred third column.

Aliphatic	Nonpolar	GAP
			ILV
		Polarity is charged nuclear not		CSTM
	NQ
			The charged nuclear of polarity	DE
	KR

Aromatic

HFWY

The present invention also comprises the generation that homology replaces, (replacing and replacing all is to use herein, promptly replace existing amino-acid residue with other residue) be similar replacement, for example basic aminoacids replaces basic aminoacids, acidic amino acid replacing acid acidic amino acid, polare Aminosaeren replaces polare Aminosaeren etc.Also non-homogeneous replacement can take place, promptly from a class residue to another kind of or selectively relate to alpha-non-natural amino acid for example ornithine (hereinafter being designated as Z), DAB ornithine (hereinafter being designated as B), norleucine ornithine (hereinafter being designated as O), pyriylalanine, thienyl alanine (thienylalanine), naphthyl L-Ala (naphthylalanine) and phenylglycocoll.

Replace and also can produce by alpha-non-natural amino acid.

The mutant of aminoacid sequence can comprise the suitable spacer groups of inserting between any two amino acid residue sequences and comprise alkyl group such as methyl, ethyl, propyl group, and amino acid spacer, for example glycine or alanine residue.Further mutant form is that those skilled in the art understand easily, and this mutant form comprises one or more amino-acid residues of class peptide (peptoid) form.For fear of producing query, " class peptide form " is used in reference to for the variant amino-acid residue, and wherein the alpha-carbon substituted radical is on the nitrogen-atoms of this residue but not on the alpha-carbon.The peptide of preparation class peptide form is known in the art, for example Simon RJ etc., PNAS (1992) 89 (20), 9367-9371 and Horwell DC, TrendsBiotechnol. (1995) 13 (4), 132-134.

The nucleotide sequence of polypeptide that nucleotide sequence of using among the present invention or coding have a specific nature of this paper definition can comprise the Nucleotide of synthetic or modification.Many different types of modification of oligonucleotide is known in the art.These comprise methylphosphonate and phosphorothioate skeleton and/or at 3 of molecule ' and/or additional acridine of 5 ' end or polylysine chain.For purpose of the present invention, any method that gets in this area all can be used to modify aminoacid sequence described herein, and this is understandable.These modifications can be used to improve the life-span of nucleotide sequence active or prolongation aminoacid sequence in vivo.

The present invention also relates to the sequence that aminoacid sequence is discussed as this paper, or the purposes of the complementary sequence of any derivative, fragment and derivative thereof.As infructescence is its segmental complementary sequence, and this sequence can be identified the existence etc. of similar encoding sequence in other organism as probe so.

With non-100% homology of the present invention but fall into the polynucleotide sequence of invention protection domain, can obtain by number of ways.Other mutant of sequence described herein also can obtain, for example by detecting from the different range individuality for example from the DNA of individual library of different population.And; other virus/bacterium; or the autoploid of cell particularly the cell homologue of mammalian cell (for example rat, mouse, ox or primates zooblast) can obtain, the fragment of this autoploid and it generally speaking can optionally listed with this paper sequence table sequence hybridization.This sequence can obtain by cDNA library or the genome dna library that detects other animal species, and in survey such library with probe under the high rigorous condition, described probe comprises all or part of of any sequence shown in the sequence table.Similar consideration is applicable to kind homologue and the allelic mutant that obtains polypeptide of the present invention and nucleotide sequence.

Variant and bacterial strain/kind autoploid also can be used degenerate pcr and obtain, and it uses design to be used in target variant and the autoploid primer of the sequence of conserved amino acid sequence in the code book invention sequence.Conserved sequence can for example be predicted from the aminoacid sequence of several variant/autoploids by comparison.Sequence alignment can be undertaken by computer software well known in the art.The GCGWisconsin PileUp program of widespread use for example.

The primer that is used for degenerate pcr can comprise one or more degeneracy position, and it can be used for stringent condition, and this stringent condition is lower than uses those stringent conditions that come cloned sequence at the single aligning primer of known array.

Perhaps, these polynucleotide can obtain by the site-directed mutagenesis of characteristic sequence.When for example reticent codon sequence variation of needs was come the optimization codon to the preference of the concrete host cell of wherein expressing polynucleotide, this was useful.The variation of other sequence is to limit the polypeptide recognition site in order to introduce, or changes the character or the function of the polypeptide of polynucleotide encoding.

The passable probe of polynucleotide of the present invention (nucleotide sequence) be used to prepare primer for example the PCR primer, be used to replace the primer of amplified reaction, thereby probe for example comes mark with radioactivity or nonradioactive labeling by exposing (revealing) marker by ordinary method, and perhaps polynucleotide can be cloned in the carrier.Described primer, probe and other fragment can be at least 15, preferably at least 20, and for example the length of at least 25,30 or 40 Nucleotide is also contained in the term used herein polynucleotide.

Polynucleotide of the present invention are DNA polynucleotide and probe can prepare with recombinating, preparation or prepare with any effective means that those skilled in the art can obtain synthetically for example.They also can be cloned by standard technique.

Generally speaking, primer is produced with synthetic method, comprises with a kind of branch one step preparation method of the required nucleotide sequence of mode of Nucleotide once.The technology of using automatic technique to finish above-mentioned task is the technology that this area obtains easily.

Long polynucleotide can prepare with gene recombination technology usually, for example use PCR (polymerase chain reaction) clone technology.This comprises preparation and is positioned at the primer of the lipid targeted sequence area flank that needs clone to (for example about 15 to 30 amino acid), this primer is contacted with the mRNA or the cDNA that obtain from animal or human's cell, under the condition that makes the desired zone amplification, carry out polymerase chain reaction, separate the fragment (for example by purification reaction mixture in sepharose) that is amplified and reclaim the DNA that is amplified.Primer can be designed as and comprises suitable enzyme recognition site restriction enzyme, to such an extent as to the DNA that is amplified can be cloned into suitable cloning vector.

Hybridization

The present invention also comprises the complementary sequence of sequence of the present invention, or can or hybridize in the sequence of the present invention or the sequence in its complementary sequence.

The term " hybridization " that the present invention uses comprises " process that nucleic acid chains is connected to complementary strand by base pairing ", just uses the amplification procedure of polymerase chain reaction (PCR) technology.

The present invention also relates to can with the complementary sequence that is tried sequence of this paper discussion or its any derivative, its purposes of nucleotide sequence of fragment or derivatives thereof hybridization.

The present invention also relates to complementary sequence with the sequence of the nucleotide sequence hybridization that can discuss with this paper.

Hybridization conditions is based on the melting temperature(Tm) (Tm) of Nucleotide in conjunction with mixture, as Berger and Kimmel (1987, Guide to Molecular Cloning Techniques, Methods in Enzymology, Vol.152, Academic Press, San Diego CA) instruction in, and show below " severity " of definition.

Maximum severity is representational to be occurred under Tm-5 ℃ of (Tm than probe hangs down 5 ℃) condition; High severity occurs in following 5 ℃-10 ℃ of about Tm; Medium severity occurs in following 10 ℃-20 ℃ of about Tm; Low severity occurs in following 20 ℃-25 ℃ of about Tm.Just as understood by a person skilled in the art, maximum stringency hybridization can be used in to be identified or detects identical nucleotide sequence, and medium (or low) stringency hybridization can be used in identify detection type like or relevant polymerized nucleoside acid sequence.

Preferably, the present invention is included under high severity or the medium stringency and can has the complementary sequence of sequence of nucleotide sequence hybridization that the present invention defines the polypeptide of specific nature with coding.

More preferably, the present invention relates to can be high stringent condition (for example 65 ℃ and O.I * SSC{l * SSC=0.15M NaCl, 0.015M Trisodium Citrate pH7.0)) have the complementary sequence of sequence of nucleotide sequence hybridization of the polypeptide of the specific nature that this paper defines down with coding.

The present invention also relates to the sequence of nucleotide sequence (complementary sequence that comprises the sequence that those this paper discuss) hybridization that can discuss with this paper.

The present invention also relates to the complementary sequence of the sequence of nucleotide sequence (complementary sequence that comprises the sequence that those this paper discuss) hybridization that can discuss with this paper.

During being also included within, the present invention waits until under the maximum stringency polymerized nucleoside acid sequence of the nucleotide sequence hybridization that can discuss with this paper.

In aspect preferred, the present invention has covered can be under stringent condition (for example 50 ℃ and 0.2 * SSC) with the nucleotide sequence of this paper discussion, or the nucleotide sequence of its complementary sequence hybridization.

In aspect being more preferably, the present invention has covered can be under high stringent condition (for example 65 ℃ and 0.1 * SSC) nucleotide sequences of discussing with this paper, or the nucleotide sequence of its complementary sequence hybridization.

Polypeptide expression

The nucleotide sequence that the present invention uses or coding has the polypeptide of specific nature that the present invention limits can be incorporated in the replicable vector of reorganization.This carrier can and/or from compatible host cell, duplicate and express the form that nucleotides sequence is classified polypeptide as.Expression can be used control sequence, comprises that promotor/enhanser and other express conditioning signal and control.Can use procaryotic promotor and in eukaryotic cell, have the promotor of function.But using-system specificity promoter or stimulation specificity promoter.Also can use chimeric promotor, the sequential element that it comprises is from two or more above-mentioned different promoters.

The nucleotide sequence polypeptide expressed that is produced by host's reconstitution cell can depend on the sequence of use and/or carrier and be secreted or be comprised in the cell.Encoding sequence can be designed to signal sequence, and this signal sequence can guide the encoding sequence of described material to pass concrete prokaryotic organism or eukaryotic cell membrane.

Expression vector

Term " expression vector " meaning be a kind of can be in vivo or the construct of vivoexpression.

Preferably, expression vector is incorporated in the organism genome.Term " mixes " to preferably include stably and is incorporated in the gene.

The nucleotide sequence that nucleotide sequence of the present invention or coding have the polypeptide of specific nature that the present invention limits may reside in the carrier, wherein said nucleotide sequence is operably connected to the adjusting sequence, can express nucleotide sequence by suitable host organisms to such an extent as to should regulate sequence, promptly this carrier is an expression vector.

Carrier of the present invention can be transformed into the suitable host cell that describes below and express the polypeptide with specific nature that the present invention limits.

The selection of carrier, for example plasmid, cosmid, virus or phage vector usually depend on the host cell that it is introduced into.

Carrier can comprise one or more selectable marker genes-such as the gene that antibiotics resistance is provided, as penbritin, kantlex, paraxin or tetracyclin resistance.Perhaps, this selection can be finished (as describing among the WO91/17243) by cotransformation.

Carrier can be used to external, for example produces RNA or is used for transfection or transformed host cell.

Therefore, in a further specific embodiments, the invention provides a kind of method of nucleotide sequence that nucleotide sequence of the present invention or coding have the polypeptide of specific nature that the present invention limits for preparing, described method is by introducing nucleotide sequence in replicable vector, introduce this carrier in the host cell that is fit to, and make described host cell growth under the condition that described carrier duplicates can causing.

Carrier can further be included in and promote the nucleotide sequence that carrier duplicates in the host cell of just discussing.The example of these sequences is replication orgin of plasmid pUC19, pACYC177, pUB110, pE194, pAMB1 and pIJ702.

Regulate sequence

In some applications, the present invention use nucleotide sequence or the nucleotide sequence of the polypeptide of coding with specific nature that the present invention limits can be operatively attached to can (as by selected host cell) expression as described in nucleotide sequence the adjusting sequence on.For example, the present invention includes such carrier, it comprises the nucleotide sequence of the present invention that can be operationally connected on such adjusting sequence, and promptly this carrier is an expression vector.

Term " can be operatively connected " (" operably linked ") and refer to (juxtaposition) side by side, and wherein the component of Miao Shuing is to make their relations with the effect of intention mode.The adjusting sequence that " can be operatively connected " encoding sequence is to be connected by finish the mode of expressing encoding sequence under the condition compatible with control sequence.

Term " adjusting sequence " comprises promotor and enhanser and other expression conditioning signal.

Term used herein " promotor " is can conventionally to use in this area, for example the RNA polymerase binding site.

The enhancing of nucleotide sequence that coding has an enzyme of the specific nature that the present invention limits is expressed and also can be finished by selecting allogenic adjusting sequence, for example promotor, secretion leader sequence (secretionleader) and terminator.

Preferably, nucleotide sequence of the present invention can be operatively connected with at least one promotor.

It is well known in the art instructing the example of the suitable promotor that bacterium, fungi or yeast host inner nucleotide sequence transcribe.

Construct

Term " construct " and term are as " conjugate (conjugate) ", " box (cassette) " and " heterozygote (hybrid) " synonym, it comprises that coding has the nucleotide sequence of the polypeptide of specific nature that the present invention limits, and it is used for directly or indirectly being connected with promotor according to the present invention.Indirectly the example that connects is that suitable interval group (spacer group) is provided in the middle of promotor and nucleotide sequence of the present invention, and intron sequences for example is as Sh1 intron or ADH intron.Equally, term of the present invention " fusion " comprises direct or indirect connection.In some respects, these terms do not comprise the natural combination of the proteinic nucleotide sequence that coding usually is connected with the wild type gene promotor and condition be described they all be in their physical environment.

Described construct even can comprise or express marker that allow to select genetic constructs.

In using for some, preferred described construct comprises the Nucleotide that nucleotide sequence of the present invention at least or coding have the polypeptide of the specific nature that the present invention limits, and it can be operated and link promotor.

Host cell

Term of the present invention " host cell " comprises any cell with following character: it comprises the nucleotide sequence of polypeptide that coding has specific nature that the present invention limits, perhaps above-described be used to recombinate prepare polypeptide expression carrier with specific nature that the present invention limits.

Therefore, the further specific embodiments of the present invention provides the nucleotide sequence that has a polypeptide of specific nature that the present invention limits with nucleotide sequence of the present invention or coding to transform or the host cell of transfection.Can select the described cell compatible with above-mentioned carrier, can for example be the cell of prokaryotic organism (as bacterium), fungi, yeast or plant.Preferred host cell is not people's a cell.

The example of the host bacterium organism that is fit to is gram-negative bacteria or gram-positive microorganism.

Depending on the character of nucleotide sequence that coding has the polypeptide of specific nature that the present invention limits, and/or further processing expressed proteinic demand, Eukaryotic host for example yeast or other fungi is preferred.Generally speaking, yeast cell is that relative fungal cell is preferred, because yeast cell is easier to handle.Yet, some protein or from yeast cell secretion seldom, perhaps sometimes by appropriate processing (for example high-glycosylation in the yeast).In these examples, should select different fungal host organisms.

Suitable host cell; purposes as yeast, fungi and plant host cell; can provide posttranslational modification (for example myristoylation, glycosylation, brachymemma, lapidation (lapidation) and tyrosine, Serine or Threonine phosphorylation), because may need to make recombination expression product of the present invention to have best biological activity.

Described host cell can be (minus) the proteolytic enzyme defective or the proteolytic enzyme feminine gender bacterial strain.

Organism

Term of the present invention " organism " comprises and anyly comprises nucleotide sequence of the present invention, or comprises the nucleotide sequence of the polypeptide with specific nature that the present invention limits of being used to encode and/or the organism of thus obtained product.

Suitable organism can comprise prokaryotic organism, fungi, yeast or plant.

Term of the present invention " transgenic organism " comprises any organism, described organism comprises the nucleotide sequence of the polypeptide with specific nature that the present invention limits of being used to encode and/or thus obtained product, and/or promotor wherein can allow the nucleotide sequence of the polypeptide that expressing is used to encode has specific nature that the present invention limits in organism.Preferred nucleotide sequence is impregnated in the organism genome.

Term " transgenic organism " is not included in the natural nucleotide encoding sequence in the natural surroundings, and their natural promoter that this moment, described sequence was subjected to be in equally in the natural surroundings is controlled.

Therefore, transgenic organism of the present invention comprises containing and is selected from one of following material, or the organism of its combination: the nucleotide sequence of the polypeptide of being used to encode with specific nature that the present invention limits, the construct of this paper definition, the carrier that this paper limits, the plasmid that this paper limits, the cell that this paper limits, or its product.For example, transgenic organism is also contained in allogenic promotor control be used to encode the down nucleotide sequence of polypeptide with specific nature that the present invention limits.

Host cell/host organisms transforms

Just as previously noted, host organisms can be prokaryotic organism body or most eukaryotes.The prokaryotic organism host's who is fit to example comprises intestinal bacteria and Bacillus subtilus.

It is well known in the art that the prokaryotic organism host transforms, for example referring to (MolecularCloning:A Laboratory Manual, 2nd edition, 1989, Cold Spring HarborLaboratory Press) such as Sambrook.If use the prokaryotic organism host, need suitably modify-for example to be removed intron before nucleotides sequence is listed in and transforms so.

In another specific embodiments, transgenic organism can be a yeast.

Filamentous fungal cells can use the whole bag of tricks well known in the art to transform, and for example relates to protoplastis and forms and protoplast transformation, uses the method for known mode regenerative cell's wall afterwards.Aspergillus (Aspergillus) is open by EP 0 238 023 as the purposes of host microorganism.

Another kind of host organisms can be a plant.The summary that is used for transforming the general technology of plant is disclosed in the article of the article of Potrykus (Annu Rev Plant Physiol Plant Mol Biol[1991] 42:205-225) and Christou (Agro-Food-Industry Hi-Tech March/April 199417-27).Further the instruction relevant for the Plant Transformation aspect sees EP-A-0449375.

Part is stated in extensive instruction for fungi, yeast and Plant Transformation as follows.

The fungi that transforms

Host organisms can be the filamentous fungus of fungi-for example.The host's that this type of is fit to example comprise belong to that Zimadzhunt L 340 belongs to, in the branch mould genus of top spore (Acrenomium), Aspergillus, Penicillium, Mucor (Mucor), Neurospora (Neurospora), Trichoderma Pseudomonas such as (Trichoderma) any one.

The instruction that transforms filamentous fungus can be referring to US-A-5741665, and it has been summarized the conversion filamentous fungus and has cultivated fungi standard technique well known in the art.A wider summary that is applicable to Neuraspora crassa (N.crassa) for example sees among MethodsEnzymes (1971) 17A:79-143 of Davis and de Serres.

The instruction that further transforms filamentous fungus is disclosed among the US-A-5674707.

On the one hand, host organisms can be Aspergillus, for example aspergillus niger.

The also available following method of transgenosis aspergillus of the present invention makes, for example Turner G.1994 (Vectorsfor genetic manipulation.In:Martinelli S.D., Kinghorn J.R. (editor) Aspergillus:50 years on.Progress in industrial microbiology vol 29.Elsevier Amsterdam1994.pp.641-666) instruction method.

Genetic expression in the filamentous fungus has been disclosed in (2002) Trends Biotechnol2002 May such as Punt; 20 (5): 200-6, Archer ﹠amp; Peberdy Crit Rev Biotechnol (1997) 17 (4): among the 273-306.

The yeast that transforms

In another embodiment, transgenic organism can be a yeast.

The summary of the principle of allogeneic gene expression sees in the relevant yeast, Methods Mol Biol (1995) for example, 49:341-54 and Curr Opin Biotechnol (1997) Oct; 8 (5): 554-60.

From this angle, yeast saccharomyces cerevisiae (Saccharomyces cerevisi) of yeast-for example or pichia pastoris phaff (Pichia pastoris) are (referring to FEMS Microbiol Rev (200024 (1): 45-66) can be used as the carrier of allogeneic gene expression.

About the summary of the secretion principle of yeast saccharomyces cerevisiae allogeneic gene expression and gene product is seen EHinchcliffe E Kenny (1993, " Yeast as a vehicle for the expression of heterologousgenes ", Yeasts, Vol 5, Anthony H Rose and J Stuart Harrison, eds, 2nd edition, Academic Press Ltd.).

Transform for zymic, developed several testing programs.For example, transgenic yeast of the present invention can be by (1978, Proceedings of the National Academy ofSciences of the USA 75,1929) such as following Hinnen; Beggs, J D (1978, Nature, London, 275,104); And Ito, and H et al (1983, J Bacteriology 153, the 163-168) method of instruction preparation.

Transformed yeast cells can by use different selected markers for example the antibiotic resistance mark of nutrient defect type mark dominance select.

Suitable yeast host organism can be selected from the relevant yeast specie of biotechnology, for example, but be not limited to, be selected from Pichia, Hansenula (Hansenula), genus kluyveromyces, Yarrowiniaspp., yeast belong (Saccharomyces spp.) and comprise that yeast saccharomyces cerevisiae or fission yeast (Schizosaccharomyce spp.) comprise schizosaccharomyces pombe (Schizosaccharomyce pombe).

The bacterial strain pichia pastoris (Pichia pastoris) of methyl battalion oxygen (methylotrophic) yeast kind can be used as host organisms.

In one embodiment, host organisms can be a Hansenula, for example multiple-shaped nuohan inferior yeast (H.polymorpha) (as disclosed in WO01/39544).

Plant transformed/vegetable cell

The host organisms that the present invention suits can be a plant.About the summary of general technology sees the article (Annu Rev Plant Physiol Plant Mol Biol[1991] 42:205-225) of Potrykus and the article (Agro-Food-IndustryHi-Tech March/Apnl199417-27) of Christou, or in WO01/16308.For example, transgenic plant can produce the plant sterol ester and the phytostanol ester of elevated levels.

