CN1737162A - EGF-R ELISA (EGFR) gene sequencing detection method - Google Patents

Abstract

The present invention relates to a kind of epidermal growth factor receptor gene determination method, belong to Protocols in Molecular Biology social application field. EGFR the 18th, the 19 and 21 exon genes fragments of the present invention's design, can be one by one from base and amino acid levels and distinctive this gene sequence characteristic of observation analysis Chinese and sudden change characteristics, it is the new heterozygosity sudden change that is not reported both at home and abroad that the 21st extron T that the inventor finds＞G sudden change and A＞T and 852 bit codons begin to insert the G sudden change, for the identification of the treatment of Chinese's targeted drug, pointed. The invention provides a kind of detection method of the EGFR of detection gene mutation, determine again whether take medicine after the detection, can obviously control the adverse side effect of Gefitinib, reduce unnecessary financial burden, the good result of prompting non-small cell lung cancer molecular targeted agents treatment.

Description

EGF-R ELISA (EGFR) gene sequencing detection method

Technical field

The present invention relates to a kind of detection method of gene, the present invention relates to more precisely a kind of epidermal growth factor receptor gene determination method. Belong to technical field of molecular biology.

Background technology

About EGF-R ELISA (EGFR) and micromolecular inhibitor gene target medicine Gefitinib (gefitinib) thereof, Epidermal Growth Factor Receptor Family is the door albumen of cellular signal transduction system, separates successfully first in nineteen fifty. Show known four hypotypes that have, namely Erb-B-1, Erb-B-2, and Erb-B-3 and Erb-B-4., at present foremost is Erb-B-1 and Erb-B-2 hypotypes, they are respectively by Her₁And Her₂Proto-oncogene produces, Her₁Namely be the functional gene that produces EGFR, Her₂To produce Neu (Cerb-B₂) functional gene. EGFR has the three functions territory inside and outside cell, be cell membrane outskirt, cross-film district and cytoplasmic domain, the former is take EGF EGF and transforminggrowthfactor-α (TGF α) as part, the latter has tyrosine kinase activity, with autophosphorylation occurs behind the ligand binding, thereby the reaction of active cell signal conduction waterfall.

Generation and the growth relationship of EGFR and cancer are close:

A, cross-film district and cytoplasmic domain amino acid sequence and retrovirus oncogene v-erb-B homology;

B, most tumors cell transition are expressed EGFR₁And EGFR₂, and be proportionate with grade malignancy.

C, many tumours be overexpression EGFR part TGF-α also, the two common tumor proliferation that promotes, therefore the FDA of U.S. government has ratified the little molecular gene target drug that U.S. A Silikang (Aotrazeneca) company produces-EGFR tyrosine kinase inhibitor Gefitinib (gefifinib in May, 2003, trade name Iressa, ZD1839) listing, China ratifies its listing in February, 2005. It can compete the ATP-binding site in conjunction with cancer cell EGFR kinase function district specifically, thereby has suppressed this kinase whose activity, suppresses growth, the propagation of tumour, but without harmful effects such as obvious side effects of chemotherapy. China carries out the reported in literature of treated with gefitinib after the EGFR of detection gene mutation is not yet arranged at present, but analyzes this gene mutation rate of Chinese Patients with Non-small-cell Lung apparently higher than American-European white man and Black people, becomes this medicine in the obvious principal element of China's curative effect. The development of molecular targeted agents, be based on cancer and be and result from the pathogenetic understanding of the unusual cause of disease of cell DNA 26S Proteasome Structure and Function, be intended to seek its special gene morbidity link and target spot and targetedly accurately treatment, but full of twists and turns in clinical practice, aberrant, it is the medicine of the treatment chronic myelocytic leukemia that designs for Abl fusion target spot at first such as Gleevec, its curative effect does not but reach desirable designing requirement, but showing magical curative effect aspect the treatment of the gastrointestinal stromal tumor that is difficult to chemotherapy, recognized afterwards that the target spot of this medicine also acted on the c-kit gene of GIST, the curative effect that Gleevec is found in more clinical practice is relevant with the Immunohistochemical Expression positive of the c-kit gene proteins CD117 of GIST, so whether positive, become the routine of Gleevec molecular targeted agents treatment if now gastrointestinal stromal tumor being detected the CD117 expression in advance. And Gefitinib is by the logic theory of Japanese according to its epidermal growth factor receptor inhibitor at first; be applied to epithelial malignancy particularly EGFR gene molecule target spot and its introne CA repetitive sequence polytropy gene therapy of colorectal cancer; but find in clinical practice; it is treated epithelial malignancy; control tumor growth with non-small cell lung cancer; subtract pain; cough-relieving; the Zhichuan texts is obvious; later on by the U.S.; Canada and Japan Clinic doctors have organized the clinical use surveyllance of meticulousr science; but the mechanism based on its targeted drug; must find out lung non-small cell lung cancer corresponding relation of the morbidity of EGFR gene target spot and central aspects particularly on gene level; finally by publishing the article before and after " science " and " the New England's magazine " and having drawn almost consistent conclusion: the EGFR exons 18 of non-small cell lung cancer; 19 and 21 exist sudden change and large fragment deletion; thereby abnormal expression is active; impel tumor proliferative; and its apoptosis is induced in Gefitinib clinical effect ATP functional areas and block the effect of its short tumor proliferative in the EGFR endochylema. This report is obtained world's tumour circle and is generally acknowledged by the issue of Most authority magazine, is applied to clinically so obtain very soon drugs approved by FDA, and the short several months, this medicine has accumulated 30,000 9 thousand people's data by the EAP plan.