Therefore; the present invention also relates to produce the method for the transgenic plant of plant sterol ester with raising and phytostanol ester level, comprise acyltransferase transformed plant cells (specifically being expression vector or structure) with the present invention's definition and the step that cultivates plants from cell transformed with the acyltransferase that comprises this paper definition.

Secretion

Usually, polypeptide is secreted into from the phenotype host wishes the substratum to obtain, and endonuclease capable is easy to reclaim from described substratum.The secretion leader sequence can be selected based on required expressive host.The hybridization signal sequence also is applied in the present invention.

The common examples of allos secretion leader sequence is that those come from amylomycin Portugal glycosides enzyme (AG) gene (glaA-has 18 and 24 amino acid, for example from aspergillus), the sequence of a-factor gene (yeast is yeast belong, genus kluyveromyces and Hansenula for example) or alpha-amylase gene (bacillus).

Detect

There is multiple detection this area and measures the known schemes that aminoacid sequence is expressed.The cell sorting method (FACS) that for example comprises enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA) and fluorescent activation.

Those skilled in the art grasp known multiple mark and interconnection technique, and can be used in nucleic acid and the determined amino acid aspect.

Many companies, for example Pharmacia Biotech (Piscataway, NJ), Promega (Madison, WI) and US Biochemical Corp (Cleveland OH) provides commercial test kit and experimental program for these methods.

Suitable reporter molecule or mark comprise those radionuclides, enzyme, fluorescein, chemiluminescent substance (chemiluminescent), developer, also comprise similarly material of substrate, cofactor, supressor, magnetic particle or the like.Patent comprises US-A-3,817,837, US-A-3,850,752, US-A-3,939,350, US-A-3,996,345, US-A-4,277,437, US-A-4,275,149 and US-A-4, and 366,241 have instructed the purposes of these marks.

Recombination immunoglobulin also can be produced described in 816,567 as US-A-4.

Fusion rotein

Polypeptide with specific nature of the present invention can be taken as fusion rotein production, for example helps its extraction and purifying.The example of fusion rotein mating partner (partner) comprises glutathione-S-transferase (GST), 6xHis, GAL4 (DNA calmodulin binding domain CaM and/or transcriptional activation domains) and beta-galactosidase enzymes.Comprising the proteolysis cleavage site so that allow to remove the protein sequence of fusion rotein sequence between fusion rotein mating partner and target protein sequence also is easily.Preferred fusion protein does not hinder the activity of described protein sequence.

Gene fusion expression system in the intestinal bacteria has been disclosed in Curr.Opin.Biotechnol. (1995) 6 (5): among the 501-6.

In another specific embodiments of the present invention, the amino acid sequence of polypeptide with specific nature of the present invention can be connected to heterologous sequence so that encoding fusion protein.For example, can influence the active factor of material in order to screen the polypeptide libraries searching, the chimeric material that coding is expressed the allos epi-position that can discern the antibody that can buy is useful.

Part below the present invention will only be described in detail by embodiment and with reference to figure below and embodiment.

Fig. 1 shows the pfam00657 consensus sequence (SEQ ID No.1) from the 6th edition database;

Fig. 2 shows the aminoacid sequence (SEQ ID No.2) that obtains from the organism Aeromonas hydrophila (P 10480; GI:121051);

Fig. 3 shows aminoacid sequence (SEQ ID the No.3) (AAG098404 that obtains from the organism aeromonas salmonicida; GI:9964017);

Fig. 4 shows the aminoacid sequence (SEQ ID No.4) (Genebank accession number NP631558) that obtains from organism streptomyces coelicolor A3 (2);

Fig. 5 shows the aminoacid sequence (SEQ IDNo.5) (Genebank accession number CAC42140) that obtains from organism streptomyces coelicolor A3 (2);

Fig. 6 shows the aminoacid sequence (SEQ ID No.6) (Genebank accession number P41734) that obtains from the organism yeast saccharomyces cerevisiae;

Fig. 7 shows the comparison of selected sequence and pfam00657 consensus sequence.

Fig. 8 shows the pairing comparison of SEQ ID No.3 and SEQ ID No.2, and it shows 93% amino acid sequence identity.Signal sequence underlines.+ expression has difference.The GDSX motif comprises avtive spot Serine 16, and avtive spot aspartic acid 116 and Histidine 291 highlight (seeing the shadow region).Numeral behind the amino acid is negative signal sequence (minus the signal sequence);

Fig. 9 code displaying is from organism Aeromonas hydrophila nucleotide sequence (SEQ ID No.7) that obtain, acyltransferase of the present invention;

Figure 10 code displaying is from organism aeromonas salmonicida nucleotide sequence (SEQ ID No.8) that obtain, acyltransferase of the present invention;

Figure 11 code displaying is from organism streptomyces coelicolor A3 (2) nucleotide sequence (SEQ ID No.9) (Genebank accession number Nec003888.1:8327480..8328367) that obtain, acyltransferase of the present invention;

Figure 12 code displaying is from organism streptomyces coelicolor A3 (2) nucleotide sequence (SEQ ID No.10) (Genebank accession number AL939131.1:265480..266367) that obtain, acyltransferase of the present invention;

Figure 13 code displaying is from organism yeast saccharomyces cerevisiae nucleotide sequence (SEQ ID No.11) (Genebank accession number Z75034) that obtain, acyltransferase of the present invention;

Figure 14 shows the aminoacid sequence (SEQ ID No.12) (Genebank accession number AL646052) that obtains from organism Lei Er Salmonella (Ralstonia).

Figure 15 code displaying is from the nucleotide sequence (SEQ ID No.13) of the acyltransferase of the present invention of organism Lei Er Salmonella acquisition;

Figure 16 shows SEQ ID No.20.Described sequence encoding Scoel, it is conservative known (hypothetical) protein [streptomyces coelicolor A3 (2)] of NCBI protein accession number CAB39707.1GI:4539178;

Figure 17 shows the nucleotide sequence shown in SEQ ID No.21, the conservative known protein [streptomyces coelicolor A3 (2)] of its coding NCBI protein accession number CAB39707.1GI:4539178;

Figure 18 shows aminoacid sequence shown in the SEQ ID No.22.Described sequence encoding Scoe2, it is the conservative known protein [streptomyces coelicolor A3 (2)] of NCBI protein accession number CAC01477.1GI:9716139;

Figure 19 shows nucleotide sequence shown in SEQ ID No.23, this nucleotide sequence coded Scoe2, and it is the conservative known protein [streptomyces coelicolor A3 (2)] of NCBI protein accession number CAC01477.1GI:9716139;

Figure 20 shows the aminoacid sequence (SEQ ID No.24) of Scoe3, and described Scoe3 is the known secreted protein [streptomyces coelicolor A3 (2)] of NCBI protein accession number CAB88833.1GI:7635996;

Figure 21 shows nucleotide sequence shown in SEQ ID No.25, this nucleotide sequence coded Scoe3, and it is the known secreted protein [streptomyces coelicolor A3 (2)] of CAB88833.1GI:7635996 for NCBI albumen accession number;

Figure 22 shows the aminoacid sequence (SEQ ID No.26) of Scoe4, and described Scoe4 is that NCBI albumen accession number is the known secreted protein [streptomyces coelicolor A3 (2)] of CAB89450.1GI:7672261;

Figure 23 shows nucleotide sequence shown in SEQ ID No.27, this nucleotide sequence coded Scoe4, and it is the known secreted protein [streptomyces coelicolor A3 (2)] of NCBI protein accession number CAB89450.1GI:7672261;

Figure 24 shows the aminoacid sequence (SEQ ID No.28) of Scoe5, and Scoe5 is the known lipoprotein [streptomyces coelicolor A3 (2)] of NCBI protein accession number CAB62724.1GI:6562793;

Figure 25 shows the nucleotide sequence shown in SEQ ID No.29, and its Scoe5 that encodes, Scoe5 are the known lipoprotein [streptomyces coelicolor A3 (2)] of NCBI protein accession number CAB62724.1GI:6562793;

Figure 26 shows the aminoacid sequence (SEQ ID No.30) of Sriml, and Sriml is that NCBI protein accession number is the GDSL-lipase [streptomyces rimosus (streptomycesrimosus)] of AAK84028.1GI:15082088;

Figure 27 shows the nucleotide sequence shown in the SEQ ID No.31, and its Sriml that encodes, Sriml are that NCBI albumen accession number is the GDSL-lipase [streptomyces rimosus] of AAK84028.1GI:15082088;

Figure 28 shows from the aminoacid sequence (SEQ ID No.32) of the acyltransferase of Aeromonas hydrophila (ATCC#7965) acquisition;

Figure 29 code displaying is from the nucleotide sequence (SEQ ID No.33) of the acyltransferase of Aeromonas hydrophila (ATCC#7965) acquisition;

Figure 30 shows the aminoacid sequence (SEQ ID No.34) that kills the acyltransferase that salmon subspecies (Aeronionas salmonicidasubsp.Salmonicida) (ATCC#14174) obtain from aeromonas salmonicida;

Figure 31 code displaying is killed the nucleotide sequence (SEQ ID No.35) of the acyltransferase of salmon subspecies (ATCC#14174) acquisition from aeromonas salmonicida;

Figure 32 shows that the homologue of Aeromonas gene can use NCBI (theNational Center for Biotechnology Information), NIH, MD, basic local sequence alignment gopher service (basic local alignment search tool service) and the complete genome group database of USA are identified.Do the data library searching with the GDSX motif, and identified that potential coding has many sequence/genes of the enzyme of lipolytic activity.From streptomyces, identified gene in xanthomonas and the Lei Er Bordetella (Ralstonia).As following Example, blue or green withered Lei Er Salmonella (Ralstoniasolanacearum) compares with aeromonas salmonicida (satA) gene.The deck watch is revealed 23% identity in pairs.The avtive spot Serine appears at aminoterminal, and can identify catalytic residue Histidine and aspartic acid.

Figure 33 shows Pfam00657.11[family 00657, database version 11] comparison of consensus sequence (after this being called the Pfam consensus sequence) and different sequence and Pfam consensus sequence.Arrow is represented the avtive spot residue, and underlined frame (boxes) is represented three kinds by [Upton C and Buckley JT (1995) Trends Biochem Sci 20; 179-179] the homology frame indicated.Capitalization in the Pfam consensus sequence is illustrated in residue conservative among many family members."-" mark is represented to be expected at and is found residue in the hiding Markov model of Pfam consensus sequence and do not find residue, thereby the jagged site that is inserted into.". " label table is shown in the residue that does not have corresponding residue in the Pfam consensus sequence.These sequences are aminoacid sequences of listing in Figure 16,18,20,22,24,26,28 and 30.

Figure 34 shows Pfam00657.11[family 00657, database version 11] consensus sequence (after this being called the Pfam sequence), and the comparison of different sequence and Pfam consensus sequence.Arrow is represented the avtive spot residue, and underlined frame table shows three kinds by [Upton C and Buckley JT (1995) Trends Biochem Sci 20; 179-179] the homology frame indicated.Capitalization in the Pfam consensus sequence is illustrated in residue conservative among many family members."-" mark is represented to be expected at and is found residue in the hiding Markov model of Pfam consensus sequence and do not find residue, thereby the jagged site that is inserted into.". " label table is shown in the residue that does not have corresponding residue in the Pfam consensus sequence.These sequences are aminoacid sequences of listing in Fig. 2,16,18,20,26,28 and 30.These protein all have activity to lipid substrates.

Figure 35 shows the aeromonas salmonicida acyltransferase expression carrier pet12-AsalGCAT-pSM that comprises the C-terminal histidine mark;

Figure 36 shows the result who detects cell extract with NEFA kit measurement method, and the result has described the activity of reorganization aeromonas salmonicida acyltransferase to Yelkin TTS.What hole was from left to right represented is: the sample that positive control, negative control (being the empty plasmid extract) and IPTG induce the back insulation to collect in 0,1,2 and 3 hour.

Figure 37 shows the growth optimization of BL21 (DE3) pLysS contain expression vector pet12-AsalGCAT=pSM, and it is presented at 30 ℃ of cultivations and has generated Yelkin TTS is had highly active enzyme.Detect the phospholipase activity of cell extract with NEFA kit measurement method.What hole was from left to right represented is: positive control; Negative control; 20 ℃; 30 ℃;

Figure 38 shows the cell crude extract with substrate Yelkin TTS BL21 that together be incubated, the expression activity acyltransferase (DE3) pLysS, and reaction mixture shows the existence of degraded product by the tlc analysis.Swimming lane: 1. do not have enzyme; 2.+A.sal-10 37 ℃ of μ l; 3.+A.sal-20 37 ℃ of μ l; 4.+A.sal-10 24 ℃ of μ l; 5.+A.sal-20 24 ℃ of μ l;

Shown in Figure 39 is the partial purification of aeromonas salmonicida acyltransferase, and it has shown the phospholipase activity relevant with the histidine tagged protein of purifying.The SE=sonicated extract, His=with the Ni-NTA of Qiagen centrifugal-test kit (spin-kit) purifying;

Figure 40 shows (GCAT) the expression carrier pet12-A.h.GCAT=pSMa of Aeromonas hydrophila glycerine acyltransferase (Glycerolipid Acyl Transferase) comprise the terminal histidine mark of C-, is used to transformed into escherichia coli BL21 (DE3) pLysS;

Figure 41 shows crude extract (5 ﹠amp that use Non-Esterified Fatty Acid (NEFA) test kit (Roche, Switzerland), mensuration to contain reorganization Aeromonas hydrophila GCAT enzyme; 10 μ l), show to have to phosphatide the activated enzyme of Yelkin TTS to the activity of Yelkin TTS;

Figure 42 shows the growth optimization of BL21 (DE3) pLysS contain expression vector pet12-AsalGCAT=pSM, is presented at 30 ℃ of cultivations and has generated Yelkin TTS is had highly active enzyme.Detect the phospholipase activity of cell extract with NEFA kit measurement method.

Figure 43 shows the partial purification of the acyltransferase of Aeromonas hydrophila and aeromonas salmonicida, and it has shown the phospholipase activity relevant with the histidine tagged protein of purifying.The SE=sonicated extract, the His=Ni-NTA spin-test kit purifying of Qiagen;

Figure 44 has shown the expression of Aeromonas gene in subtilis 163, and its demonstration has produced all has active excretory enzyme to Yelkin TTS and DGDG.PUB-AH is the construct that comprises the Aeromonas hydrophila gene, and pUB-AS is the construct that has the aeromonas salmonicida gene, culture filtrate and substrate insulation 60 minutes.

Figure 45 and Figure 46 are presented at the chromatographic sheet (chloroform: methyl alcohol: water (65: 25: 4)) among the developping agent IV; Swimming lane 1: 40mg Sitosterol 30 minutes; Swimming lane 2: transferring enzyme+40mg Sitosterol 30 minutes; Swimming lane 3: transferring enzyme+80mg Sitosterol 30 minutes; Swimming lane 4: transferring enzyme+40mg Sitosterol 120 minutes; Swimming lane 5: transferring enzyme+80mg Sitosterol 120 minutes; Swimming lane 6: transferring enzyme+40mg Sitosterol 300 minutes; Swimming lane 7:40mg Sitosterol 300 minutes; Swimming lane 8: cholesterol; Swimming lane 9: Sitosterol;

Figure 47 has described the katalysis by acyltransferase, the reaction between phosphatidylcholine and the cholesterol;

Figure 48 shows that the lipid to extracting carries out thin-layer chromatographic analysis, 6 from enzyme processing or the yolk without the enzyme processing) 0.31PLU/g transferring enzyme #179,7) 1.25PLU/g transferring enzyme #178-9,8) 23.25PLU/g transferring enzyme #3108,9) contrast;

Figure 49 shows that the mayonnaise of handling or producing without the yolk that enzyme is handled with enzyme detects sample: 5) transferring enzyme #179,0.31PLU/g, 6) transferring enzyme #178-9,1.25PLU/g, 7) Phospholipid hydrolase #3108,23.3PLU/g, 8) contrast, water;

Figure 50 demonstration is used from the thin-layer chromatography (among solvent I) of the egg-yolk lipids of the acyltransferase processing of Aeromonas hydrophila extraction.

Figure 51 demonstration is used from the thin-layer chromatography (among solvent IV) of the egg-yolk lipids of the acyltransferase processing of Aeromonas hydrophila extraction.

Figure 52 is presented at the thin-layer chromatographic analysis of the egg-yolk lipids that the transferring enzyme of a time-histories handles.

The generation of lipid acid and sterol ester is as the function of time during Figure 53 display application acyltransferase (Tranf#178-9), and makes comparisons with lipolytic enzyme, the fine, soft fur thermophilic mould (Thermomyceslanuginosus) of using contrast.

Figure 54 has shown the relative transferase active that is expressed as % transferase active and hydrolytic activity in the enzymatic reaction in the yolk of high-moisture, and #1991 (Phospholipase A2) and #2427 (phospholipase A1) are the contrast Phospholipid hydrolases, and #178 is an acyltransferase;

Figure 55 shows the influence of water content to the transferase active of the transferring enzyme #178 of mensuration in the reaction of the transferring enzyme in the yolk of high-moisture.

Figure 56 is presented at the function of the transferase active of acyltransferase (#178) in the transferring enzyme reaction in the high yolk of water content as the reaction times.

Figure shown in Figure 57 and Figure 58 has described lipid acid and the cholesteryl ester function as the time.The result who has obtained by the vapour-liquid chromatography method during these figure have described and measured, this mensuration has been measured the acyltransferase activity with Yelkin TTS in the damping fluid and cholesterol as substrate;

Figure 59 shows the thin-layer chromatography among the solvent I.The yolk (swimming lane 1 and 2) that acyltransferase #138 through coming from aeromonas salmonicida handles, or with Phospholipid hydrolase #2938 (LIPOPAN ^F) yolk of Chu Liing (swimming lane 3), or untreated yolk (swimming lane 4).

Figure 60 shows the thin-layer chromatography among the solvent IV.The yolk of handling through acyltransferase #138 (swimming lane 1 and 2), or with the yolk (swimming lane 3) of Phospholipid hydrolase #2938 processing, or untreated yolk (swimming lane 4).

Figure 61 shows the yolk of handling through acyltransferase #138 (sample 1 and 2), or with the yolk (sample 3) of Phospholipid hydrolase #2938 processing, or untreated yolk (sample 4).

Figure 62 is presented at 100 ℃ of food emulsions of handling after 2 hours.0) untreated yolk, 1) handle 210 minutes yolk, 3 through acyltransferase #138) handle 210 minutes yolk through contrast Phospholipid hydrolase #2938;

Figure 63 has shown chromatographic sheet, and it has screened the transferase active to plant sterol and glycerine.The PC=phosphatidylcholine, LPC=lyso-phosphatidylcholine, PE=phosphatidylethanolamine; The monogl=monoglyceride;

Chromatographic sheet among the I of solvent shown in Figure 64, sample 1 to 6 are to react after 24 hours, and sample 1 to 4 is that reaction is after 4 hours.Thin-layer chromatographic analysis confirms to have formed sterol ester in sample 1,2,5 and 6.

Chromatographic sheet among the I of solvent shown in Figure 65, derive from aeromonas salmonicida immobilized acyltransferase transferase active with the oily mixture of the sample that took out in 0.5,1,3,6 and 24 hour in detect.

Chromatographic sheet shown in Figure 66 and Figure 67 among solvent I and the IV: swimming lane 1=Yelkin TTS; Swimming lane 2=contrast, 10 minutes; Swimming lane 3=0.75PLU, 10 minutes; Swimming lane 4=0.75PLU, 60 minutes; Swimming lane 5=0.75PLU, 220 minutes; Swimming lane 6=contrast, 20 hours; Swimming lane 7=0.75PLU, 20 hours; Swimming lane 8=cholesterol ester;

Figure 68 and Figure 69 are shown in the chromatographic sheet in the solution IV: swimming lane 1=Yelkin TTS; Swimming lane 2=contrast, 10 minutes; Swimming lane 3=1PLU, 10 minutes; Swimming lane 4=1PLU, 60 minutes; Swimming lane 5=1PLU, 180 minutes; Swimming lane 6=1PLU, 220 minutes; Swimming lane 7=1PLU, 1200 minutes; Swimming lane 8=contrast, 1200 minutes; Swimming lane 9=glucose ester; Swimming lane 10=cholesterol; Swimming lane 11=glucose;

Figure 70 is presented at the reaction of DGDG and glucose under the acyltransferase catalysis.

Figure 71 is presented at the aminoacid sequence (SEQ ID No.36) that is used for mutagenesis Aeromonas hydrophila acyltransferase gene Fusion construct in the example 17, and underlined amino acid is the zytase signal peptide;

Figure 72 code displaying derives from the nucleotide sequence (SEQ ID No.45) of the enzyme that contains the zytase signal peptide of Aeromonas hydrophila; And

Chromatographic sheet shown in Figure 73 clearly shows the generation of plant sterol ester and monoglyceride.Swimming lane 1 is to react after 1 hour, and swimming lane 2 is to react after 4 hours, and swimming lane 3 is to react after 24 hours, and swimming lane 4 is plant sterols.

Embodiment

Except pointed, implement TLC according to the description among the embodiment 6 and analyze, and the GLC analysis implemented in the description in embodiment 11.

Embodiment 1: derive from aeromonas salmonicida and kill salmon subspecies (Aeromonas salmonicida The clone of transferring enzyme subsp.Salmonicida), sequencing and heterology are expressed.

Used bacterial strain:

Aeromonas salmonicida kills salmon subspecies (ATCC 14174) available from ATCC, grow overnight in 30 ℃, Luria-Bertani substratum (LB).Carry out centrifugal and with the genomic dna separation method isolation of genomic DNA of Qiagen Ltd. to described cell.Genomic dna damping fluid group (cat.19060), protein kinase K (cat.19131) and RNAse A (cat.19101) are all available from Qiagen.Ltd (Boundarycourt Gatwick Court, West Sussex, RH10 2AX).

Host strain BL21 (DE3) pLysS (Novagen) is used to produce recombinant gas zygosaccharomyces enzyme.The competent cell of BL21 (DE3) pLysS is as using expression vector pet12-AsalGCAT=pSM host transformed.The transformant that comprises suitable plasmid 37 ℃, contain in the LB nutrient agar of every milliliter of 100-μ g Ampicillin Trihydrate and grow.

The structure of expression vector pet12-AsalGCAT-pSM:

For all DNA cloning from the transferase gene of Aeromonas, with genomic dna (0.2-1 μ l) as template, pfu archaeal dna polymerase (2.5 unit) and 10 μ l, 10 * pfu damping fluid, be each primer (50pmol/ μ l) of 1 μ l, 200 μ M dNTP use in the total reaction volume of 100 μ l together.PCR is reflected at and utilizes following condition to carry out in the program-controlled thermal cycler: kept 30 seconds for 95 ℃, with 95 ℃ 30 seconds, 60 ℃ 1 minute, 68 ℃ circulations in 2 minutes 30 times.72 ℃ were extended 5 minutes again.

Pcr amplification from the transferase gene of aeromonas salmonicida is undertaken by two isolating PCR reactions.PCR reaction 1 uses following primer to implementing: aslUSNEW (5 ' AGCATATGAAAAAATGGTTTGT TTGTTTATTG GGG 3 ' [SEQ ID No.36]) and asls950new (5 ' GTG ATG GTG GGC GAG GAA CTC GTA CTG3 ' [SEQ ID No.37]).Implement PCR reaction for the second time to mix the terminal histidine mark of C-, described reaction uses the PCR product and the following primer of first set reaction to carry out: aslUSNEW (5 ' AGCATATGAAAA AATGGTTTGTTTGTTTATTG GGG 3 ' [SEQ ID No.38]) and AHLS1001 (5 ' TTGGATCCGAATTCAT CAATG GTG ATG GTG ATG GTG GGC3 ' [SEQ ID No.39]).The PCR product that purifying reacts for the second time also utilizes restriction enzyme Ndel and BamHI digestion.2 μ gpET 12a carrier DNAs are handled through restriction enzyme Ndel and BamHI digestion and with Phosphoric acid esterase equally.The pET 12a that restriction enzyme is handled is purified with the PCR product of reaction 2, and (Roche Switzerland) connects with connecting test kit (Rapid Ligation Kit) fast.Connect mixture and be used for transformed into escherichia coli TOP10 cell.Transformant is layered on the LB nutrient agar that contains 100 μ g/ml Ampicillin Trihydrates.

The sequence and the direction of the transferase gene that T7 promoter primer (5 ' TAATACGACTCACTATAG3 ' [SEQ ID No.40]) and T7 terminator primer (5 ' CTAGTTATTGCTCAGCGG3 ' [SEQ ID No.41]) are used for verifying that the pET12a carrier is cloned.With ABI Prism  BigDye ^TMTerminator cycle sequencing test kit (Terminators Cycle sequencing kit), as template, and 3.2pmol T7 promotor and terminator primer are implemented determined dna sequence with the 500ng plasmid DNA.

Construct shown in Figure 35 is used for transformed competence colibacillus bacterial host strains BL21 (DE3) pLysS (Novagen) and can selects Ampicillin Trihydrate resistance transformant being used for expression analysis.

The expression of reorganization aeromonas salmonicida acyltransferase

With non-esterified lipid acid (Non-Esterified Fatty Acid) (NEFA) test kit (Roche, Switzerland) in cell extract quantitatively for the enzymic activity of Yelkin TTS.

In Figure 36, BL21 (DE3) pLysS that comprises expression vector pet12-AsalGCAT-pSM grows in LB substratum+100 μ g/ml Ampicillin Trihydrates, and 37 ℃ of vibration insulations are up to OD ₆₀₀=0.6 to 1.0.Induce described culture with IPTG (0.4mM), be incubated 3 hours again.IPTG induces sample thief after 0,1,2 and 3 hour.Detect enzymic activity as substrate with the NEFA test kit with Yelkin TTS.

Be used to prepare the growth optimization of the stronger enzyme of activity

BL21 (DE3) pLysS that comprises expression vector pet12-AsalGCAT-pSM grows in LB substratum+100 μ g/ml Ampicillin Trihydrates, insulation under different growth temperatures (37 ℃, 30 ℃, 20 ℃), oscillating condition.The optimum condition that produces active acyltransferase is when culture is 30 ℃ of growths as shown in figure 37.

The partial purification of reorganization aeromonas salmonicida transferring enzyme

Bacterial strain BL21 (DE3) pLysS that comprises expression vector pet12-AsalGCAT-pSM is 37 ℃ of growths, by supersound process (sonification) preparation cell crude extract.Recombinant enzyme is further purified from the cell crude extract through supersound process with Ni-NTA spin (spin) test kit of Qiagen.Use the NEFA test kit and measure phospholipase activity as substrate with Yelkin TTS.Cell crude extract and substrate Yelkin TTS from BL21 (DE3) pLysS of expression activity transferring enzyme together are incubated, and use the tlc analyze reaction mixture, show exist (referring to Figure 38) of degraded product.

The partial purification of reorganization aeromonas salmonicida transferring enzyme

Bacterial strain BL21 (DE3) pLysS that comprises expression vector pet12-AsalGCAT-pSM prepares cell crude extract 37 ℃ of growths by supersound process.Recombinase is further purified from the cell crude extract after supersound process with the Ni-NTA spin test kit of Qiagen.Use the NEFA test kit and measure phospholipase activity (referring to Figure 39) as substrate with Yelkin TTS.

The cloning and expression of embodiment 2 Aeromonas hydrophila transferring enzymes in intestinal bacteria

From the Aeromonas hydrophila (ATCC#7965) that ATCC obtains, 30 ℃, the middle incubated overnight of Luria-Bertani substratum (LB).Eccentric cell is also used the genomic dna separation method isolation of genomic DNA (genomic DNA) of QiagenLtd..Genomic dna damping fluid group (cat.19060), protein kinase K (cat.19131) and RNAse A (cat.19101) all come from Qiagen Ltd. (Boundarycourt Gatwick Court, West Sussex, RH10 2AX).

Host bacteria bacterial strain BL21 (DE3) pLysS (Novagen) is used to prepare recombinant gas zygosaccharomyces enzyme.The competent cell of BL21 (DE3) pLysS is as using expression vector pet12a-A.h.GCAT-pSMa host transformed.The transformant that comprises suitable plasmid is in the LB nutrient agar that contains every milliliter of 100-μ g Ampicillin Trihydrate, in 37 ℃ of growths.

The structure of expression vector pet12a-A.h.GCAT-pSMa:

For all DNA cloning from the transferase gene of Aeromonas, with genomic dna (0.2-1 μ l) as template, pfu archaeal dna polymerase (2.5 unit) and 10 μ l, 10 * pfu damping fluid, be each primer (50pmol/ μ l) of 1 μ l, 200 μ M dNTP use in the total reaction volume of 100 μ l together.PCR is reflected at and utilizes following condition to carry out in the program-controlled thermal cycler: kept 30 seconds for 95 ℃, with 95 ℃ 30 seconds, 60 ℃ 1 minute, 68 ℃ circulations in 2 minutes 30 times.72 ℃ were extended 5 minutes again.

Pcr amplification from the transferase gene of Aeromonas hydrophila (ATCC#7965) is undertaken by two isolating PCR reactions.

PCR reaction 1 uses following primer to carrying out: AHUS1 (5 ' GTCATATGAAAAAATGGTTTGTGTGTTTATTGGGATTGGTC3 ', SEQID No.42) and ahls950 (5 ' ATGGIGAIGGTGGGCGAGGAACTCGTACTG3 ', SEQ ID No.43).

Implement PCR reaction for the second time to mix the terminal histidine mark of C-, described reaction uses the PCR product and the following primer of first set reaction to carry out: AHUS1 (5 ' GTCATATGAAAAAATGGTTTGTGTGTTTATTGGGATTGGTC3 ' SEQ ID No. 44) and AHLS1001 (5 ' TTGGATCCGAATTCATCAATGGTGATGGTGATGGTGGGC3 ' SEQ ID No.45).

The PCR product that purifying reacts for the second time also utilizes restriction enzyme Ndel and BamHI digestion.2 μ g pET 12a carrier DNAs are handled through restriction enzyme Ndel and BanHI digestion and with Phosphoric acid esterase equally.The pET 12a that restriction enzyme is handled is purified with the PCR product of reaction 2, and (Roche Switzerland) connects with connecting test kit (Rapid Ligation Kit) fast.Connect mixture and be used for transformed into escherichia coli TOP10 cell.Transformant is layered on the LB nutrient agar that contains 100 μ g/ml Ampicillin Trihydrates.

T7 promoter primer (5 ' TAATACGACTCACTATAG3 ') and T7 terminator primer (5 ' CTAGTTATTGCTCAGCGG3 ') are used for verifying sequence and the direction of pET12a GCAT that carrier is cloned.With ABI Prism  BigDye ^TMTerminator cycle sequencing test kit (TerminatorsCycle sequencing kit), as template, and 3.2pmol T7 promotor and terminator primer are implemented determined dna sequence with the 500ng plasmid DNA.

Construct shown in Figure 40 is used for transformed competence colibacillus bacterial host strains BL21 (DE3) pLysS (Novagen), and can select Ampicillin Trihydrate resistance transformant and be used for expression analysis.

The expression of Aeromonas hydrophila transferring enzyme in BL21 (DE3) pLysS

Coli strain BL21 (DE3) pLysS that comprises expression vector pet12a-A.h.GCAT=pSMa grows in LB substratum+100 μ g/ml Ampicillin Trihydrates, and 37 ℃ of vibration insulations are up to OD ₆₀₀=0.6 to 1.0.Induce described culture with IPTG (0.4mM), be incubated 3 hours again.IPTG induces sample thief after 0,1,2 and 3 hour.Detect enzymic activity (Figure 41) as substrate with the NEFA test kit with Yelkin TTS.

Be used to prepare the growth optimization of the stronger enzyme of activity

BL21 (DE3) pLysS that comprises expression vector pet12a-A.h.GCAT-pSMa grows in LB substratum+100 μ g/ml Ampicillin Trihydrates, insulation under different growth temperatures (37 ℃, 30 ℃, 20 ℃), oscillating condition.The optimum condition that produces active acyltransferase is when culture is 30 ℃ of growths as shown in figure 42.

The partial purification of reorganization Aeromonas hydrophila transferring enzyme (GCAT)

Bacterial strain BL21 (DE3) pLysS that comprises expression vector pet12a-A.h.GCAT-pSMa prepares cell crude extract in 37 ℃ of growths 0 by supersound process.Recombinant enzyme is further purified from the cell crude extract through supersound process with Ni-NTA spin (spin) test kit of Qiagen.Use the NEFA test kit and measure phospholipase activity (Figure 43) as substrate with Yelkin TTS.

Embodiment 3: the Aeromonas transferring enzyme is in subtilis (Bacillus subtilis) 163 Expression

Plasmid construction

Two kinds of different subtilis expression vectors (pUB 110 ﹠amp; PBE5) be used for the heterogenous expression of Aeromonas gene subtilis.PUB 110 carriers comprise the αDian Fenmei promotor and the pBE carrier contains the P32 promotor as the Aeromonas expression of gene regulatory region that merges.In pUB110 last amino acid of first amino acid of the ripe GCAT gene of 0 Aeromonas and the zytase signal peptide of subtilis by at restriction site Nhe1 at the frame endomixis, two extra amino acid of generation before maturation protein.PBE5 contains the cgtase signal sequence 0 that merges in the Nco1 site makes recombinant protein be secreted into the cultivation filtrate.

Implement the Aeromonas gene of the signal sequence frame endomixis of PCR reaction acquisition and pUB 110 and pBE5 carrier.With following pairing primer the Aeromonas hydrophila gene is carried out PCR.

PCR reaction 1:usAHncol (5 ' ATGCCATGGCCGACAGCCGTCCCGCC3 ', SEQ ID No.46) and lsAH (5 ' TTGGATCCGAATTCATCAATGGTGATG3 ', SEQID No.47)

PCR reaction 2:US-AhnheI (5 ' TTGCTAGCGCCGACAGCCGTCCCGCC3 ', SEQ ID No.48.) and lsAH (5 ' TTGGATCCGAATTCATCAATGGTGATG3, SEQID No.49)

With following pairing primer the aeromonas salmonicida gene is carried out PCR.

PCR reaction 3:US-Asncol (5 ' TTGCCATGGCCGACACTCGCCCCGCC3 ', SEQ ID No.50) and lsAH (5 ' TTGGATCCGAATTCATCAATGGTGATG3 ', SEQID No.51)

PCR reaction 4:US-ASnhel (5 ' TTGCTAGCGCCGACACTCGCCCCGCC3 ', SEQ ID No.52) and lsAH (5 ' TTGGATCCGAATTCATCAATGGTGATG3 ', SEQID No.53)

All the PCR product cloning is also used oppositely or the order-checking of forward sequencing primer in PCR blunt II (TOPO carrier).

Clone from PCR reaction 1 and 3 cuts with Ncol and Bam HI, is connected as the pBE5 carrier of inset with the cutting of Nco1/BamH1/ Phosphoric acid esterase.Clone from PCR reaction 2 and 4 cuts with Nhe1 and BamH1, is connected as the pUB carrier of inset with the cutting of Nhe1/BamH1/ Phosphoric acid esterase.

The activity characterization of the expression of Aeromonas transferase gene and described enzyme in the subtilis.

From the acyltransferase of two kinds of Aeromonas kinds successfully expression in escherichia coli (result as above).Genus bacillus pUB 110 and pBE5 gene fusion construct are used for transforming subtilis, and select transformant by being layered on the kantlex plate.Kalamycin resistance through separating and growing in 2xYT transforms physical efficiency heterogenous expression Aeromonas gene in subtilis.Cultivate filtrate except that having acyltransferase and phospholipase activity, also have (DGDG) galactolipid enzymic activity of digalactosyl diacylglycerol (digalactosyldiacylglycerol).At the activity of digalactosyl diacylglycerol (DGDG) supernatant liquor and substrate insulation were measured after 60 minutes, in Figure 44, shown from the DGDG (from Sigma) of wheat-flour and at the activity of Yelkin TTS.Genus bacillus overnight incubation (20-24 hour) in substratum produced as secreted protein after 48 hours.In some cases, the Aeromonas expression of gene influences cell viability and the growth in genus bacillus and the intestinal bacteria, therefore is necessary carefully to select expression strain and optimizes growth conditions to guarantee expression.For example, several genus bacillus host strains (B.s 163, DB104 and OS 21) transform with expression vector and are used for growth fraction.B.s163 can and have the proteic ability of expression activity by two kinds of Aeromonas gene transformation.DB104 can transform with all constructs but have only the ability of expressing the aeromonas salmonicida transferring enzyme.

Embodiment 4: the fermentation and the purifying of the Aeromonas acyltransferase that produces in the intestinal bacteriaEscherichia coli fermentation:

Microorganism

Use colibacillary two bacterial strains in this research, one comprises Aeromonas hydrophila (implementing 2) acyltransferase and other aeromonas salmonicida (embodiment 1) acyltransferase that comprises.

The coli strain called after DIDK0124 that comprises the Aeromonas hydrophila gene comprises the coli strain called after DIDK0125 of aeromonas salmonicida gene.The fermented product called after SAL0302 of the fermented product called after HYDRO0303 of DIDK0124 and DIDK0125.Protein called after REF#138 from the HYDRO025 purifying.Albumen called after REF#135 from the HYDRO0303 purifying.

Growth medium and culture condition

LB-agar

The LB-agar plate that is used to keep bacterial strain comprises: 10g/L Tryptones, 5g/L yeast extract, 5g/LNaCl, 15g/L agar, 100mg/L Ampicillin Trihydrate and 35mg/L paraxin.Agar plate is 30 ℃ of insulations.

LB shakes bottle

Being used to produce bioreacter cultivates LB substratum with the inoculum raw material (50mL pr shake bottle) and comprising: the 10g/L Tryptones, the 5g/L yeast extract, 5g/L NaCl, 100mg/L Ampicillin Trihydrate (ampicillin) and 35mg/L paraxin (chloramphenicol).Shake bottle and inoculate, 30 ℃, 200rpm insulation with LB agar plate culture.

The cultivation of bioreacter

Bioreacter is cultivated in inner (in-built) bio-reactor built of 6L and is carried out, and is full of the 4L substratum that contains following material in the described bio-reactor: 10g/L Tryptones, 5g/L yeast extract, 5g/L NaCl, 8g/L KH ₂PO ₄, 0.9g/L MgSO ₄, 7H ₂O, 40g/L Glucose monohydrate, 0.4mL/ADD APT  Foamstop Sin 260 (ADD APT Chemicals AG, Helmond, The Netherlands), 10mg/L (NH ₄) ₂Fe (SO ₄) ₂6H ₂O, 0.7mg/LCuSO ₄5H ₂O, 3mg/L ZnSO ₄7H ₂O, 3mg/L MnSO ₄H ₂O, 10mg/L EDTA, 0.1mg/L NiSO ₄6H ₂O, 0.1mg/L CoCl ₂, 0.1mg/LH ₃BO ₄, 0.1mg/L KI, 0.1mg/L Na ₂MoO ₄2H ₂O, 1g/L Ampicillin Trihydrate and 35mg/L paraxin.

A certain amount of LB substratum of inoculation guarantees that growth terminal point after cultivating in about 20 hours is (by following calculation of parameter: maximum specific growth rate 0.6h in bio-reactor ^-1, LB shakes the OD of bottle ₆₀₀With the whole last OD of bio-reactor ₆₀₀, it is about 20).

SAL0302 has inoculated the LB substratum of 10mL, and HYDR00303 has inoculated the LB substratum of 4mL.

Bio-reactor is operated under following condition: 30 ℃ of temperature, stir 800-1000rpm (according to experiment), and ventilation 5L/min, pH6.9, pH controls 8.75% (w/v) NH ₃-water and 2M H ₂SO ₄Add isopropyl ss-D-sulphur galactoside (thiogalactoside) to end level 0.6mM, induce and finish, produce 0.4 mole (HYDR00303) and 0.7 mole of CO respectively ₂

Results

Following operation steps is used for the results and the homogenate of biomass:

1) centrifugal from the fermenting broth of fermentation at 5000 * g, placed abandoning supernatant 10 minutes for 4 ℃.Described biomass are placed with preceding-20 ℃ and are preserved.Melt described biomass and at 500mL 20mMNaH ₂PO ₄, pH7.4,500mM NaCl, the 10mM imidazoles and fully (no EDTA) proteinase inhibitor (Roche, resuspended in Germany).

2) biomass of Xuan Fuing are at 2kbar, and 4 ℃, from (the homogenate among the Warwick, cell rupture instrument UK) (cell disrupter) of Constant Systems company.

3) cell debris was placed 30 minutes for 4 ℃ in the centrifugal removal of 10.000 * g, collected supernatant liquor.

4) clarificationization was placed 60 minutes for 4 ℃ in that 13.700 * g is centrifugal to make supernatant liquor, collected supernatant.

5) (Pall LifeSciences UK) filters described supernatant liquor, collects filtrate chromatography purification immediately by 0.2 μ m Vac Cap strainer.

The chromatography purification of transferring enzyme

With the gel-filled post of 50ml chelating type agarose ff. (2.5 * 10cm), and with nickel-vitriol charging (charged with) (according to described method of manufacturer Amersham Biosciences).With 200ml 20mM NaH ₂PO ₄, pH7.4,500mM NaCl, 10mM imidazoles balance columns, with the 400ml crude extract with the flow velocity application of sample of 5ml/min in post.Use 20mM NaH ₂PO ₄, pH7.4,500mM NaCl, the 10mM imidazoles is washed post up to UV ₂₈₀Reach baseline, use 40ml 20mM NaH then ₂PO ₄, pH7.4,500mM NaCl, 500mM imidazoles wash-out GCAT.

Embodiment 5: the fermentation of the Aeromonas acyltransferase that produces in the subtilis with Purifying

Fermentation

BAC0318-19，BAC0323-24

Microorganism

Usedly in this research microbe-derivedly insert in the pUB110OIS carrier in containing, the plasmid of the gene of coding aeromonas salmonicida transferring enzyme is to the conversion of subtilis host strain #163.This expression of gene is controlled by the αDian Fenmei promotor, and the secretion of transferring enzyme is by subtilis zytase signal sequence mediation (embodiment 3).Bacterial strain called after DIDK0138 (fermentation BAC0318-19) and DIDK0153 (fermentation BAC0323-24).