Because the curative effect of Gefitinib is relevant with the EGFR gene mutation, and Japan and Chinese EGFR mutation rate are higher than American-European and Black people's decades of times, " science " the American-European and Black people's non-small cell lung cancer EGFR mutation rate of report only 2% of publishing the article, and Japan reaches 28%, the extensive clinical application result of American I NTACT shows that this medicine uses scope extremely limited to American-European and Black people, compare inefficacy difference with chemotherapeutics, with regard to the U.S.'s 200,000,000 populations, 0.7 ‰ lung cancer morbidity rate is calculated, annual newly-increased lung cancer less than 100,000 people, 2% Gefitinib susceptibility rate wherein, this medicine is suitable for 500 people/years of number less than, and the Asia has 10 times to the population of the U.S. and 10 times to U.S.'s susceptibility rate, the applicable crowd of annual medicine more than at least 5 ten thousand, such as everyone expensive 10,000 U.S. dollars, just reach the amount in 500,000,000 U.S. dollar/years, the EGFR gene population that detects in addition various tumours can reach 10 times to the susceptibility population of lung cancer, offshore company is in the Asia, the profit margin that China may obtain is very surprising, can reach 30,000,000,000/year RMB￥. Predicating curative effect of gefitinib is directly related with the EGFR gene mutation, therefore preliminary examination gene mutation enforcement individualized treatment can be more targeted, " science " put down in writing in April, 2004, carry out in the 125 routine Patients with Non-small-cell Lungs of EAP plan, select 5 examples effective in cure, 4 routine inefficacy persons detect through gene sequencing, there is EGFR exons mutation (L858R 2239-2247Del 2240-2257Del 2238-2255Del) in whole 5 routine responders, and none example sudden change of 4 routine nonresponders. The cell line H to the lung cancer of 50 times of sensitivities of Gefitinib of in vitro culture₂₃₅₅Also exist the L858R sudden change. " New England's magazine " published the article in the same period and 275 examples taken the non-small cell lung cancer case Clinical Application Analysis of Gefitinib, there are 25 people that clinical efficacy is arranged, 9 people detection EGFR total length codons wherein, find that there is sudden change in 8 examples, sudden change mode and site and " science " report and basic identical, and none example sudden change of the not aobvious curative effect person of 7 examples occurs. 16 routine effective in cure persons fail to obtain DNA because of the acupuncture sample and abandon detection in addition. On the other hand, do not carry out genetic test and the America and Europe carried out 2600 examples on a large scale the III clinical trial phases (INTACT2) of associating gemzars and taxol and Carboplatin in patients advanced Non-small cell lung be proved to be survival without obvious improvement, reason is that there are a large amount of EGFR sudden change Population with Negatives (95-98%) in American-European non-small cell lung cancer patient, so most clinical position persons propose, the Gefitinib front EGFR gene mutation that needs the preliminary examination Non-Small Cell Lung Carcinoma of taking medicine, curative effect surpasses without 100 times of sudden change persons if any suddenling change then. Should look suddenlys change whether to exist implements individualized treatment, costly because the medication that reaches more than 16 months will happyly miss the state of an illness, and certain side effect is arranged.