Growth medium and culture condition

Pre-culture medium

Shake adding 100mL substratum in the bottle (cubic capacity 500mL has dividing plate), described substratum comprises:

NaCl 5g/L

K ₂HPO ₄ 10g/L

Soyflour 20g/L

Yeast extract, BioSpringer106 20g/L

Defoamer, SIN260 5mL/L

PH adjusts to 7.0 before the autoclaving

Shake interpolation 6mL 50% (w/w) Nutriose in the bottle to each behind the autoclaving.And behind autoclaving, add the kantlex of concentration 50mg/L.

Inoculation

The pre-cultivation shaken bottle with directly from the freezing culture inoculation of 25% (w/v) glycerine storage liquid.Shake bottle and be incubated about 16 hours, get 50mL inoculation fermentation jar at 33 ℃, 175rpm.

Fermentation

Fermentation is carried out in the inner fermentor tank of building of 6L.

Fermention medium (batch medium) (3L) comprising in batch:

Corn steep liquor (50%dw) 40g/L

Yeast extract BioSpringer153 (50%dw) 10g/L

NaCl 5g/L

CaCl ₂，2H ₂O 0.25g/L

Mn(NO ₃) ₂，H ₂O 0.2g/L

Defoamer SIN260 1mL/L

Kantlex (after filtering sterilising treatment, adding autoclaved fermentor tank) 50mg/L

Charging (feed) comprising:

Glucose monohydrate 540g/kg

MgSO ₄，7H ₂O 4.8g/kg

Defoamer SIN260 4mL/kg

Yeast extract, BioSpringer 153 (50%dw) 150g/kg

(autoclaving respectively)

According to following equation, the charging among fermentation BAC0318 and the BAC0323 is based on the CO that accumulates ₂Beginning:

Input rate-flow rate (flow) [g/h]=0, AcCO ₂＜0.15

Input rate-flow rate [g/h]=2.85+t1.54, AcCO ₂〉=0.15 and t＜12

Input rate-flow rate [g/h]=21.3, t＞12

T: from the CO that accumulates ₂(AcCO ₂) reach the time that 0.15 mole point begins (hour).

According to following equation, the charging among fermentation BAC0319 and the BAC0324 is based on the CO that accumulates ₂Beginning:

Input rate-flow rate [g/h]=0, AcCO ₂＜0.15

Input rate-flow rate [g/h]=2.0+t1.08, AcCO ₂〉=0.15 and t＜12

Input rate-flow rate [g/h]=15, t＞12

T: from the CO that accumulates ₂(AcCO ₂) reach the time that 0.15 mole point begins (hour).

Adding 12.5% (w/v) ammoniacal liquor or 2M phosphoric acid makes the pH value be controlled at 7.0.

Air flow is the corresponding 1vvm of 3L/min.

33 ℃ of temperature.

Fermentor tank is equipped with two 8cm  Rushton at a distance of 10cm to elect device (impeller).

Results

At room temperature 16,000 * g centrifugal 10 minutes, remove biomass.Supernatant liquor is sterilized after filtration, and filtrate is used for purifying and application test.

Embodiment 6: the application test in the yolk

In following experiment, at transferring enzyme expression in escherichia coli, that separate suicide salmon Aeromonas only in yolk and added in the yolk of plant sterol and detect.

Material:

Transferring enzyme from aeromonas salmonicida REF#138

Yolk: from fresh ovum (hen egg)

Plant sterol: β-Gu Zaichun, Sigma S 5753

TLC plate: silica plate Merck nr.1.05715.0001

TLC analyzes

The TLC-plate is placed half an hour in heating container (110 ℃), makes it activation

The 100ml developping agent is poured into the chromatography cell of adding a cover.The wall of cell is covered with filter paper (Whatman 2) makes this cell be unfolded the agent vapo(u)rous.

The TLC plate is put in the support, and sample is added on the TLC plate of bottom 2cm.The TLC plate is put into the TLC cell of developping agent.When developping agent during apart from plate bottom 14cm, take out the TLC plate, it is dry to place evaporation plate (fume board) to go up, and places heating container (heat board) (110 ℃) then 10 minutes.

The TLC plate is immersed launch in the reagent, drying is 15 minutes in heating container (110 ℃).

Developping agent:

Nr.IV: chloroform: methyl alcohol: water (65: 25: 4)

Nr.I:P-ether: MTBE: acetate (60: 40: 1)

Launch damping fluid (vanadate-damping fluid):

32gNa ₂CO ₃?ad?300ml?H ₂O(1M)

Add 18.2g Vanadium Pentoxide in FLAKES (V ₂O ₅) the low-grade fever dissolving.

Solution is cooled to envrionment temperature.

The careful 460ml 2.5M H that adds ₂SO ₄. (460ml H ₂O+61ml H ₂SO ₄)

Add water to 1000ml.

Phospholipase activity

Substrate:

0.6%L-α phosphatidylcholine 95% plant (Avanti#441601)+0.4% Chuan-X100 (SigmaX-100)+5mM CaCl ₂Be dissolved in the 0.05M HEPES damping fluid of pH7.

Step

400 μ l substrates are added to 1.5ml Eppendorf pipe, place the hot mixing tank of Eppendorf (thermomixer), 30 ℃, 5 minutes.

Time T=0 o'clock adds 50 μ l enzyme solution.The blank that contains water rather than enzyme is analyzed.

On the hot mixing tank of Eppendorf, mixed described sample 10 minutes with 1000rpm in 30 ℃.During time T=10 minute, the Eppendorf pipe is placed another hot mixing tank, at 99 ℃, 10 minutes to finish reaction.

Free lipid acid uses the NEFA test kit of WAKO GmbH to analyze in the sample.

Under the condition determination, enzymic activity PLU-7pH7 calculates with micromole's lipid acid that per minute produces.

Lipid extracts

1g yolk and 7.5ml chloroform: methyl alcohol among Whirleys mixes at 2: 1, with 750 * g centrifugal 10 minutes.

Separate 3ml chloroform phase, be used for further lipid analysis.

The result:

With above-mentioned methods analyst expression in escherichia coli, from the phospholipase activity of the transferring enzyme (REF#138) of aeromonas salmonicida, and in being with or without the yolk of β-Gu Zaichun, detect.The magnetic stirrer of sample described in the reaction process.Experimental design such as table 1.

Table 1

Measure	37 ℃ reaction times	Yolk	Sitosterol	Transferring enzyme #138
					Sequence number	Minute	Gram	Milligram	Unit
1	30	1	40
					2	30	1	40	0,75PLU
3	30	1	80	0,75PLU
					4	120	1	40	0,75PLU
5	120	1	80	0,75PLU
					6	300	1	40	0,75PLU
8	300	1	40

Add the 7.5ml chloroform: methyl alcohol (2: 1) also mixes 30 seconds termination reactions on the Whirley mixing tank.Centrifugation chloroform phase arrives activatory silicon-dioxide TLC plate in advance with the chloroform phase transition of 2 μ l, TLC plate developping agent nr.I wash-out, another TLC plate wash-out in developping agent IV.

Figure 45 and 46 shows the TLC analytical results.

Be used to commit suiside transferring enzyme, the transferring enzyme reaction descriptions in the yolk that adds plant sterol of salmon Aeromonas, this enzyme is transferred to cholesterol with lipid acid from the Yelkin TTS of yolk in the cholesteryl ester forming process.The TLC tomographic map shows that also the part sterol that is added in the yolk is transferred to sterol ester.

The available HPLC of amount of the sterol ester relevant with the amount of formation cholesteryl ester or GLC analyze in reaction process.

Existing plant sterols ester can reduce the absorption of enteron aisle to cholesterol.Show also in the document that enteron aisle is less than absorption to free cholesterol to the absorption of cholesteryl ester.When adding transferring enzyme and plant sterol to yolk, can obtain reducing the product of cholesterol absorption, produce the lysolecithin that can improve the yolk emulsifying property simultaneously.The further advantage of adding transferring enzyme and plant sterol in yolk is that the cholesterol of plant sterol ester and natural acquisition together is ingested, and expects that this has the cholesterol absorption of making and reduces maximum effect.

Embodiment 7: the modification of yolk during from the acyltransferase of aeromonas salmonicida

According to the present invention, now shown and used transferring enzyme might from yolk, produce lysolecithin and not form lipid acid basically.

Lecithin content in the yolk is a kind of important emulsifying agent of preparation mayonnaise, but limitation is that the gained mayonnaise is to thermally labile.Therefore in the past few years people known to use Phospholipid hydrolase that pancreas gets that the Yelkin TTS of yolk is modified to a kind of stronger emulsifying agent be haemolysis Yelkin TTS.In the mayonnaise production process, help to improve the thermostability of mayonnaise when the pasteurization with the yolk of enzyme modification.Use the limitation of pancreas Phospholipid hydrolase to be that free fatty acids quantity also increases in yolk, this causes the decline of resistance of oxidation, because free fatty acids is easier to oxidized than its corresponding esters.Free fatty acids also may cause the appearance of soap taste (soapy-off taste).

As described in embodiment 5,,, be used for modifying egg-yolk lipids by the liquid chromatography (LC) purifying from the transferring enzyme of aeromonas salmonicida successful expression and in laboratory scope, fermenting in subtilis.Be used for the production of thermally-stabilised mayonnaise through the yolk of enzyme modification.

Can in yolk, produce lysolecithin and cholesteryl ester from the transferring enzyme of aeromonas salmonicida and do not produce a large amount of free fatty acidies.Do not increase or do not increase substantially the free fatty acids in the food in other words.

Yolk through enzyme modification shows the emulsifying agent characteristic of improving and can be used for heat-staple production.

Enzyme by the lipid shift reaction (Figure 47) between catalysis Yelkin TTS and cholesterol show to yolk modify high functionalized.

This research has further been studied transferring enzyme to purposes in the modification of yolk and the modified purposes of yolk in thermally-stabilised production.

Present embodiment has been described the fermentation of transferring enzyme, separates and the application in yolk and through the application of yolk in thermally-stabilised production of enzyme modification.The present embodiment separated into two parts:

A. the application of transferring enzyme in yolk

B. in mayonnaise, detect yolk through enzyme modification

Experiment

A. use

Enzyme-to-substrate

From the transferring enzyme #178-9 of aeromonas salmonicida, purifying 2554-100C73,15PLU-7/ml

From the transferring enzyme #179 of aeromonas salmonicida, 18.5PLU-7/ml

Phospholipase A1 LECITASE ^TMMltra (Novozymes A/S, Denamrk)

Yolk: contain the liquid-type yolk of 8% salt, SANOVAFOODS, DK

TLC analyzes by preceding method and implements (seeing front embodiment 6)

Phospholipase activity: see before and state embodiment.

Lipid extracts

1g yolk and 7.5ml chloroform: methyl alcohol 2: 1 mixed 30 seconds in Whirley, with 750 * g centrifugal 10 minutes.

Separate the 4mi chloroform and be used for further lipid analysis mutually.

Oxidative stability detects

The oxidative stability of mayonnaise is measured in ML OXIPRESS instrument, and wherein said sample stands oxidative stress by the heating in oxygen atmosphere, under the pressurized conditions.

Through being known as after for some time of inductive phase (IP), the oxidation of sample causes certain oxygen depletion, is recorded as pressure change by pressure transmitter.Inductive phase, the high more oxidative stability that shows was good more.

Operation steps

5 gram mayonnaise are put in the Glass Containers and Glass Containers seals with pressure transmitter.This container is full of 5 crust (bar) oxygen.Open the valve emptying receptacles.This operation repeats twice and sample and 5 environment that cling to oxygen is placed 80 ℃.Oxygen presses the function of the time that is measured as and inductive phase (IP) hour to calculate.

The result

Purified transferring enzyme sample #179 and #178-9 from aeromonas salmonicida are used to handle yolk, and be as shown in table 2.Primary detection shows, what Phospholipid hydrolase (PLU) activity of the GCAT transferring enzyme of adding should be with than commodity Phospholipid hydrolase is active much lower.Reason is that GCAT is a transferring enzyme, therefore has the hydrolytic activity that many lower than common Phospholipid hydrolase.

Table 2

	Sanofo yolk 8% salt	2344-44 C89?18.5 PLU-7/ml	Transferring enzyme #178-9	#3108， Lecitase Mltra	Water
							Sequence number	Yolk	Transferring enzyme #179	18.5 PLU-7/ml	1500PLU- 7/ml 7/ml
	Gram	Gram	Gram	Milliliter	Gram	PLU-7/ml
							6	120	2.00			8.00	0.31
7	120		10		0	1.25
							8	120			1.86	8.14	23.25
9	120				10	0

In proportion yolk and enzyme are put in that (scaling the egg yolk and the enzyme in abeaker) carries out enzymatic reaction in the beaker.Sample places heating container, 37 ℃, stirring at a slow speed.React after 1,2 and 4 hour, sample thief is TLC and is analyzed.React after 4 hours, described product is kept at 5 ℃ in order to mayonnaise experiment use.

The TLC of the lipid that extracts from the yolk of handling through enzyme analyzes as shown in figure 48.

TLC shown in Figure 48 analyzes and shows that Phospholipid hydrolase #3108 in forming the free fatty acids process, also has some monoglycerides and triglyceride to have tangible hydrolytic action for triglyceride level.As if Phospholipid hydrolase #3108 do not have influence to cholesterol.Two transferring enzyme samples are all facilitated the formation of cholesteryl ester and significantly with the decline of cholesterol level.

The yolk through enzyme modification of D in mayonnaise

Be the effect of mentioning in the research table 2, carry out application experiment with the mayonnaise that contains 50% fat to the modification of yolk sample.Also produce the mayonnaise that contains undressed yolk.

Research purpose is clearly to through the emulsification property of the yolk of enzyme modification and the influence of thermostability.All the mayonnaise sample contains identical oil level and has only yolk emulsified (emulsified with only eggyolk).All the mayonnaise sample is heated to 95 ℃ and kept 5 minutes with KoruMa mixer (Disho V60/10) preparation in the preparation process.

Mayonnaise sample (Figure 49) by the yolk preparation of handling through enzyme is of close texture evenly no separating of oil.Control sample separates with aqueous phase at oil.

Measure with MalvernMastersizer by the olesome size in the mayonnaise sample of the yolk preparation of handling through enzyme.Sample mixes in the 0.1M of pH7 phosphate buffered saline buffer with 0.1%SDS before measuring.Reading is all the particulate size averages shown in the table 3.

Table 3

Experiment

Enzyme

The granular size average, μ m

6	Transferring enzyme #179,0.31PLU-7/g	12.9
			7	Transferring enzyme #178-9,1.25PLU-7/g	7.2
8	#3108.Lecitase Mltra (Lecithase lecithinase), 23 PLU-7/g	5.2

The granular size measuring result has clearly illustrated the effect from the transferring enzyme dosage increase of aeromonas salmonicida.Use heavy dose of transferring enzyme, granular size is approximate with the particle of the mayonnaise for preparing with Lecitase Mltra.But what should sincerely remember is that Lecitase Mltra produces abundant fatty acid, facilitates the distribution of fine particle.

Utilize the oil droplet size of the prepared mayonnaise of enzyme to be significantly less than the oil droplet size of the mayonnaise (promptly contrasting mayonnaise) that does not utilize enzyme prepared.

Oxidative stability

Mayonnaise sample 7 and 8 oxidative stability are analyzed with ML OXIPRES, and analytical results is as shown in table 4.

Table 4

Sample	Induce period	Induce period
				1. measure hour	2. measure hour
7	37.44	38.08
			8	35.68	35.52

The mensuration explanation antioxidative stabilizer of oxidative stability has significant difference.The mayonnaise that the yolk that the mayonnaise that the yolk that transferring enzyme 179-8 handles is made is handled than Lecitase Mltra is made has better antioxidative stabilizer.This is that these free fatty acidies are easier to be oxidized to corresponding fatty acid ester because Lecitase Mltra produces more free fatty acids.

Be used for the yolk sample chloroform extraction that mayonnaise is produced, the lipid in the yolk is analyzed with GLC, the results are shown in Table 5.

Table 5

Experiment	Enzyme	Lipid acid	Cholesterol	Cholesteryl ester	Triglyceride level
							6	Transferring enzyme #179	0.96	0.94	0.49	23.95
7	Transferring enzyme # 178-9	1.84	0.60	1.06	24.54
						8	#3108， Lecitase?Mltra	14.05	1.16	0.12	2.45
9	Contrast	0.48	1.16	0.13	22.87

GLC result in the table 5 has confirmed the result that TLC analyzes, and Lecitase Mltra can produce very a large amount of free fatty acidies and most triglyceride level is hydrolyzed.On the other hand, transferring enzyme only produces an amount of free fatty acids and triglyceride level is not hydrolyzed.Clearly illustrate that equally transferring enzyme produces cholesteryl ester from cholesterol.

The PC amount that presentation of results " is handled through enzyme " in the mayonnaise is less than the contrast mayonnaise, and the LPC amount of while through the mayonnaise that enzyme is handled is higher than the contrast mayonnaise.LPC amount raises and can explain well that the mayonnaise of handling through enzyme compares with the contrast mayonnaise, the former emulsifying effect enhanced reason.HPLC and GLC and show that also the free cholesterol level comparison of the mayonnaise of handling through enzyme is low according to the free cholesterol level of mayonnaise, may be because in the transferring enzyme reaction, the mayonnaise that cholesterol causes as acceptor molecule handling through enzyme is compared with the contrast mayonnaise, and the former has more cholesteryl ester to produce.In addition, the result shows not significance increase of free fatty acids when handling yolk with transferring enzyme.The result shows that further the free fatty acid content in the food that acyltransferase is handled significantly is lower than the free fatty acid content in the food of handling with the contrast Phospholipid hydrolase, though in the food lysolecithin formation amount the same also be like this.

Embodiment 8: the effect of aeromonas salmonicida transferring enzyme in cake

In cake prescription, detect effect from the GCAT acyltransferase of aeromonas salmonicida.Enzyme is detected separately and is mixed detection with other lipolytic enzyme.Enzyme can be added in some cake compositions or before mixing cake and together add with other cake composition.

The preliminary experiment explanation, compared with the control, acyltransferase combines with the triglyceride hydrolysis enzyme and can improve cake volume and dough flesh (crumb) structure.

In following experiment, from the transferring enzyme of aeromonas salmonicida and variant can be detected separately or with triglyceride hydrolysis enzyme joint-detection.These enzymes have activity to the lipid composition in egg and the shortening, and promptly sugared to cake prescription integral part, protein, and glycerine and cholesterol (in the egg) have activity.

Materials and methods

Enzyme

#179 is from the acyltransferase of aeromonas salmonicida

Grindamyl EXEL 16, lipase is thermophilic mould from fine, soft fur

The cake prescription:

Composition	％	g
			Sugar
35/20	20,37	204
			Cake mix, Albatros	18,11	181
Wheat starch	5,21	52

Baking powder (baking powder)	0,36	4
			Liquid shell egg through pasteurization	22,63	226
Shortening Vegao (Aarhus United	18,11	181
			Whey powder	0,68	7
Glucose syrup, 75%42DE	4,53	45
			Glycerine	1,36	14
Salt	0,32	3
			Rapeseed oil	6,34	63
Potassium sorbate (Potassium sorbate)	0,18	1,8

Equipment:

Mixing tank: the Hobart N50 of band shovel

Baking box: Simon cake baking box

Operation steps:

All the components is controlled at room temperature.

1. make sugar and shortening emulsification (cream up) 3 minutes-begin, be transferred to third speed in 30 seconds with second speed

2. add remaining component-begin to be transferred in 30 seconds second speed-stirring 5 minutes altogether with first speed.

3. in the 1dl measuring cup, measure the volume of sticking with paste (batter)

4. spray (spray) pound cake jar (pound caketin) with " Babette " oily smear (oil spread), and cover with paper

5. claim 2 * 350g to put into the pound cake jar

6. evenly launch agglomerate with shovel

7 put into before the baking box-add at the top of cake (centre of cake is along lengthwise direction) delegation's oil-make cake therefrom separated

8180 ℃ were toasted 50 minutes

9 toasted after, jar is taken out from baking box, before cake takes out from jar jar " dropping " to desk

10 paper of removing on the cake also will face up

11 weigh and measurement volumes before, cake is placed on the grid cooling 60 minutes

Remarks:

Used enzyme adds when mixing beginning, or is added in other composition of cake before adding other composition.

Enzyme only has activity, these enzyme deactivations in the cake bake process in mixing of cake composition or reaction process.

The result

Below carry out shown in the experiment according to the form below

		1	2	3	4
						Shell egg	G		250	250	250	250
Glucose syrup, 75%DE 42	G	10	10	10	10
						The #179 acyltransferase, 26PLU/ml	ML		25		25
Grindamyl?EXEL?16，	Mg		37,5	37,5
						Water					25

According to the top prescription that provides, after egg is used to make cake, make egg very soon, glucose syrup and enzyme were 37 ℃ of reactions 30 minutes.

PRELIMINARY RESULTS explanation acyltransferase improves cake volume and dough flesh structure, mouthfeel and outward appearance with comparing with the water contrast from the thermophilic mould triglyceride hydrolysis enzyme of fine, soft fur.PRELIMINARY RESULTS explanation in cake, acyltransferase and lipase united use fine.

Embodiment 9: the purpose of these experiments is to detect single from having a liking for aqueous vapor at expression in escherichia coli The transferring enzyme of born of the same parents bacterium

In yolk, detect the transferring enzyme reaction of Aeromonas hydrophila #135 (0.5NEFA-PLU/ml).Experimental design is as shown in table 6.

Table 6

	Reaction times	Yolk	#135 concentration
				Sequence number	Minute	Gram	Unit, PLU-NEFA
1	30	1	0,000
				2	30	2	0,100
3	60	2	0,100
				4	150	2	0,100
5	240	2	0,100
				6	1560	2	0,100
7	1560	1	0,000

Yolk is heated to 37 ℃, adds enzyme.Add the 7ml chloroform after reaction times: methyl alcohol 2: 1 also mixed 30 seconds in Whirley.

Sample centrifugal 10 minutes at 800 * g is isolated lower solvent phase.Getting 2 μ l samples adds on the TLC silica plate also with elutriant IV wash-out.The TLC analytical results is shown in Figure 50,51.

The materials and methods that present embodiment is mentioned sees the materials and methods that above embodiment describes in detail.

The sample of this experiment is also analyzed through GLC as the TMS derivative.GLC result is as shown in table 7.

Table 7The GLC of egg-yolk lipids

Sequence number	Reaction	Transferring enzyme # 135conc.
							Time	Unit/g yolk	Free fatty acids	Cholesterol	Cholesteryl ester
	Minute		％	％	％
						7	Contrast	0	0,25	2,88	0,34
3	60	0,025	0,25	2,68	0,56
						4	150	0,025	0,29	1,85	1,72
5	240	0,025	0,53	1,42	3,54
						6	1560	0,025	0,95	0,3	4,43

From to free fatty acids, the GLC of cholesterol and cholesteryl ester analyzes, and can calculate every kind of composition volumetric molar concentration and calculate transferase active per-cent, and is as shown in table 7.

The transferase active percentage calculation

According to the result, free fatty acids, the following calculating of the increasing amount of sterol ester

Δ % lipid acid=% lipid acid (enzyme)-% lipid acid (contrast)

Δ % sterol ester=% sterol ester/stanol ester (enzyme)-% sterol ester/stanol ester (contrast)

Transferase active per-cent is the per-cent that accounts for total enzyme activity:

Wherein:

Mv sterol ester=sterol ester molecular-weight average

Mv lipid acid=lipid acid molecular-weight average

The transferase active of Aeromonas hydrophila #135 in table 8 yolk

Sequence number	Reaction	Transferring enzyme # 135 concentration
								Time	Unit/g yolk	Free fatty acids	Cholesterol	Cholesteryl ester	Transferase active
	Minute		mM	mM	mM	％
							7	Contrast	0	8,9	74,5	5,3	-
3	60	0,05	8,9	69,3	8,7	100
							4	150	0,05	10,4	47,8	26,5	93

5	240	?0,05	?18,9	?36,7	?54,6	77
							6	1560	?0,05	?33,9	?7,8	?68,4	48

It is principal reaction that TLC and GLC analyze the transferring enzyme reaction that confirms initial Aeromonas hydrophila #135.React and begin to occur some hydrolytic activities after 150 minutes.After 1560 minutes, the transferring enzyme reaction is suitable substantially with the hydrolysis reaction level.As long as the result has also confirmed the acceptor molecule cholesterol and can use that the transferring enzyme reaction is exactly principal reaction.When cholesterol concentration decline, hydrolytic activity is just more and more main.

Embodiment 10: with yolk as the determination experiment of the transferase active of substrate-hereinafter become " egg Yellow assay method "

Acyltransferase separates and expresses subtilis from aeromonas salmonicida.The purpose of this research is to formulate a kind of analytical procedure, and this method can be measured the transferase active and the hydrolytic activity of enzyme, analyzes by these, and the substrate with comprising Yelkin TTS and cholesterol makes the transferring enzyme of enzyme and the qualification of hydrolytic activity become possibility.

Because comprising Yelkin TTS and cholesterol and known transferring enzyme and Phospholipid hydrolase, yolk can work fully, so this research is with the substrate of yolk as enzymatic determination to this substrate.

Using the shortcoming of yolk is that this substrate is water, lipid and proteinic complex mixture.Lipid composition comprises glyceryl ester, 66.2%; Phosphatide, 29.6%; And cholesterol, 4.2%.Phosphatide comprises 73% Yelkin TTS, 15% kephalin and 12% other phosphatide.For lipid acid, the 33%th, saturated fatty acid and 67% unsaturated fatty acids comprise 42% oleic acid and 7% linolic acid (ref.Kirk-OthmerEncyclopedia of Chemical Technology, John Wiley ﹠amp; Sons, Inc.)

Expection yolk composition changes to some extent.But document (Biochimica et Biophysica Acta, 1124 (1992) 205-222) mention " although diet and envrionment conditions have very big change; lipid and lipoprotein composition in the ripe yolk of domestic hen are very constant " in, and further quote as proof " result; yolk continues to provide forms basicly stable food; thus this just can keep its chemistry and physics-chem characteristic to be applied to credibly toast, in makeup and the pharmaceutical industry ".

This piece document shows that the yolk component is highly stable, and therefore decision uses egg yolk as substrate in yolk is measured.

The lipid reactant product that quantification is handled gained to the enzyme of yolk is by extracting lipid from substrate, and the GLC that then does lipid composition analyzes and gets.

Operation steps

Material

Yolk: the liquid-type yolk of pasteurization, from Dan  g Products A/S, DK-4000Roskilde.

HEPES damping fluid Sigma catalog number (Cat.No.) .H 3375

Chloroform, AG

Enzyme

Purifying, from the acyltransferase of aeromonas salmonicida #178-9

Fine, soft fur is thermophilic mould lipase GRINDAMYL EXEL 16, production number 147060 (contrast)

With yolk is the enzymatic determination of substrate.

In 20ml Wheaton glass cylinder weighing 5 gram liquid-type yolk, be heated to 35 ℃.

Add the 0.25ml enzyme solution, timing begins.

With regular intervals the 0.5g sample is moved on in the 10ml Dram glass cylinder (glass).

Add 20 μ l 4M HCl, to stop enzyme reaction and acidifying soap.

Add the 3ml chloroform.Sample was mixed in Whirley 30 seconds.

With sample centrifugal 10 minutes, and get the 0.8ml chloroform and move to mutually in tarry (tarred) Dram glass cylinder at 3000 * g.Under 60 ℃ of nitrogen vapor conditions, evaporate chloroform.Weighing dram glass cylinder once more.

The lipid that extracts is analyzed by GLC and TLC.

TLC analysis-as described herein.

GLC analysis-as described herein.

The result

For the yolk assay method of using yolk as substrate, as shown in table 9 experimentizing.

Table 9

		1	2	3
					Yolk, liquid state	Gram		5	5	5
Transferring enzyme #178-9,32PLU-7/ml *	ml			0.25
					Fine, soft fur is thermophilic mould lipase, 200LIPU/ml	ml		0.25
Water	ml	0.25

15,30, take out the 0.5g sample after 60,120 and 1080 minutes respectively, separate lipid by solvent extraction.Make the TLC analysis of lipid respectively of solvent I and IV.The photo of TLC plate is shown in Figure 52.

TLC analyzes the activity (sample 3) of the transferring enzyme #178-9 that clearly shows aeromonas salmonicida.This can find out from the decline of phosphatide PC and PE.The result shows that also the amount of lysolecithin LPC is high unlike expected value.This explanation perhaps this enzyme has hydrolytic activity to lysolecithin or also may be because lysolecithin polarity is strong, can partly be dispersed in aqueous phase, causes extracting insufficient institute extremely.

For determining free fatty acids, the amount of cholesterol and cholesteryl ester is also carried out GLC to the isolating lipid of solvent extraction and is analyzed.GLC result is as shown in table 10.

The hang oneself GLC of lipid of the yolk that enzyme handles of table 10 analyzes.The result represents with the % based on lipid composition

			15 minutes	30 minutes	60 minutes	120 minutes	1080 minutes
								Free fatty acids	Contrast	1	0.328	0.304	0.332	0.333	0.369
	Fine, soft fur is thermophilic mould (T. lanuginosus)	2	0.391	0.376	0.459	0.627	22.909
									Aeromonas salmonicida # 178-9	3	1.007	1.668	4.013	6.761	15.098
								Cholesterol	Contrast		1	3.075	2.968	3.103	3.056	3.099
	It is mould that fine, soft fur is thermophilic	2	3.130	3.032	3.045	3.026	3.225
									Aeromonas salmonicida # 178-9	3	2.835	1.912	0.356	0.220	0.206
								Cholesteryl ester	Contrast		1	0.416	0.397	0.422	0.408	0.437
	It is mould that fine, soft fur is thermophilic	2	0.436	0.400	0.425	0.419	0.416
									Aeromonas salmonicida # 178-9	3	1.414	2.988	6.107	6.694	5.760
								Triglyceride level	Contrast		1	76.153	73.505	75.565	79.344	77.382
	It is mould that fine, soft fur is thermophilic	2	74.099	74.413	77.079	74.284	21.781
									Aeromonas salmonicida # 178-9	3	73.781	73.342	77.857	82.040	72.117

From the result, it is almost all esterified to observe after 60 minutes the cholesterol in the sample 3.Can inference in preceding 30 minutes, unnecessary reaction substrate be arranged.Therefore, be used to calculate the activity of described enzyme from the result of institute's sample thief after 15 and 30 minutes.

Based on the fact that contains 27% lipid in the information of table 10 and the yolk, can calculate the micromole's lipid acid that every milliliter of enzyme produces and the quantity of cholesteryl ester, the result sees table 11.

The result of table 11 carries out following calculating by the result to lipid acid in the sample 3 (aeromonas salmonicida, 15 minutes) and gets

Lipid in the 5g yolk=5*0.27=1.35 gram

1.35 the gram lipid contains 1.007% lipid acid=1.35*1.007/100=0.01359 gram

The molecular-weight average of lipid acid is 272

0.01359 gram=0.01359*1000000/272 μ mol=49.9798 μ mol adds the 0.25ml enzyme

μ mol lipid acid/ml enzyme=49.9798/0.25=199.9

Table 11

Micromole/ml enzyme
							0 minute	15 minutes	30 minutes
Free fatty acids	Contrast		65.01	60.37
						It is mould that fine, soft fur is thermophilic		77.61	74.71
	Transferring enzyme #178-9		199.86	331.06
					Cholesteryl ester	Contrast		35.09	33.50
	It is mould that fine, soft fur is thermophilic		36.77	33.73
						Transferring enzyme #178-9		119.29	252.15

Can calculate from the result of table 11, compared with the control, the variation of the lipid acid that enzyme causes and the amount of cholesteryl ester sees Table 12.

Table 12

Δ micromole/ml enzyme		0 minute	15 minutes	30 minutes
					Free fatty acids	It is mould that fine, soft fur is thermophilic		12.593	14.340
	Transferring enzyme # 178-9		134.843	270.691
Cholesteryl ester	It is mould that fine, soft fur is thermophilic		1.677	0.235
						Transferring enzyme # 178-9		84.196	218.652

The lipid acid that produces and the amount of cholesteryl ester are as the function of time, shown in Figure 53.

Hydrolytic activity (FFA formation) and acyltransferase activity (cholesteryl ester formation) as the function of time can be calculated from the clinometer of curve.Then can calculate relative transferase active (% acyltransferase activity) and relative hydrolytic activity, as shown in table 13.Transferase active can be measured by previously described acyltransferase activity percentage test scheme relatively.For example, calculate the relative reactivity of #178-9: gross activity is FFA activity+transferase active=9,023+7,2884=16,311 μ mol/min/ml, relative transferase active=7,2884*100/16,311=44,7, relative hydrolytic activity=9,023*100/16,311=55,3

Table 13

It is mould that fine, soft fur is thermophilic	The FFA activity	0.4780	μmol/min/ml
				Aeromonas salmonicida #178-9	The FFA activity	9.0230	μmol/min/ml
				It is mould that fine, soft fur is thermophilic	The cholesteryl ester activity	0.0078	μmol/min/ml
Aeromonas salmonicida #178-9	The cholesteryl ester activity	7.2884	μmol/min/ml
It is mould that fine, soft fur is thermophilic	Relative transferase active	1.6
				Aeromonas salmonicida #178-9		44.7
				It is mould that fine, soft fur is thermophilic	Relative hydrolytic activity	98.4
Aeromonas salmonicida #178-9		55.3

Result in the table 13 confirms to have significant transferase active from the transferring enzyme of aeromonas salmonicida, and described result confirms that also this enzyme has significant hydrolytic activity.

Derive from the thermophilic mould lipase of fine, soft fur and mainly contain hydrolytic activity, transferase active 1.6 can not prove to have any transferase active relatively, can only explain with the uncertain factor in analyzing.

Conclusion

Utilize yolk as substrate, measure from the acyltransferase of aeromonas salmonicida with from the transferring enzyme and the hydrolytic enzyme activities of the thermophilic mould lipase of fine, soft fur.Under the condition determination, between the time of the formation of cholesteryl ester and free fatty acids and acyltransferase, there is linear relationship at first.Just can calculate hydrolytic activity (FFA formation) and transferase active (cholesteryl ester formation) based on this linear relationship.Hydrolytic activity and transferase active also can calculate relatively.Under this condition determination, show the hydrolysis and the transferase active that almost are equal to from the acyltransferase (this example is GCAT) of aeromonas salmonicida.Show very low hydrolytic activity and transferase active is not remarkable from the thermophilic mould lipase of fine, soft fur.

Embodiment 11: the transferring enzyme in the yolk of high-moisture is measured

Brief introduction

Separate and subtilis, express from aeromonas salmonicida according to acyltransferase of the present invention.Preliminary experiment shows this enzyme, and that lipid acid is transferred to cholesterol from lipid is effective for substrate for utilizing yolk.

In the following experiment, will more study in great detail with the transferring enzyme reaction of yolk as substrate, special concern contains the water concentration in the described substrate.

Operation steps

Material

Yolk: the liquid-type yolk of pasteurization, from Dan  g Products A/S, DK-4000Roskilde.

HEPES damping fluid Sigma production number H3375

Chloroform, AG

Squalane, AG

Enzyme:

According to the #178-9 acyltransferase of the present invention from aeromonas salmonicida

#2427 phospholipase A1 .LIPOPAN from sharp sickle spore (fusarium oxysporum) ^Ffrom Novozymes, DK (being equivalent to lipolytic enzyme)

From the #1991 Phospholipase A2 of pancreas, LIPOMOD 22L from Biocatalysts, UK (being equivalent to lipolytic enzyme)

With yolk is the enzymatic determination of substrate

With 20ml Wheaton glass cylinder weighing 5 gram liquid-type yolk, be heated to 35 ℃.

Add water and enzyme solution, pick up counting.

With regular intervals the 0.5g sample is moved on in the 10ml Dram glass cylinder.

Add 20 μ l 4M HCl to stop enzyme reaction and acidifying soap.

Add the 3ml chloroform.Sample was mixed in Whirley 30 seconds.

With sample centrifugal 10 minutes of 3000 * g and get the 0.8ml chloroform and move to mutually in the tarry Dram glass cylinder.Under 60 ℃ of nitrogen vapors, evaporate chloroform.Weighing dram glass cylinder once more.

Isolating lipid is analyzed by GLC.

GIC analyzes

Perkin Elmer Autosystem 9000 Capillary Gas Chromatograph, silicon post 12.5m * 0.25mm ID * 0.1 μ film thickness, 5% phenmethyl silicone (phenyl-methyl-silicone) (CP Sil 8 CB are from Chrompack) that it is equipped with WCOT to merge.

Carrier gas: helium

Syringe .PSSI cold cracking injection (initial temperature is heated to 385 ℃ for 50 ℃) volume 1.0 μ l

Detector FID:395 ℃

Baking oven program: 123

Oven temperature, ℃. 90 280 350

Isothermal (isothermal), the time, minute. 10 10

Alternating temperature speed (temperature rate), ℃/min. 15 4

Specimen preparation: the 30mg sample is dissolved in the 9ml heptane: pyridine, contain internal standard heptadecane, 0.5mg/ml at 2: 1.The sample solution of 300 μ l is moved on to bent phial (crimp vial), add 300 μ lMSTFA (N-methyl N-trimethyl silyl trifluoroacetamide (N-Methyl-N-trimethylsilyl-trifluoraceamid)), 60 ℃ were reacted 20 minutes.

Calculate: the response factor of glycerine list-two-three ester (mono-di-triglycerides) and free fatty acids (reaction factor) is determined by standard 2 (list-two-triglyceride level), cholesterol, the response factor of cholesterol cetylate (Cholesteryl palmitate) and cholesterol ester stearic acid is determined by the reference material (purifying substance 10mg weighs) of purifying.

The result

Contain the substrate of the yolk of 2% squalane (squalane) as reaction.Add the internal standard that squalane is analyzed as GLC, to quantize the lipid composition in the yolk.

Experimental design is as shown in table 14.

Table 14

		1	2	3	4	5	6	7	8
										Substrate contains the yolk of 2% squalane	g		5	5	5	5	5	5	2.5	2.5
Transferring enzyme #178-9,14PLU-7/ml	ml		0.25			0.25		0.13
										LIPOPAN F solution, 200PLU-7/ml	ml			0.25					0.13
The #1991 Phospholipase A2,6300PLU/ml	ml				0.25		0.25
Water	ml	0.25				3.8	3.8	8.75	8.75

Sample thief after 30,60 and 120 minutes is with above-mentioned methods analyst (sample thief 0.5ml (exp 1-4) 0.86ml (exp.5-6) and 2.2ml (exp.7-8)).

GLC result is as shown in Table 15.GLC result represents with the per-cent of substrate (yolk).This table has also shown the total water-content in reaction times and the reaction mixture.

Table 15

Enzyme	Reaction times	Water %	GLC	GLC	GLC
							Minute	In the reaction	% lipid acid	The % cholesterol	The % cholesteryl ester
Contrast
		120	54	0,247	0,863	0,083

#178	30	54	?0,422	?0,669	?0,445
						#178	60	54	?0,515	?0,549	?0,672
#178	120	54	?0,711	?0,364	?1,029
						#2427	30	54	?2,366	?0,848	?0,090
#2427	60	54	?3,175	?0,837	?0,088
						#2427	120	54	?3,926	?0,833	?0,082
#1991	30	54	?1,606	?0,911	?0,083
						#1991	60	54	?1,701	?0,838	?0,080
#1991	120	54	?1,781	?0,763	?0,053
						#178	30	73	?0,377	?0,764	?0,495
#178	60	73	?0,488	?0,665	?0,719
						#178	120	73	?0,626	?0,426	?0,931
#2427	30	73	?2,471	?0,853	?0,092
						#2427	60	73	?3,284	?0,858	?0,087
#2427	120	73	?4,176	?0,837	?0,081
						#178	30	89	?0,344	?0,720	?0,308
#178	60	89	?0,443	?0,725	?0,446
						#178	120	89	?0,610	?0,597	?0,607
#2427	30	89	?0,510	?0,167	?0,010
						#2427	60	89	?0,602	?0,133	?0,010
#2427	120	89	?0,867	?0,147	?0,009

Based on to lipid acid, the analysis of cholesterol and cholesteryl ester can calculate the function of the content of the free fatty acids of generation and cholesteryl ester as reaction times and water content.On these results' basis, just can calculate total enzyme activity with the summation meter that lipid acid forms and cholesteryl ester forms.Can calculate relative hydrolytic activity and relative transferase active (being the % acyltransferase activity) by result shown in the table 16.

The also available Statgraphic Multifactor of result shown in the table 16 ANOVA does statistical study.The statistics of Figure 54 confirms under this kind condition determination, Phospholipase A1, and #2427 and Phospholipase A2, #1991 does not have transferase active and transferring enzyme #178-9 demonstrates 50% transferase active.

In this mensuration water content for the influence of the transferase active of transferring enzyme #178 also by statistics credit analyse, shown in Figure 55.These results show water content in this mensuration under the situation between the 54-89% scope, water content for relative transferase active do not have obvious shadow to.

Reaction times influences utilization as table 16 and the outcome evaluation shown in Figure 56 for the transferase active of transferring enzyme #178.Figure 56 result shows that relative transferase active descends as the function in reaction times.This can be consumed with most receptors molecule cholesterol, and therefore relative hydrolytic activity improves this fact to be explained.The negative value of #2427 transferring enzyme reaction only shows for this analytical procedure do not have transferase active in variation.