" science " publishes the article and recorded and narrated 16 Patients with Non-small-cell Lungs of not accepting treated with gefitinib, and gene sequencing has shown various EGFR gene mutations, and wherein 15 is the Japanese, is adenocarcinoma of lung, and 10 people are the women. Therefore think that there is greatest differences in EGFR sudden change and reactive with treated with gefitinib between Japan and American, prompting molecular pathology pathogenesis and race, sex and histological type have obvious relation. It is effective that the Japanese reports that 101 examples are taken Patients with Non-small-cell Lung 20 people of Gefitinib, always efficient is 19.8%, efficient far above American-European and Black people 11.8%, be 22.2% and Chinese carry out the efficient of EAP planning and statistics, found that through genetic test the mutation rate 14%-57% of EGFR in Asian's adenocarcinoma of lung and women population does not wait, low mutation rate far above occidentals average 2%, and the Japanese is to 277 routine lung cancer EGFR gene sequencing, find that there is gene mutation in 111 examples (40%), 52 examples, 19 Exon deletion wherein, 54 examples 21 and 18 extron point mutation, 5 examples copy and insert.

China EGFR detection in Gene Mutation present situation and other EGFR detection method are analyzed: internal authority magazine " science " is published the article, explicitly point out with ImmunohistochemistryMethods Methods detection EGFR expression and analysis of gefitinib for treat NSCLC irrelevant, had not yet to see similar domestic and foreign literature, certainly SABC is relevant with predicating curative effect of gefitinib with ELISA method detection EGFR protein level, therefore, detect the dna sequence dna of EGFR18,19 and 21 extron total lengths with gene order surveying method, become the sure method of prediction predicating curative effect of gefitinib. Problem and shortcoming that prior art exists: the epidermal growth factor receptor gene order-checking detect analytical technology be in April, 2004 at first by U.S. Paez JG and Lynch TJ respectively at " scieNce " and " New England's magazine " issue, they all are DNA genes of the ncbi database EGFR20 bar extron total length of employing, with nest-type PRC method amplification EGFR106 bar gene short-movie section, obtain testing result with identical gene order surveying method and instrument type.

Mainly be to have found to detect EGFR the 18th extron, the 19th extron and the sudden change of the 21st extron generation said gene (497 T of the 21st exon 2＞G sudden change, 2504 A＞T suddenly changes exception, by alone at first discovery of inventor).

Gefitinib has been explained in above-mentioned discovery and Tarciva treatment non-small cell lung cancer is effective in cure and the molecular target mechanism of inefficacy, but there are some problems in above-mentioned technology:

1, designs 06 short-movie section of EGFR exons 1 and can more fully detect sequence, unlikely omission EGFR extron DNA total length, but can not be applied to detection of clinical uses, otherwise only the conventional extron of a routine patient EGFR gene detects consuming time will reaching more than 1 month, and is expensive more considerable. Comprised the part introne, sheared son so the inventor has designed three complete extron segments, control region, whole pathologies site and the sudden change mode both can the above-mentioned EGFR extron of complete detection reported, the PCR program is more optimized, improve recall rate, more can allow this detection enter practical application.

2, the EGFR extron detection method of Paez JG and Lynch TJ announcement, the American-European Caucasoid of key reaction and Black people's gene appearance, but the generally acknowledged othernesses such as ethnic group, region that exist of gene event, EGFR the 18th, the 19 and 21 exon genes fragments of inventor's design, can be one by one from base and amino acid levels and distinctive this gene sequence characteristic of observation analysis Chinese and sudden change characteristics, it is the new heterozygosity sudden change that is not reported both at home and abroad that the 21st extron T that the inventor finds＞G sudden change and A＞T and 852 bit codons begin to insert the G sudden change, and it is pointed to be used for analyzing the treatment of Chinese's targeted drug.

3, the EGFR extron test item of Paez JG and Lynch TG only is newfound technique of gene detection in 2004, mainly is for experimental study. 2004 the end of the year Japanese utilize total RNA extractive technique to carry out the CDNA pcr amplification, this technology is applied to the molecular pathology genetic test of clinical disease natural sciences, but this technology artificially has additionally increased RNA-DNA reverse transcription PCR link, might be undetected to heterozygosity strand gene mutation event increase false positive pollution or false negative, and increased the time and the funds that detect, and lack the application of clinical gene pathology and report sample and technical operation standard.