Table 16

Enzyme

Reaction times

Mix in reaction

The lipid acid that produces

The cholesterol that consumes

The cholesteryl ester that produces

Hydrolytic activity %

Transferase active %

	Minute	Water % in the compound
								#178	30	54	?0,175	?0,194	?0,362	53	47
#178	60	54	?0,268	?0,314	?0,589	52	48
								#178	120	54	?0,464	?0,499	?0,946	53	47
#2427	30	54	?2,119	?0,015	?0,007	100	0
								#2427	120	54	?2,928	?0,026	?0,005	100	0
#2427	60	54	?3,679	?0,030	?-0,001	100	0
								#1991	30	54	?1,359	?-0,048	?0,000	100	0
#1991	60	54	?1,454	?0,025	?-0,003	100	0
								#1991	120	54	?1,534	?0,100	?-0,030	101	-1
#178	30	73	?0,130	?0,099	?0,412	42	58
								#178	60	73	?0,241	?0,198	?0,636	47	53
#178	120	73	?0,379	?0,437	?0,848	51	49
								#2427	30	73	?2,224	?0,010	?0,009	100	0
#2427	60	73	?3,037	?0,005	?0,004	100	0
								#2427	120	73	?3,929	?0,026	?-0,002	100	0
#178	30	89	?0,097	?0,143	?0,225	50	50
								#178	60	89	?0,196	?0,138	?0,363	56	44
#178	120	89	?0,363	?0,266	?0,524	62	38
								#2427	30	89	?0,263	?0,696	?-0,073	113	-13
#2427	60	89	?0,355	?0,730	?-0,073	110	-10
								#2427	120	89	?0,620	?0,716	?-0,074	105	-5

Conclusion

Detection from the acyltransferase of aeromonas salmonicida is carried out in substrate yolk and under the different moisture content condition.This enzyme and contrast lipolytic enzyme are promptly from the phospholipase A1 of sharp sickle spore with from the Phospholipase A2 contrast of pancreas.

Result's proof has only the transferring enzyme reaction between transferring enzyme catalysis Yelkin TTS and the cholesterol in the cholesteryl ester forming process.It almost is identical for the relative transferase active from the aeromonas salmonicida transferring enzyme in 54% to 89% scope that the result shows in substrate moisture content.

Embodiment 12: " the transferring enzyme assay method in the buffered substrate " is used to measure acyltransferase Active (for example being used to utilize the food of Yelkin TTS and cholesterol)

Acyltransferase is separated and is expressed subtilis from aeromonas salmonicida.This enzyme is in forming the cholesteryl ester process, and is very effective for lipid acid is transferred to cholesterol from lipid.By observing the formation of free fatty acids, show that this enzyme has certain hydrolytic activity.Traditional Phospholipid hydrolase (EC3.1.1.4 and EC3.1.1.32) has the ability of hydrolyzed lecithin in the forming process of free fatty acids and lysolecithin, and does not have these enzymes of report that transferase active is arranged.

Here describe the transferring enzyme of enzyme and the measuring method of hydrolytic activity in detail, therefore can differentiate the acyltransferase consistent with the present invention, and the used substrate of measuring method comprises Yelkin TTS and cholesterol.Substrate used in this time studying is based on the GranulestinLecithin and the cholesterol that are dispersed in the damping fluid.From described substrate, extract lipid, analyze lipid composition with GLC then, thus the quantitative reaction product.

Operation steps

Material

L-α-phosphatidylcholine 95% (plant) Avanti no.441601

Cholesterol: Sigma catalogue .C 8503

The cholesteryl cetylate, Sigma C 6072

The cholesteryl stearate, Sigma C 3549

HEPES damping fluid Sigma catalog number (Cat.No.) .H 3375

Chloroform, AG

Enzyme

The source aeromonas salmonicida #178-9, purifying GCAT

The TLC analysis is described as embodiment 6 and is carried out.

GLC such as embodiment 11 describe and carry out.

The result: transferring enzyme is measured based on GranulestinLecithin and cholesterol as substrate.

According to following operation, the transferase active of following transferring enzyme is measured in the substrate with GranulestinLecithin and cholesterol basis.

450mg GranulestinLecithin (＞95%PC Avanti production number 441601) and 50mg cholesterol are dissolved in chloroform, evaporation drying under vacuum condition.300mg cholesterol/phosphatidylcholine mixture moves on in the Wheaton glass cylinder and adds 15ml 50mM HEPES pH of buffer 7.Lipid is distributed in the damping fluid in whipping process.

Substrate is heated to 35 ℃ simultaneously with magnetic stirring apparatus is mixed, adds the 0.25ml enzyme solution.This is the high moisture environments of water content about 95%.

In reaction 0,5,10,15, take out the 2ml sample after 25,40 and 60 minutes.Add 25 μ l 4M HCl immediately with the acidifying free fatty acids, stop enzyme reaction.Add the 3.00ml chloroform.Sample is acutely rocked jolting 30 seconds in Whirley.Sample is centrifugal, separate the 2ml chloroform and also filter mutually with the filter paper (filter) of 0.45-μ m, enter in the tarry Dram glass cylinder of 10ml.Under 60 ℃ of nitrogen vapor conditions, evaporate chloroform.And weighing sample once more.The lipid that extracts is analyzed by GLC.

The GLC analytical results as shown in figure 17.The result is with the percentage calculation of extracted lipid.The lipid acid that forms and the amount of cholesteryl ester are as the function of time, shown in Figure 57.Infer that from Figure 57 enzyme reaction is not linear as the function of time because can be observed initial hydrolysis and transferase active higher.After about 10 minutes, before about 60 minutes, reaction and display goes out the formation of lipid acid and cholesteryl ester and the linear relationship of time.Therefore decision is observed enzyme reaction with this timed interval.

Table 17

Minute	0	5	10	15	25	40	60
Cholesterol, %	10.064	8.943	8.577	8.656	8.102	7.856	7.809
								Cholesteryl ester, %	0.000	1.571	2.030	2.058	2.282	2.659	3.081
Total FFA, %	0.260	1.197	1.239	1.466	2.445	2.943	3.940

Can calculate the growing amount of lipid acid and cholesteryl ester according to the enzyme amount of lipid content in the known reaction mixture and interpolation, represent (table 18 and Figure 58) with μ mol/ml enzyme

Table 18

Minute	10	15	25	40	60
							μmol/ml	μmol/ml	μmol/ml	μmol/ml	μmol/ml
Total FFA	58.1	68.7	114.6	138.0	184.7
						Cholesteryl ester	88.8	90.0	99.3	115.6	133.8

From the result of table 18 and the rate of curve of Figure 58, can calculate quantity as the lipid acid and the cholesteryl ester of the function of time, represent with the every ml enzyme of μ mol/min.

The calculating of hydrolytic activity and transferase active is shown in table 19.The mensuration scheme that is used in above-described % acyltransferase activity is measured relative transferase active.

Table 19

Hydrolytic activity (lipid acid)	2.52	The every ml enzyme of μ mol/min
			Transferase active (cholesteryl ester)	0.94	The every ml enzyme of μ mol/min
Gross activity	3.45	The every ml enzyme of μ mol/min

			Relative transferase active	27.1	％
Relative hydrolytic activity	72.9	％

The transferase active screening of other enzyme

Method above-mentioned is used for screening the transferase active and the hydrolytic activity of different lipolytic enzymes.The enzyme that detects is shown in table 20.

Table 20

		1	2	3	4	5
							Substrate	ml	15	15	15	15	15
#178-9 transferring enzyme aeromonas salmonicida 32 PLU-7/ml	ml	0.25
							5％#3016，LIPOPAN F (sharp sickle spore)	ml		0.25
It is mould that 5% fine, soft fur is thermophilic	ml			0.25
							5% wrinkle candidiasis (Candida rugosa) #2983 that falls	ml				0.25
5% column candidiasis (Candida cylindracea) # 3076	ml					0.25

The substrate that comprises 300mg phosphatidylcholine/cholesterol is distributed in the HEPES damping fluid of 50mM pH7.0, is heated to 35 ℃ under stirring, and adds enzyme solution, and stirred sample maintains 35 ℃.Take out sample and use chloroform extraction with timed interval of rule.Isolating lipid is analyzed with GLC, and the result is shown in table 21.

Table 21

Sample
									1	Transferring enzyme 178-9
	Minute	0	5	10	15	25	40	60
										FFA	1.216	2.516	2.983	2.62	2.894	3.448	3.911
	Cholesterol	7.547	6.438	6.365	6.15	6.136	5.936	5.662
										Cholesteryl ester	0	1.835	2.177	2.44	2.58	2.851	3.331
									2	Point sickle spore (LIPOPAN F)	0	5	10	15	25	40	60
	FFA	1.216	1.345	1.796	1.95	2.487	2.424	2.977
										Cholesterol	7.547	7.309	7.366	7.33	7.429	7.341	7.326
	Cholesteryl ester	0	0.26	0.386	0.35	0.267	0.36	0.394

3	It is mould that fine, soft fur is thermophilic	0	5	10	15	25	40	60
										FFA	1.216	0.853	0.875	1	0.896	1.105	1.009
	Cholesterol	7.547	7.384	7.639	7.63	7.675	7.603	7.529
										Cholesteryl ester	0	0	0	0	0	0	0
									4	Candidiasis (# 2938) wrinkles	0	5	10	15	25	40	60
	FFA	1.216	0.982	0.987	1.02	1.135	1.131	1.15
									4	Cholesterol	7.547	7.438	7.656	7.66	7.638	7.575	7.585
	Cholesteryl ester	0	0	0	0	0	0	0
5	Column candidiasis (# 3076)	0	5	10	15	25	40	60
										FFA	1.216	1.032	1.097	1.07	1.203	1.131	1.43
	Cholesterol	7.547	7.502	7.425	7.65	7.619	7.502	7.411
										Cholesteryl ester	0	0	0	0	0	0	0

Analyze and to observe from GLC, have only acyltransferase (178-9) to produce a large amount of cholesteryl ester and lipid acid.And observe Phospholipid hydrolase from sharp sickle spore and make that the free fatty acids amount is stable and increase, only have a spot of cholesteryl ester to form at first, but not observing cholesteryl ester increase as the function of time.

Amount and GLC according to lipid substrates analyze, and can calculate relative transferase active and relative hydrolytic activity based on the result who derives from 10 to 60 minute reaction times.The result of transferring enzyme 178-9 and sharp sickle spore lipase is shown in table 21.Other enzyme that is verified is show activity not.

Table 21

	Transferring enzyme 178-9	Point sickle spore
			Hydrolytic activity, micromole/minute every milliliter of enzyme	?1.03	0.96
Transferase active, micromole/minute every milliliter of enzyme	?0.40	0.01
			Gross activity, micromole/minute every milliliter of enzyme	?1.43	0.98
			Relative hydrolytic activity	?71.8	98.7
Relative transferase active	?28.2	1.3

Result shown in the table 21 confirms that acyltransferase (sample 178-9) has significant transferase active.It is very consistent with experiment shown in the table 19 equally also to observe relative transferase active.

Yet the Phospholipid hydrolase of observing from sharp sickle spore has very low transferase active.To such an extent as to very low its of transferase active drops in the range of indeterminacy of analysis.In expecting, the Phospholipid hydrolase of sharp sickle spore has significant hydrolytic activity.

Conclusion

Substitute yolk (shown in the embodiment 11) as the substrate of measuring the aeromonas salmonicida transferase active based on the phosphatidylcholine of purifying and the artificial substrate of cholesterol.Between 10 to 60 minutes reaction times, the function that free fatty acids and cholesteryl ester formed as the time presents almost linear.Activity based between 10 to 60 minutes reaction times can calculate hydrolytic activity and transferase active.

The concentration of substrate that concentration of substrate in this measuring method is lower than in the yolk relatively is lower, and water content is higher relatively.

According to the result of experiment of acyltransferase (being GCAT in this situation) in damping fluid in artificial substrate phosphatidylcholine/cholesterol from aeromonas salmonicida, the inference this kind of enzyme also has good transferase active in the very high system of water content.

The transferase active and the hydrolytic activity that all can be used for measuring enzyme based on the measuring method of the phosphatidylcholine/cholesterol (referring to embodiment 12) in yolk (referring to embodiment 11) and the damping fluid.According to the preferred yolk of lower angle: hydrolytic activity and transferase active and time are linear, and the phosphatidylcholine/cholesterol in the damping fluid is only linear in scope sometime.

Embodiment 13: food emulsion(Food Emulsion)

In containing the standard food emulsion formulations of 60% oil (standard Food emulsion recipe), measure influence through the liquid-type yolk of enzyme modification.

Standard method and material as precedent one by one as described in.

Shown in table 22, yolk be used for committing suiside acyltransferase or the Phospholipid hydrolase of salmon Aeromonas (#138), promptly (Novozymes A/S, Denmark) (#2938) handles commercial enzyme (commercially available enzyme) LipopanF .

Table 22The enzyme of yolk is handled

		1	2	3	4
						Yolk, Sanofo production number 1123P2	Gram		10	10	10	10
#138，10PLU/ml	ML		1	1
						#2938， 200PLU/ml	ML				1
Water	ML												1
						Reaction times	Minute	210	360	210	210

The TLC of the egg-yolk lipids of the yolk of handling from enzyme analyzes and is presented at Figure 59 and 60.

In this experiment, the dosage of #2939 increases 10 times, and this produces fairly obvious activity to yolk.The free fatty acids amount obviously raises, and Yelkin TTS (PC) is hydrolyzed to lysolecithin (LPC).Because free cholesterol is converted into cholesteryl ester, part Yelkin TTS is converted into lysolecithin, so transferring enzyme #138 has produced tangible transferring enzyme reaction.

The interesting aspect of another of enzyme modification effect is the denseness (consistency) of product.The sample of handling through Phospholipid hydrolase #2938 becomes very hard, and the sample of handling with acyltransferase #138 has identical liquid consistency (referring to Figure 61) with control sample.

In the food emulsion formulations, detect the yolk after modifying, shown in table 23.

Table 23Mayonnaise and enzyme modification yolk

	?0	1a	2a	3a	4a
							?％	％	％	％	％
Rapsolie	?60	60	60	60	60
						Yolk, Sanofo product no. 1123P2	?2,8
Enzyme modification yolk 1		2,8
						Enzyme modification yolk 2			2,8
Enzyme modification yolk 3				2,8
						Contrast (being untreated) yolk 4					2,8
Water	?39	36,2	36,2	36,2	36,2
						Vinegar, 10% acetate	?1	1	1	1	1

Modified yolk 1 and 2 is handled through acyltransferase; Modified yolk 3 is handled through the commodity Phospholipid hydrolase.

Can produce the food emulsion of oil-in-water emulsion according to following schedule of operation: the weighing in beaker of yolk and water, oil weighing separately.

Turrax mixing tank (20000rpm) is dipped in aqueous phase.Oil pumps into water with a constant speed, continues 2 minutes.Mixing process continues 1 minute again.Add vinegar then and mixed 5 seconds.

Check emulsifying agent stability in the time of in 100 ℃ of heating containers.Evaluation described emulsion (referring to Figure 62) after 100 ℃, 2 hours.

The emulsion stability of unprocessed yolk is very good in this experiment.But handle yolk because the amount minimizing of water sepn (water separation) has the stability of raising with acyltransferase #138.The yolk of handling through Phospholipid hydrolase #2938 produces very unsettled emulsion, and oil almost completely separates with water in the time of 100 ℃.

Think, in some applications, use the compositions and methods of the invention can improve the thermostability of emulsion, as the oil-in-water salad cream etc.This point is particularly important for food emulsifier, and these food emulsifiers are accepted heat treated before will and/or storing through pasteurisation treatment for extending the shelf life, as the meat through preprocessing (as microwave oven meat) of wanting reheat to handle before eating.Though do not expect to be subjected to any concrete theory, in some applications, free fatty acids accumulate the thermostability that is considered to damage these emulsions.Will be appreciated that the thermostability enhanced food emulsion that uses the inventive method to obtain, in all food applications, can not be found or even be not required.This is apparent for the technician in such field, and these characteristics are desirable in application in the application in this field, and emulsion stable available is equal to the simple heating experiment detection easily of pasteurization for example or microwave oven reheat.The contriver has found that the food emulsion that obtains with enzyme of the present invention has the thermostability of raising in preferred specific embodiments.

Embodiment 14: be rich in the transferring enzyme reaction in the yolk of plant sterol

But the transferring enzyme catalysis that is derived from aeromonas salmonicida forms lysolecithin, monoglyceride and plant sterol ester in the yolk that is rich in plant sterol and glycerine.Described enzyme is also comprising plam oil, and Yelkin TTS detects in the low water content system of plant sterol and glycerine.Analyze demonstration by TLC and GLC, under these reaction conditionss, have monoglyceride and plant sterol ester to generate.

Foreword:

In the aqueous hardly system (almost water freesystem) of Yelkin TTS, fat, plant sterol and glycerine, measure transferase active from the transferring enzyme of aeromonas salmonicida.

Material:

Yolk: through the liquid-type yolk of pasteurization from Danag Products A/S, DK-4000Roskilde

GCAT transferring enzyme purifying 178-9,32PLU-7/ml (Journal 2254-100)

Soybean lecithin, Yolkin from Aarhus United, Denmark.

Plam oil 43 is from Aarhus United, Denmark.

L-α phosphatidylcholine 95% plant (Avanti#441601)

Sitosterol, Sigma noS5753

Plant sterol: Generol N122 is from Cognis, Germany

Glycerol product number 085915

The result

Transferase active to plant sterol and glycerine initially screens as described in Table 24 carrying out in yolk.

Table 24

		1	2	3	4
						Yolk	Gram		1	1	1	1
Glycerine	Gram	0.1	0.1
						Sitosterol: olie 3: 7	Gram			0.13	0.13
Transferring enzyme #178-9	Unit	1		1
						Water			*		*

* water=83 μ the l of the water yield in the relative enzyme solution

Mix each composition and be heated to 37 ℃, in process, remain on this temperature with magnetic stirrer.

Take out 0.1 gram sample after 3 and 23 hours, analyze with TLC.

The TLC analytical results is shown in Figure 63.

Result among Figure 63 shows that cholesterol and plant sterol can react esterification by transferring enzyme, and to follow the formation (sample 3 and 4) of lysolecithin, reason be that free sterol and cholesterol nearly all in sample 3 all is converted into corresponding ester.

The result illustrates that also the sample that only has glycerine and yolk produces monoglyceride.The amount of monoglyceride need be passed through the GLC analysis confirmation.When sterol and glycerine (sample 3) when adding simultaneously, the amount of monoglyceride is very low, to such an extent as to use TLC detect less than.This explanation is used the transferring enzyme reaction appropriateness of glycerine as long as sterol and cholesterol have residue.

In another experiment, transferring enzyme 178-9 to be added in the mixture of soybean lecithin, glycerine and plant sterol, purpose is the catalytic activity of research enzyme in this reaction mixture.

Composition in these experiments in the reaction mixture is as shown in Table 25.

Table 25

		1	2	3	4	5	6
								Soybean lecithin	Gram	1.875	2.25	1.875	2.5	3.5	3.5
Plant sterol; Generol N 122	Gram	0.225	0.225	0	0	0.225	0.5
								Plam oil 43	Gram	2.675	2.25	2.8	2.125	1.062	0.831
Glycerine	Gram	0.225	0.275	0.325	0.375	0.248	0.238
Transferring enzyme #178-9,32 PLU/ml	ml	0.2	0.2	0.2	0.2	0.2	0.2

Experiment is undertaken by mix described lipid composition under 46 ℃ of stirrings.Add enzyme, 4 and 24 hours later samples that take out.

Sample is analyzed by TLC, shown in Figure 64.

After reaction 24 hours, take out the sample of experiment 2,4 and 5, also carry out GLC and analyze, the result is shown in table 26.

Table 26

		2	4	5
					Glycerine fatty acid monoglyceride sterol sterol ester	％ ％ ％ ％ ％	3.16 4.23 2.24 2.13 2.89	5.71 5.36 3.87	4.17 6.67 3.92 2.62 2.14

The result has confirmed that transferring enzyme 178-9 is containing soybean lecithin, in the reaction mixture of glycerine and plant sterol, but the formation of catalysis plant sterol ester and monoglyceride.Under the situation of the reducing cholesterol effect of emulsifying property that needs monoglyceride and plant sterol, this reaction mixture can be used for the production of oleomargarine.

Conclusion

But the formation of plant sterol ester and monoglyceride in the yolk of plant sterol and glycerine has been added in the CGAT transferring enzyme catalysis that derives from aeromonas salmonicida.Also catalysis is at plam oil for same enzyme, and Yelkin TTS forms plant sterol ester and monoglyceride in the mixture of plant sterol and glycerine.Therefore needing monoglyceride and lysolecithin to improve emulsifying effect and to need under the situation of reducing cholesterol effect of plant sterol, this enzyme can be used for the production of oleomargarine and other oleaginous food.

Embodiment 15: derive from aeromonas salmonicida acyltransferase immobilization and solid Purposes during alcohol ester is synthetic

The acyltransferase (in this example for GCAT) that derives from aeromonas salmonicida is fixed on the Celite by the precipitating action of acetone.The 10ml enzyme solution slowly stirred 2 hours in room temperature with 0,1 gram Celite 535535 (from Fluka) in the TEA of 20mM pH7 damping fluid.

In continuing whipping process, add the 50ml cold acetone.

Throw out by separating at 5000g in centrifugal 1 minute.

Throw out washs 2 times with the 20ml cold acetone.

Celite dry 1 hour in envrionment temperature

Fixed transferase detects in the oil mixt that contains 13% phosphatidylcholinase and 7% plant sterol.(table 27)

Table 27

	％
		Avanti Yelkin TTS	12.0
Plant sterol Generol 122N	6.6
		Plam oil 43	71.4
Glycerine	5.0
		Immobilized transferring enzyme #178,45U/g	2.0
Water	3.0

Yelkin TTS, plant sterol and soybean oil are heated to 46 ℃, the dissolving plant sterol.Add immobilized transferring enzyme.

In the process with the magnetic stirring apparatus mild stirring, transferring enzyme is reflected at 46 ℃ to be continued to carry out.After 1/2,1,3,6 and 24 hour, take out sample, and carry out TLC and analyze.React termination reaction after 24 hours, leach (filter off) immobilized enzyme.

TLC analytic sample result is shown in Figure 65.

TLC analyzes the immobilized transferring enzyme clearly show from aeromonas salmonicida in the effect that cholesterol is converted in the cholesteryl ester.Also can be observed a small amount of monoglyceride forms.Enzyme is also shown in the environment of water content height (6-89%) has high activity, transferring enzyme and be used for the application that therefore other transferring enzyme of the present invention also can be used for having the immobilized enzyme of high-moisture.This just allows to substitute present immobilized lipase in the bio-transformation of the lipid that utilizes transferring enzyme.

Embodiment 16 Aeromonas hydrophila transferring enzymes can from phosphatide transfer to sterol form sterol ester and/or Transfer to glycan molecule and form sugar ester.

The acyltransferase (label #139) of expressing from Aeromonas hydrophila, in intestinal bacteria (Hydro 0303HVP) is at chelating type sepharose FF, purifying and analyze phospholipase activity on HR 2.5/10 post.In yolk, estimate transferase active and determine enzymic activity in yolk and functional.Described enzyme also can detect in containing the yolk of glucose.

Phospholipase activity

From chelating type sepharose FF, the isolating transferring enzyme #139 of HR 2.5/10 post measures with NEFA-PLU (pH7), and activity is 1,15 NEFA-PLU/ml of unit.

Yolk

In initial request test, transferring enzyme #139 detects in yolk according to following operation steps.

The 1 fresh yolk of gram weighing in the screw-topped flask of 10ml.The adding zymin is also mixed in vortex mixer.Sample is positioned over 37 ℃ and stir with magnetic stirrer.

Add the 7.5ml chloroform: methyl alcohol (2: 1) termination reaction also mixes 30 seconds in Whirley.Chloroform is also used mobile damping fluid nr.I wash-out with 2 μ l chloroform phase transitions mutually by centrifugation to preactivated silicon TLC plate, another TLC plate is wash-out in mobile damping fluid IV.

Experimental design is shown in table 28

Table 28

Test	Reaction times	Yolk	Transferring enzyme #139
				Sequence number	Minute	Gram	Unit
1	10	1
				2	10	1	0.75NEFA-PLU
3	60	1	0.75NEFA-PLU
				4	300	1	0.75NEFA-PLU
5	1200	1
				6	1200	1	0.75NEFA-PLU

TLC analyzes shown in Figure 66 and Figure 67.TLC analyzes the clear transferring enzyme reaction that has shown transferring enzyme #139.Cholesterol is converted into cholesteryl ester, and the Yelkin TTS amount reduces.Transferring enzyme #139 also acts on lysolecithin yet the result equally also illustrates, so lysolecithin only has a spot of accumulating.This observations is supported in the formation of free fatty acids (FFA).

Yolk and glucose

Initial stage has shown that the transferring enzyme (#138) from aeromonas salmonicida can utilize glucose as acceptor molecule in the transferring enzyme reaction.Whether also detected transferring enzyme (#139) can utilize glucose as acceptor molecule.Experimental design sees table 29.

Table 29

Test	Reaction times	Yolk	Glucose, 70%	Transferring enzyme #139
					Sequence number	Minute	Gram	Milligram	Unit
1	10	1	500
					2	10	1	500	1NEFA-PLU
3	60	1	500	1NEFA-PLU
					4	180	1	500	1NEFA-PLU
5	300	1	500	1NEFA-PLU
					6	1200	1	500	1NEFA-PLU
7	1200	1	500

Reaction product is analyzed (Figure 68 and Figure 69) by TLC.

The TLC analysis revealed is forming glucose ester (Figure 69 swimming lane 6) but is not observing glucose ester in reaction after 1200 minutes after 220 minutes reaction times.Therefore can have transferring enzyme and hydrolytic activity by inference transferring enzyme #139.Free fatty acids is stablized rising as the function in reaction times has also proved this point.

General introduction (resume):

Transferring enzyme from Aeromonas hydrophila detects in yolk.The result confirms the formation of this enzyme catalysis cholesteryl ester and with the formation of lysolecithin.After the reaction times that prolongs, when most of cholesterol consumes, free fatty acids also forms.Therefore can mainly have transferase active by this enzyme of inference, when having only water, also can be observed hydrolytic activity as donor molecule.

In the experiment that utilizes yolk and glucose, but the original position of observing from transferring enzyme catalysis glucose ester in the high food environment of water content of Aeromonas hydrophila forms (Figure 70).

Embodiment 17: from the variant (SEQ of the acyltransferase of Aeromonas hydrophila (Ahyd2) ID No.36 (referring to Figure 71))

Use from Stratagene, La Jolla, CA 92037, the QuikChange of USA ^Multi-SiteDirected Mutagenesis test kit is introduced sudden change, is undertaken by the explanation that Stratagene provides.

The activity that the variant that variation is positioned at tyrosine 256 shows phosphatide increases.

The variant that variation is positioned at tyrosine 256 and tyrosine 260 shows that the activity to galactolipid increases.

The variant that variation is positioned at tyrosine 265 shows to be increased the transferase active as the galactolipid of acry radical donor.

The position of numbering indication in following sequence: from the enzyme of Aeromonas hydrophila, its aminoacid sequence is shown in Figure 71 SEQ ID No.36 (underlined amino acid is represented the zytase signal peptide).Nucleotide sequence is shown in SEQ ID No 54 among Figure 72.

Embodiment 18: acyltransferase is reflected at and produces the plant sterol ester that is used to prepare oleomargarine With the purposes in the monoglyceride

The acyltransferase of expressing in subtilis, be derived from aeromonas salmonicida is comprising vegetable lecithin, and is detected in the plam oil mixture of plant sterol and glycerine.Acyltransferase shows plant sterol and the glycerine ability as acceptor molecule of utilizing in the process that produces plant sterol ester and monoglyceride.Reaction mixture is used for producing high-quality edible (table) oleomargarine based on the monoglyceride of reaction mixture, meanwhile, is rich in the plant sterol ester of decreasing cholesterol effect in the oleomargarine.

This time the purpose of experiment is research generates monoglyceride and plant sterol ester by the enzymatic reaction that is dissolved in Yelkin TTS, plant sterol and glycerine in the vegetation fat a possibility.

The acyltransferase that initial experiment shows the salmon Aeromonas that is used to commit suiside generates monoglyceride and the plant sterol ester is possible from Yelkin TTS, glycerine and plant sterol.

This time in the experiment, this reaction mixture is used to produce edible oleomargarine.

Material:

From the acyltransferase of aeromonas salmonicida, #196C101,18.6PLU/g (Journal2254-104)

Plam oil 43 is from Aarhus United, DK

L-α phosphatidylcholine 95% plant (Avanti#441601)

Plant sterol: Generol N122 is from Cognis, Germany

Glycerol product number 085915

Distilled monoglyceride, Dimodan HP is from Danisco.

The preparation of oleomargarine

1, mixing water phase composition.(if needed, water is heated to about 80 ℃ and carries out pasteurization).Be adjusted to pH5.5.

2, melt fat phase, temperature regulation is to about 40-45 ℃.

3, heating emulsifying agent, some of them oil is following ratio

The grease of 1 part of emulsifying agent than 5 parts is to certain temperature (75-80 ℃), and described temperature is than the high 5-10 of fusing point ℃ of emulsifying agent.After mixture melts fully and fully stirs, it is added in the oil that continues heating, continue to stir.

4, add food flavouring.

5, water is added to fat mutually in, continue to stir.

6, in prolong (normal capacity, normal cooling), be cooled to temperature out 8-10 ℃.

The result

The acyltransferase of detection resources suicide salmon Aeromonas is shown in table 30 in the plam oil mixture.For making the dissolving of plant sterol and Yelkin TTS, in whipping process, Yelkin TTS, plant sterol, glycerine and plam oil are heated to 60 ℃.

Table 30

Substrate	％
		Avanti Yelkin TTS plant sterol, Generol 122N plam oil, fusing point 43 glycerine	12 6.6 76.4 5

Substrate is cooled to 48 ℃, and the amount shown in the table 31 of pressing is added acyltransferase #196.Keep in slowly stirring reaction mixture 48 ℃ 24 hours.

Table 31

	Gram
		Substrate transferring enzyme #196C101,18.6PLU/g	220 15

From reaction mixture, take out sample in reaction after 1,4 and 24 hour, and in solvent I, be TLC and analyze (Figure 73).TLC result is clear to show the plant sterol ester and monoglyceride forms.In Figure 73, first swimming lane is to react after 1 hour, and swimming lane 2 is to react after 4 hours, and swimming lane 3 is to react after 24 hours, and swimming lane 4 is plant sterols.

React termination reaction after 24 hours, discard the resistates of insoluble plant sterol, settled solution is used to produce oleomargarine.

Oleomargarine

According to prescription shown in the table 32, the reaction mixture that contains monoglyceride and plant sterol ester is used to produce edible oleomargarine.

Table 32

Jour.No?3734	1	2
			Water
Water	16	16
			Salt	0.5	0.5
Skim-milk	1	1
			Potassium sorbate	0.1	0.1
EDTA	0.015	0.015
			PH	5.5	5.5
			Total water	16.6	16.6
			The fat phase
Plam oil
	43	25	25
Rapeseed oil				75	75
	Total fatty phase	83.2	78.4
Dimodan?HP				0.2
	Reaction mixture		5

The oleomargarine that produces from reaction mixture is best in quality, has good workability (spreadability), good mouthfeel and lose without any local flavor.Oleomargarine compares on quality level with the reference oleomargarine of producing with distilled monoglyceride Dimodan HP.

It is exactly hard slightly observing the unique different of oleomargarine jour.3734 no 2 and reaction mixture, and reason is that plam oil 43 contained in the prescription is bigger than the content in the reference oleomargarine.

Embodiment 19: the purposes of acyltransferase in bread manufacture

When making bread, one of limitation of using lipase is to have free fatty acids to form in the lipase reaction process.As everyone knows, too much free fatty acids forms and will the cured effect of flour be had a negative impact, and reason is that gluten becomes too firmly and the dough of stiff (bucky) (being flexibility decrease) forms, and it can not expand in fermentation and bake process.

From the antioxidative stabilizer angle, also should avoid forming free fatty acids, reason is that free fatty acids is easier to take place lipid oxidation than corresponding triglyceride level.

Among the present invention; adding lipolytic enzyme in dough causes the problem of free fatty acids formation to overcome with the method for adding acyltransferase; acyltransferase does not produce free fatty acids; and with one or more lipid acid on the lipid acry radical donor is transferred to non-water acceptor molecule the dough; as carbohydrate, albumen or peptide chain; if perhaps be used for containing dairy fats bread; sterol is optional or unite with the acceptor that other is listed above and to add in the dough described sterol such as plant sterol or phytostanol to.Preferably, the acceptor molecule in the dough may be that glucose, sucrose or maltose and/or other are commonly used in one or more materials in the carbohydrate in the dough.

In following experiment, in miniature baking experiment, detect acyltransferase.The formation of reaction product fully proofs lipid composition in (fully proved) dough of shaping by water saturated butyl alcohol extraction, and analyzes by HPLC and GLC.

Materials and methods

Enzyme: acyltransferase, 550PLU-7/ml

Lipopan ^TMCommercial lipases .12000LIPU/g that F BG, Novozymes. provide or Grindamyl Exel 16.12000 LIPU/g

The Yelkin TTS powder, 95% phosphatide (Danisco A/S Denmark provides)

Digalactosyl diglyceride is from whole wheat (face) powder (from SigmaD4651)

Flour: S  lvmel nr.2001084 (Denmark's wheat-flour, from Havnemollerne, Odense, Denmark)

Miniature baking experiment

Flour 50 gram, dry yeast 10 grams, glucose 0.8 gram, salt 0.8 gram, the water of 70ppm xitix and 400Brabender unit mix in the bowl at 50 gram Brabender, 30 ℃ of kneadings 5 minutes.

34 ℃ left standstill 10 minutes.The dough that dough is divided into each 15 gram.Be shaped in a special device then, wherein dough twists between treucher and the resin glass support.Described dough in jar 34 ℃ proof 45 minutes, in the Voss domestic ovens 225 ℃ the baking 8 minutes.

After the baking, make bread be cooled to room temperature.Weighing bread is also with Semen Brassicae campestris substitution method (rapeseed displacement method) measurement volumes after 20 minutes.Bread also is cut open, and estimates dough flesh (crumb) and bread shell (crust).

Result and conclusion:

PRELIMINARY RESULTS shows that acyltransferase all demonstrates tangible active effect for the volume and the outward appearance of bread.Particularly, PRELIMINARY RESULTS show with the contrast (no enzyme) and with the commodity in use lipolytic enzyme be Grindamyl Exel 16 or LipopanF ^TMIn time, compared, and uses acyltransferase that specific surface inclusion long-pending (spcific bread volume) is increased.

Embodiment 20: the standard ice-creams that utilizes butterfat

Be used for ice-cream emulsifying agent and can produce in check fat crystallizationization and slight stabilization removal, this is owing to protein adsorption effect in ice-cream ageing (aging) process causes.This change has improved the ice-creams quality.Monoglyceride or triglyceride are generally used for icecream production, also known the associating in the icecream production process used polarity emulsifying agent such as polysorbate and sugar ester and glycerine list-diester (mono-diglyceride), help to control fatty stabilization removal, the ice-creams of production has good cream texture and the sliding mouthfeel of children.

The ice-creams emulsifying agent adds ice cream mix to powder form usually.But recently shown and used lipase that the fat in the ice-creams prescription is carried out enzymatic reaction, can produce glycerine list-diester.But the problem that is to use lipase to bring is when having water in the reaction mixture, and lipase is the formation of catalysis free fatty acids also.

But, it is shocking that acyltransferase has overcome the defective of lipase, because acyltransferase can be transferred to acceptor molecule such as sterol from Yelkin TTS and other lipid with lipid acid; cholesterol; glucose, glycerine and albumen/peptide chain, and do not form a large amount of free fatty acidies.

One of main component in the ice-creams is the breast system cream (diary cream) that contains 38% butterfat.Breast system cream also comprises a spot of Yelkin TTS, and Yelkin TTS is the donor molecule of acyltransferase.(“contains?smaller?amount?of?lecithin，which?is?a?donor?molecule?foracyl-transferase.(“Complex?milk?lipids?account?for?about?1％of?the?total?milkfat?and?are?mainly?composed?of?phospholipids”Ref.Mllmann′s?Encyclopedia?ofIndustrial?ChemistryCopyright2003by?Wiley-VCH?Verlag?GmbH?&?Co.KGaA.)。Breast system cream also contains on a small quantity the cholesterol as the acceptor molecule of acyltransferase.

According to ice-cream moiety, might produce monoglyceride and polarity emulsifying agent, as lysolecithin and sugar ester, these are useful for icecream production.

Another beneficial effect of acyltransferase reaction is to form cholesteryl ester, this cholesterol absorption in enteron aisle of can slowing down in breast system cream.

The ice-creams prescription

	Add emulsifying agent	Enzyme-added
			Breast system cream, 38%	23,65	23,65
Skimmed milk	53,30	53,30
			Skim- milk	4,90	11,30
Sugar	12,00	12,00
			Dextrose syrup DE 42,75% TS	4,25	4,25
Glycerine	1,0	1,0
			Stabilizer blend (blend)	0,2	0,2
?Cremodan?SE30	0,6
			Acyltransferase 500 PLU/ g		0,1
The Grindsted food flavouring	0,1	0,1
			Color	+	+

The icecream production process

1. with breast system cream, dextrose syrup and glycerine are heated to about 40 ℃.Add acyltransferase, and allow mixture reaction 30 minutes.Taking out sample is used for analyzing.

2. heat all other lipid composition to about 40 ℃.

3. add other dry ingredient.(before the interpolation, first mixed stability agent composition (stabiliser blend) and sugar)

4. when the dry ingredient dissolving, add breast system cream-glucose mixture.

5.80-85 ℃ pasteurization 20-40 second.

6.80 ℃ homogenate (prescription 1,190 crust; Prescription 2,175 crust)

7. be cooled to the ageing temperature, 4 ℃

8. freezing to desired overrun (desired overrun) (suggestion 100%) in continuing refrigerated tank

9.-40 ℃ of sclerosis in pipeline (tunnel)

10.-25 preserve below ℃

The result:

Compare with the ice-creams of commodity in use emulsifying agent Cremodan SE 30 preparations, it is splendid to use acyltransferase to help to produce taste in the icecream production process, the good ice-creams of cream taste.Ice-cream melting phenomenon by acyltransferase production also has improvement.

Embodiment 21: the acyltransferase in the cheese

Cheese is by solidifying milk, skimmed milk, partly defatted milk, cream, whey butter, or buttermilk, or any combination of these materials, by the effect of rennet (rennet) or other suitable setting accelerator, part is discharged the described whey that is produced of solidifying, fresh or sophisticated solid or the semi-solid product made.

Cheese yield mainly depends on fat and the protein ingredient in the milk.Salt (specifically being calcium salt) and protein concentrate also have acidity, and be extremely important for solidifying.(ref.? Mllmann′s?Encyclopedia?of Industrial?Chemistry?Copyright2003by?Wiley-VCH?Verlag?GmbH?&?Co)。

Described effort is to be optimization and increase cheese yield, and it can improve clotting method (USP 4,581,240) realization by the optimization (USP 4,959,229) of cheese production program or by using, and a kind of method in back can increase the content of whey-protein in the curdled milk.

In the present invention, use acyltransferase to prepare in the cheese process,, the content of whey-protein in the curdled milk is increased by the enzymatically modifying whey-protein by processing to milk.

When lipid acid and non-film albumen such as beta-lactoglobulin covalent attachment, its physics will significantly change with characteristic function.

Be cheese production of the present invention, in milk, add before the rennet or simultaneously acyltransferase is added in the milk.

In the sedimentary process of casein, acyltransferase can utilize other lipid in Yelkin TTS and the milk as donor in the peptide chain process of albumen that forms acidylate or acidylate, and peptide or albumen are as acceptor molecule.

The hydrophobic change of milk-protein helps to increase the albumen precipitation in the curdled milk in the cheese production process.

Increase because the cheese yield increase that the present invention obtains comes from the reservation amount of albumen in cheese coagulum that raising usually is lost in the whey, therefore a kind of directly relevant with the present invention's mechanism proper method is to be based upon on the basis of the final protein content in the mensuration whey.Albumen in the whey is few more must to mean that the albumen in the curdled milk is many more, and cheese yield is also high more.

The mensuration of protein content contains and can carry out by the following method in the whey.In the 100ml beaker, degreasing or whole milk are heated to the temperature that suitable rennet solidifies, normally 30-35 ℃.Batch milk-acid bacteria bottle opener (bulk lactic acid bacteria starter) of optional interpolation 1%, and add the standard rennet of respective amount (for example 0.03-0.05%).When milk is transformed into grumeleuse, thereby its hardness enough allows to be cut into the fritter of about length of side 0.5cm greatly, carries out described cutting with sharp cutter.Thereby the synerisis beginning keeps making the curdled milk sedimentation after 30 minutes, takes out whey sample, uses centrifugal 10 minutes of laboratory centrifuge.With for example protein content of this sample of Kjeldahl methods analyst.Alternatively, and/or as a supplement, sample should be by determining the type and the method for quality analysis of independent protein ingredient.

Embodiment 22 " assay method in the low moisture environment "

The transferring enzyme reaction of lipolytic enzyme in the low water content environment.

Operation steps

Material

Cholesterol Sigma catalogue .C 8503

L-α-phosphatidylcholine 95% (plant) Avanti#441601

Soybean oil, Aarhus United, DK.

Chloroform, AG

Enzyme

#179, GCAT is from aeromonas salmonicida

#2427, phospholipase A1 be from sharp sickle spore (Fusarium oxysporum), and LIPOPAN  F is from Novozymes, Denmark

#1991, from the Phospholipase A2 of pancreas, LIPOMOD 22L is from Biocatalysts, UK

#2373, South Pole candidiasis (Candida antarctica) lipase, Novozyme 525L is from Novozymes Denmark.

Enzymatic determination

By in whipping process, being heated to 60 ℃, make 13.1% Yelkin TTS and 6.6% cholesterol be dissolved in soybean oil

With 20ml Wheaton glass cylinder weighing substrate and be heated to 46 ℃

Interpolation water and enzyme solution also picks up counting

With regular intervals with the 50mg sample transfer in the 10ml Dram glass cylinder and freezing

Isolated lipid is analyzed by GLC

GLC analyzes

GLC analyzes and presses embodiment 11 described enforcements

The result

Experimental design is shown in table 33

To be heated to 46 ℃ based on the substrate of the soybean oil that contains 13.1% Yelkin TTS and 6.6% cholesterol.The interpolation enzyme solution also picks up counting.

React after 30,60 and 120 minutes, sample thief is GLC and is analyzed.

Table 33

		1	2	3	4	5
							Substrate	Gram		5	5	5	5	5
Transferring enzyme #179-C72,56PLU-7/ml	ml		0.3
							#2427，200PLU-7/ml	ml			0.3
Pancreas PLA 2#19916300PLU/ml	ml				0.3
							Novozyme?525L，#2373，200LIPU/ml	ml					0.3
Water	ml	0.3
							% water		6	6	6	6	6

GLC result is shown in table 34.The result is to represent based on the gross sample percentages of ingredients.Based on GLC result, can calculate not enzyme-added control sample relatively, by the lipid acid of enzyme reaction generation and the amount of cholesteryl ester.Under such experiment condition, overall enzymic activity can be estimated with hydrolytic activity (forming mensuration by free fatty acids) and transferase active (estimating by cholesteryl ester formation).Can calculate relative mole hydrolytic activity and relative mole transferase active from these results and lipid acid with the molecular weight information of cholesteryl ester, shown in table 35.

Table 34

Enzyme	The reaction times branch	Lipid acid %	Cholesterol %	Cholesteryl ester %
					Contrast #179 #179 #179 #2427 #2427 #2427 #1991 #1991 #1991 #2373 #2373 #2373	120 30 60 120 30 60 120 30 60 120 30 60 120	0.533 0.770 0.852 0.876 3.269 3.420 3.710 2.871 3.578 3.928 1.418 1.421 1.915	7.094 5.761 5.369 4.900 7.094 7.094 7.094 7.094 7.094 7.094 7.094 7.094 7.094	0.000 2.229 2.883 3.667 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000

Table 35

Enzyme	Reaction times minute	The lipid acid that produces	The cholesterol that consumes	The cholesteryl ester that produces	Hydrolytic activity %	Transferase active %
							?#179 ?#179 ?#179 ?#2427 ?#2427 ?#2427 ?#1991 ?#1991 ?#1991 ?#2373 ?#2373 ?#2373	30 60 120 30 60 120 30 60 120 30 60 120	0.238 0.319 0.343 2.737 2.887 3.177 2.338 3.046 3.395 0.885 0.888 1.383	1.334 1.725 2.195 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000	2.229 2.883 3.667 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000	20 21 18 100 100 100 100 100 100 100 100 100	80 79 82 0 0 0 0 0 0 0 0 0

Conclusion

Can be observed all detected enzymes and all showed hydrolytic activity in these experiments, this is because the amount of lipid acid increases.But only the GCAT from aeromonas salmonicida shows transferase active.Therefore inference from the phospholipase A1 of sharp sickle spore, has only hydrolytic activity from the Phospholipase A2 of pancreas with from the oidiomycetic lipase in the South Pole in having oiliness system Yelkin TTS and cholesterol, that contain 6% water.

The disclosed content of all that mention in the top specification sheets is included in herein as a reference.The different modifying of the inventive method and system and change are clearly and not can depart from scope and spirit of the present invention to those skilled in the art.Although the present invention is described according to preferred specific embodiments, it is understandable that the scope of claim protection of the present invention should not be limited to these specific embodiments inadequately.In fact, be well-known to the various modifications of the described pattern that is used to realize invent for biochemical field and physiotechnology field or those of ordinary skill in the related art, intention is included in the protection domain of following claim.

Budapest treaty is about the microbial preservation of the international endorsement that is used for patented procedure

The international office form

Danisco (Danisco A/S)

Langebrogade?1

DK-1001?Copenhagen

Denmark

Preservation people's name and address

¹When being applicable to detailed rules and regulations 6.4 (d), the described date is the date that the qualification of international depositary institution is assert.Form sp/4 (one page thus much)

Budapest treaty is about the microbial preservation of the international endorsement that is used for patented procedure

The international office form

Danisco (Danisco A/S) survival proof

Langebrogade 1 is protected by the specified world of following one page

DK-1001Copenhagen hides unit and provides according to detailed rules and regulations 10.2

Denmark

Should receive this survival proof

The title of unit and address

1 refers to initial preservation day, perhaps, when having carried out the conversion of new preservation or preservation, refers to the maximally related date (date of new preservation or the date of changeing preservation).

2 for the (ii) and (iii) situation of representative of those rules 10.2 (a), refers to nearest viability check.

3 usefulness are made fork and are represented to select.

IV. implement the condition of viability check 4
V. international depositary institution
		Title: NCIMB Ltd. address: 23 St Machar Drive Aberdeen AB243RY Scotland	The official's that can represent international depositary institution or be authorized to people's signature: date: on January 9th, 2004

If, then fill in this if 4 require this information and verify as feminine gender.

Budapest treaty is about the microbial preservation of the international endorsement that is used for patented procedure

The international office form

Danisco (Danisco A/S)

Langebrogade?1

DK-1001?Copenhagen

Denmark

Preservation people's name and address

When being applicable to detailed rules and regulations 6.4 (d), the described date is the date that the qualification of international depositary institution is assert.Form sp/4 (one page thus much)

Budapest treaty is about the microbial preservation of the international endorsement that is used for patented procedure

The international office form

Danisco (Danisco A/S) survival proof

Langebrogade 1 is protected by the specified world of following one page

DK-1001Copenhagen hides unit and provides according to detailed rules and regulations 10.2

Denmark

Should receive this survival proof

The title of unit and address

1 refers to initial preservation day, perhaps, when having carried out the conversion of new preservation or preservation, refers to the maximally related date (date of new preservation or the date of changeing preservation).

2 for the (ii) and (iii) situation of representative of those rules 10.2 (a), refers to nearest viability check.

3 usefulness are made fork and are represented to select.

IV. implement the condition of viability check 4
V. international depositary institution
		Name: NCIMB Ltd. address: 23St Machar Drive Aberdeen AB24 3RY Scotland	The official's that can represent international depositary institution or be authorized to people's signature: date: on January 9th, 2004

If, then fill in this if 4 require this information and verify as feminine gender.

Claims (43)

1, a kind of in food the method for produced in situ emulsifying agent, this method comprises adds acyltransferase in the food step.

2, the described method of claim 1 wherein has at least two kinds of emulsifying agents to generate.

3, the described method of claim 1 or claim 2 generates under the situation that the free fatty acids of wherein said emulsifying agent in food do not increase or do not increase substantially.

4, any described method of claim 1-3; wherein said acyltransferase is a kind of like this enzyme, and it can transfer to the following acyl acceptor one or more from lipid with acyl group: sterol, stanol, carbohydrate, protein or its subunit, glycerine.

5, the described method of claim 2, wherein at least a emulsifying agent is the carbohydrate ester.

6, the described method of claim 2, wherein at least a emulsifying agent is the protein ester.

7, aforementioned any described method of claim, wherein the original position in food of one or more in sterol ester or stanol ester or protein ester or carbohydrate ester or triglyceride or the monoglyceride generates.

8, the described method of claim 7, wherein said sterol ester are one or more α-Gu Zaichun esters, β-Gu Zaichun ester, Stigmasterol ester, etembonate alcohol ester, Brassicasterin ester or cholesteryl ester.

9, the described method of claim 6, wherein said stanol ester are one or more β-Gu Zaichuns or ss-Sitosterol.

10, any described method of aforementioned claim, wherein said acyltransferase are characterised in that it is a kind of like this enzyme, and it has acyltransferase activity; and comprise amino acid motif GDSX, wherein X is one or more residues in the following amino-acid residue: L, A; V, I, F; Y; H, Q, T; N, M or S.

11, any described method of aforementioned claim; wherein said acyltransferase comprises H-309; or comprising histidine residues, this Histidine is arranged in the corresponding position of His-309 with the aminoacid sequence of Aeromonas hydrophila lipolytic enzyme shown in SEQ ID No.2 or the SEQ ID No.32.

12, any described method of aforementioned claim, wherein said acyltransferase can obtain from the organism of dependent of dead military hero under one or more: Aeromonas, streptomycete, yeast, galactococcus, mycobacterium, suis, Bacterium lacticum, desulfiting bacterium, genus bacillus, Campylobacter, vibrionaceae, rod bacterium, sulfolobus solfataricus, aspergillus, fission yeast, Listera spp, Neisseria gonorrhoeae, Mesorhizobium, Lei Er Salmonella, Xanthomonas campestris and candidiasis.

13, any described method of aforementioned claim, wherein said acyltransferase comprises one or more following aminoacid sequences: (i) aminoacid sequence shown in the SEQ ID No.2; (ii) aminoacid sequence shown in the SEQID No.3; (iii) aminoacid sequence shown in the SEQ ID No.4; (iv) aminoacid sequence shown in the SEQ ID No.5; (v) aminoacid sequence shown in the SEQ ID No.6; (vi) aminoacid sequence shown in the SEQ ID No.12; (vii) aminoacid sequence shown in the SEQ ID No.20; (viii) aminoacid sequence shown in the SEQ ID No.22; (ix) aminoacid sequence shown in the SEQ ID No.24; (x) aminoacid sequence shown in the SEQ ID No.26; (xi) aminoacid sequence shown in the SEQ ID No.28; (xii) aminoacid sequence shown in the SEQ ID No.30; (xiii) aminoacid sequence shown in the SEQ ID No.32; (xiv) aminoacid sequence shown in the SEQ ID No.34, perhaps with SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.12, SEQ ID No.20, SEQ ID No.22, SEQ ID No.24, SEQ ID No.26, SEQ ID No.28, SEQ ID No.30, SEQ ID No.32, or any one sequence shown in the SEQ ID No.34 has the aminoacid sequence of 75% or 75% above identity.

14, any described method of aforementioned claim, wherein said emulsifying agent is one or more in the following material: monoglyceride, lyso-phosphatidylcholine, DGMG.

15, the purposes of acyltransferase the food that comprises emulsifying agent from the foodstuff raw material preparation; generate under the situation that the free fatty acids of wherein said emulsifying agent in food do not increase or do not increase substantially, described emulsifying agent produces from the foodstuff raw material component by acyltransferase.

16, the described purposes of claim 15 wherein has at least two kinds of emulsifying agents to generate.

17, the described purposes of claim 16, wherein at least a emulsifying agent is the carbohydrate ester.

18, the described purposes of claim 16, wherein at least a emulsifying agent is the protein ester.

19, any described purposes among the claim 15-18, wherein also original position generation in food of one or more sterol esters or stanol ester or protein ester or carbohydrate ester or triglyceride or monoglyceride.

20, the described purposes of claim 19, wherein said sterol ester are one or more materials in α-Gu Zaichun ester, β-Gu Zaichun ester, Stigmasterol ester, etembonate alcohol ester, Brassicasterin ester or the cholesteryl ester.

21, the described purposes of claim 20, wherein said stanol ester are one or more β-Gu Zaichuns or ss-Sitosterol.

22, any described purposes among the claim 15-21, wherein said acyltransferase are characterised in that it is a kind of like this enzyme, and it has acyltransferase activity; and comprise amino acid motif GDSX, wherein X is one or more residue in the following amino-acid residue: L, A; V, I, F; Y; H, Q, T; N, M or S.

23, any described purposes among the claim 15-22; wherein said acyltransferase comprises H-309; or comprising histidine residues, this Histidine is arranged in the corresponding position of His-309 with the aminoacid sequence of Aeromonas hydrophila lipolytic enzyme shown in SEQ ID No.2 or the SEQ IDNo.32.

24, any described purposes among the claim 15-23, wherein said acyltransferase can obtain from the organism of dependent of dead military hero under one or more: Aeromonas, streptomycete, yeast, galactococcus, mycobacterium, suis, Bacterium lacticum, desulfiting bacterium, genus bacillus, Campylobacter, vibrionaceae, rod Pseudomonas, sulfolobus solfataricus, aspergillus, fission yeast, Listera spp, Neisseria gonorrhoeae, Mesorhizobium, Lei Er Salmonella, Xanthomonas campestris and candidiasis.

25, any described purposes among the claim 15-24, wherein said acyltransferase comprises one or more following aminoacid sequences: (i) aminoacid sequence shown in the SEQ ID No.2; (ii) aminoacid sequence shown in the SEQID No.3; (iii) aminoacid sequence shown in the SEQ ID No.4; (iv) aminoacid sequence shown in the SEQ ID No.5; (v) aminoacid sequence shown in the SEQ ID No.6; (vi) aminoacid sequence shown in the SEQ ID No.12; (vii) aminoacid sequence shown in the SEQ ID No.20; (viii) aminoacid sequence shown in the SEQ ID No.22; (ix) aminoacid sequence shown in the SEQ ID No.24; (x) aminoacid sequence shown in the SEQ ID No.26; (xi) aminoacid sequence shown in the SEQ ID No.28; (xii) aminoacid sequence shown in the SEQ ID No.30; (xiii) aminoacid sequence shown in the SEQ ID No.32; (xiv) aminoacid sequence shown in the SEQ ID No.34, perhaps with SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.12, SEQ ID No.20, SEQ ID No.22, SEQ ID No.24, SEQ ID No.26, SEQ ID No.28, SEQ ID No.30, SEQ ID No.32, or any one sequence shown in the SEQ ID No.34 has the aminoacid sequence of 75% or 75% above identity.

26, any described purposes among the claim 15-25, wherein said emulsifying agent is one or more in the following material: monoglyceride, lyso-phosphatidylcholine, DGMG.

27, a kind of enzyme food composition or feed enzyme composition, it contains acyltransferase.

28, described enzyme food composition of claim 27 or feed enzyme composition, wherein said acyltransferase are characterised in that it is a kind of like this enzyme, and it has acyltransferase activity; and comprise amino acid motif GDSX, wherein X is one or more residue in the following amino-acid residue: L, A; V, I, F; Y; H, Q, T; N, M or S.

29, claim 27 or 28 described enzyme food composition or feed enzyme compositions; wherein said acyltransferase comprises H-309; or comprising histidine residues, this Histidine is arranged in the corresponding position of His-309 with the aminoacid sequence of Aeromonas hydrophila lipolytic enzyme shown in SEQ IDNo.2 or the SEQ ID No.32.

30, any described enzyme food composition or feed enzyme composition among the claim 27-29, wherein said acyltransferase can obtain from the organism of dependent of dead military hero under one or more: Aeromonas, streptomycete, yeast, galactococcus, mycobacterium, suis, Bacterium lacticum, desulfiting bacterium, genus bacillus, Campylobacter, vibrionaceae, rod Pseudomonas, sulfolobus solfataricus, aspergillus, fission yeast, Listera spp, Neisseria gonorrhoeae, Mesorhizobium, Lei Er Salmonella, Xanthomonas campestris and candidiasis.

31, any described enzyme food composition or feed enzyme composition among the claim 27-30, wherein said acyltransferase comprises one or more following aminoacid sequences: (i) aminoacid sequence shown in the SEQ ID No.2; (ii) aminoacid sequence shown in the SEQ ID No.3; (iii) aminoacid sequence shown in the SEQ ID No.4; (iv) aminoacid sequence shown in the SEQ ID No.5; (v) aminoacid sequence shown in the SEQ ID No.6; (vi) aminoacid sequence shown in the SEQ ID No.12; (vii) aminoacid sequence shown in the SEQ ID No.20; (viii) aminoacid sequence shown in the SEQ ID No.22; (ix) aminoacid sequence shown in the SEQ ID No.24; (x) aminoacid sequence shown in the SEQ ID No.26; (xi) aminoacid sequence shown in the SEQ ID No.28; (xii) aminoacid sequence shown in the SEQ ID No.30; (xiii) aminoacid sequence shown in the SEQ ID No.32; (xiv) aminoacid sequence shown in the SEQ ID No.34, perhaps with SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.12, SEQ ID No.20, SEQ ID No.22, SEQ ID No.24, SEQ ID No.26, SEQ ID No.28, SEQ ID No.30, SEQ ID No.32, or any one sequence shown in the SEQ ID No.34 has the aminoacid sequence of 75% or 75% above identity.

32, among the claim 27-31 any described enzyme food composition or feed enzyme composition according to purposes any among the claim 15-26, or in claim 1-14 the purposes in any one method.

33, a kind of food, any described method obtains among its available claim 1-14.

34, a kind of immobilized acyltransferase.

35, the described immobilized acyltransferase of claim 34, wherein said acyltransferase are characterised in that it is a kind of like this enzyme, and it has acyltransferase activity; and comprise amino acid motif GDSX, wherein X is one or more residue in the following amino-acid residue: L, A; V, I, F; Y; H, Q, T; N, M or S.

36, the described immobilized acyltransferase of claim 34 or claim 35; wherein said acyltransferase comprises H-309; or comprising histidine residues, this Histidine is arranged in the corresponding position of His-309 with the aminoacid sequence of Aeromonas hydrophila lipolytic enzyme shown in SEQID No.2 or the SEQ ID No.32.

37, any described immobilized acyltransferase among the claim 34-36, wherein said acyltransferase can obtain from the organism of dependent of dead military hero under one or more: Aeromonas, streptomycete, yeast, galactococcus, mycobacterium, suis, Bacterium lacticum, desulfiting bacterium, genus bacillus, Campylobacter, vibrionaceae, rod Pseudomonas, sulfolobus solfataricus, aspergillus, fission yeast, Listera spp, Neisseria gonorrhoeae, Mesorhizobium, Lei Er Salmonella, Xanthomonas campestris and candidiasis.

38, any described immobilized acyltransferase among the claim 34-37, wherein said acyltransferase comprises one or more following aminoacid sequences: (i) aminoacid sequence shown in the SEQ ID No.2; (ii) aminoacid sequence shown in the SEQ ID No.3; (iii) aminoacid sequence shown in the SEQ ID No.4; (iv) aminoacid sequence shown in the SEQ ID No.5; (v) aminoacid sequence shown in the SEQ ID No.6; (vi) aminoacid sequence shown in the SEQ ID No.12; (vii) aminoacid sequence shown in the SEQ ID No.20; (viii) aminoacid sequence shown in the SEQ ID No.22; (ix) aminoacid sequence shown in the SEQ ID No.24; (x) aminoacid sequence shown in the SEQ ID No.26; (xi) aminoacid sequence shown in the SEQ ID No.28; (xii) aminoacid sequence shown in the SEQ ID No.30; (xiii) aminoacid sequence shown in the SEQ ID No.32; (xiv) aminoacid sequence shown in the SEQ ID No.34, perhaps with SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.12, SEQ ID No.20, SEQ ID No.22, SEQ ID No.24, SEQ ID No.26, SEQ ID No.28, SEQ ID No.30, SEQ ID No.32, or any one sequence shown in the SEQ ID No.34 has the aminoacid sequence of 75% or 75% above identity.

39, a kind of evaluation is suitable for the method for acyltransferase of the present invention, wherein this method comprises the steps, promptly use " the transferring enzyme assay method in the low moisture environment ", one or more method testing goal enzymes in " the transferring enzyme assay method in the high-moisture yolk " or " the transferring enzyme assay method in the buffered substrate " are selected the acyltransferase with following one or more character: (a) when using " the transferring enzyme assay method in the low moisture environment ", 30,20, or has at least 1% relative transferase active when detecting after 120 minutes; (b) when using " the transferring enzyme assay method in the high-moisture yolk " when in moisture 54% yolk, detecting, has 100% relative transferase active at the most; Perhaps (c) has at least 2% acyltransferase activity when using " the transferring enzyme assay method in the buffered substrate " detection.

40, the described method of claim 39, wherein select such acyltransferase, this enzyme has character two or more in the following character: (a) when using " the transferring enzyme assay method in the low moisture environment ", have at least 1% relative transferase active when detecting after 30,20 or 120 minutes; (b) when using " the transferring enzyme assay method in the high-moisture yolk " when in moisture 54% yolk, detecting, has 100% relative transferase active at the most; Perhaps (c) has at least 2% acyltransferase activity when using " the transferring enzyme assay method in the buffered substrate " detection.

41, the described method of claim 39, wherein select such acyltransferase, this enzyme has the character more than three kinds in the following character: measure after (a) passing through the time period that is selected from 30,20 or 120 minutes when using " low moisture environment transferring enzyme assay method ", obtain at least 1% relative transferase active; (b) when detecting moisture 54% yolk, use " shifting enzyme assay in the high-moisture yolk ", obtain 100% relative transferase active at the most; Perhaps (c) obtains at least 2% transferase active when using " shifting enzyme assay in the buffered substrate ".

42, the described method of claim 39, wherein select such acyltransferase, this enzyme has all character in the following character: measure after (a) passing through the time period that is selected from 30,20 or 120 minutes when using " low moisture environment transferring enzyme assay method ", obtain at least 1% relative transferase active; (b) when detecting moisture 54% yolk, use " shifting enzyme assay in the high-moisture yolk ", obtain 100% relative transferase active at the most; Perhaps (c) obtains at least 2% transferase active when using " shifting enzyme assay in the buffered substrate ".

43, acyltransferase, its utilization is identified according to method any among the claim 39-42.

Images