4, domestic each medical institutions, Hospital Authority not yet set up this clinical gene pathology test item, even fail to retrieve EGFR extron examining report or the data of medical science, biology laboratory.

Summary of the invention

The object of the invention is to for the deficiencies in the prior art recited above, a kind of epidermal growth factor receptor gene determination method is provided.

The present invention takes following technical scheme to realize:

EGF-R ELISA (EGFR) gene sequencing detection method:

(1) test material and object

The somatic tissue of the non-small cell carcinoma that various approach obtain, the section of the paraffin-embedded tissue of lung cancer, the cancer cell in advanced lung cancer MET tissue and the blood, cells in pleural fluids from lung cancer cases and puncture cell, phlegm cell;

(2) use reagent and instrument

The commercial reagent box that V-gene company, the DNA of Roche company extract

Promega PCR purifying commercial reagent box

ABI order-checking commercial reagent box

Instrument: the automatic gel imaging system of DNA quantitative instrument electrophoresis apparatus PCR instrument is cold

Freeze centrifuge gene sequencer genetic analysis software

(3) testing process

1. at first test material is carried out the pathological technique film-making, observe, provide the pathological diagnosis report, put on record, determine whether non-small cell lung cancer and pathological classification, the section of drawing materials behind the selected focus zone is included gene sequencing in and is detected;

2. organize pre-treatment and extracting DNA, every batch of group is set up the contrast of lung cancer surrounding tissue;

3. the DNA quantitative instrument detects sample quality (the 260nm absorptance is greater than 0.05, A260/A280 ratio 1.6-1.8, and 320nm wavelength place absorptance approaches zero);

4. use the primer (EGFR exons 18,19 and 21 full length DNA sequences) of having set to carry out pcr amplification (Touchdown technology);

5. gel autography electrophoresis observation is analyzed the PCR effect

6. PCR product purification

7. the PCR product carries out sequencing reaction

8. use gene sequencer to carry out order-checking and the analysis of EGFR gene; Doing two-way order-checking during such as negative findings detects;

9. according to pathological diagnosis, clinical examination treatment situation and the sequencing results are carried out comprehensive assessment, finish EGFR pathological gene sequencer address;

(4) observation index

The sequence of the open sequence (NM-005228) of the EGFR DNA that provides according to u.s. national library of medicine (www.NCBI.NLM.NIH.GOV) and mRNA is determined EGFR the 18th, 19 and 21 extron total length segments;

1. EGFR the 18th extron fragment length is 437bp, and sequence sees below to be stated

The main nucleotides 2155G＞A that observes suddenlys change, and namely amino acid G719s changes

2. EGFR the 19th extron fragment length is 411bp, and sequence sees below to be stated

Main nucleotides 2235-2249Del, i.e. the amino acid E746-A750del deficient phenomena observed

Nucleotides 2236-2250Del, i.e. amino acid E746-A750del deficient phenomena

Nucleotides 2254-2277Del, i.e. amino acid S752-I759del deficient phenomena

The phenomenons such as other nucleotide fragments lacks, inserts, repeats, such as amino acid L747-T751insS, L747-P753insS and L747-A750del etc.;

3. EGFR the 21st extron, fragment length is 399bp, sequence sees below to be stated

The main nucleotides 2576T＞G that observes, i.e. amino acid L858R sudden change

Nucleotides 2497T＞G (L833V) 2504A＞T (H835L)

The phenomenons such as other nucleotides heterozygous mutant: suddenly change such as amino acid L861Q;

The 2556th in nucleotides inserts bases G (Q852)

At first determine EGFR the 18th, 19 and 21 exon genes base sequence and mutational sites thereof:

The EGFR complete genome sequence (NM-005228) and the mRNA sequence that openly provide according to U.S. national library (www.NCBI.NLM.NI H.gov), with reference to the American AB I Celerar of company database related gene document and " (science " 2004,304 (5676): 1457-1500, the full genome document of Epub EGFR, the selected EGFR gene extron of order-checking that needs of the present invention is as follows:

Exon18

The EGFR18 exon sequence

ccgtgtcctggcacccaagcccatgccgtggctgctggtccc

cctgctgggccatgtctggcactgctttccagcatggtgagggctgaggtgacccttgtctc

tgtgttcttgtcccccccagCTTGTGGAGCCTCTTACACCCAGTGGAGAAGCTCCCAACCAA

GCTCTCTTGAGGATCTTGAAGGAAACTGAATTCAAAAAGATCAAAGTGCTGG

CTCCGGTGC

GTTCGGCACGGTGTATAAGgtaaggtccctggcacaggcctctgggctgggccgcagggcct

ctcatggtctggtggggagcccagagtccttgcaagctgtatatttccatcatctactttac

tcttt

Exon19

The EGFR19 exon sequence

acccagatcactgggcagcatgtggcaccatctcacaattgc

cagttaacgtcttccttctctctctgtcatagGGACTCTGGATCCCAGAAGGTGAGAAAGTT

AAAATTCCCGTCGCTATCAA ACA

CTCGATgtgagtttctgctttgctgtgtgggggtccatggctctgaacctcaggcccacct

tttctcatgtctggcagctgctctgctct

Exon21

The EGFR21 exon sequence

atgaccctgaattcggatgcagagcttcttcccatgatgatc

tgtccctcacagcagggtcttctctgtttcagGGCATGAACTACTTGGAGGACCGTCGCTTG

GTGCACCGCGACCTGGCAGCCAGGAACGTACTGGTGAAAACACCGCAGCATGTCAAGATCAC

AGATTTTGGGC

GGCCAAACAGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGGCA

AAtaaggaggtggctttaggtcagccagcattttcctgacaccagggaccaggctgccttcc

cactagctgtattgttt

Observation mutational site to the said gene fragment mainly comprises three aspects::

(1) mutational site of having reported

The 2155th G of Exon 18 nucleotides＞A suddenly change (G719S)

Exon19 nucleotides 2235-2249 lacks (E746-A750del)

Nucleotides 2236-2250 lacks (E746-A750del)

Nucleotides 2254-2277 lacks (S752-I759del)

Nucleotide deletion (L747-T751insS)

Nucleotide deletion (L747-P753insS)

Nucleotide deletion (L747-A750del)

Exon21 nucleotides the 2573rd T＞G suddenly change (L858R)

Coding mutation (L861Q)

(2) the sudden change site of Chinese's new discovery

The 2497th T＞G of Exon21 nucleotides (L833V)

The 2504th A＞T of nucleotides (H835L)

The 2556th in nucleotides inserts bases G (Q852)

(3) EGFR18,19 and 21 extrons of being found by the inventor site that newly suddenlys change

(5) design primer

According to above-mentioned EGFR genetic fragment, determined EGFR the 18th, 19 and 21 extrons, utilize the corresponding primer of Oligo software independent design, and with reference to the PCR condition of optimizing and order-checking Adaptability Analysis, synthetic primer sequence is as follows:

18 extron upstream primers, 5 ' TCC AAA TGA GCT GGC AAG TG 3 '

Downstream primer 5 ' TCC CAA ACA CTC AGT GAA AC 3 '

19 extron upstream primers, 5 ' GTG CAT CGC TGG TAA CAT CC 3 '

Downstream primer 5 ' TCT GGA GAT GAG CAG GGT CT 3 '

21 extron upstream primers, 5 ' GCT CAG AGC CTG GCA TGA AC 3 '

Downstream primer 5 ' CAT CCT CCC CTG CAT GTG TT 3 '

(6), extract template DNA

Flesh tissue: the DNA of V-gene company extracts the reagent box

Fix and paraffin: the DNA of Roche company extracts the reagent box

Blood and liquid cell: the DNA of Promega company extracts the reagent box

More than all by specification indication method operations, detect dna profiling and quality with gel electrophoresis system, then measure DNA concentration with eppendorf nucleic acid quantification instrument, select dsDNA for measuring target, the 260nm absorptance is greater than (dna content is greater than 2.0ug/ul) more than 0.05, between the absorptance A260/A280 ratio 1.6-1.8,320nm wavelength place absorptance is close to 0 sample as applicable template;

(7), pcr amplification and purifying

To the eligible dna profiling that obtains, with touch down technology amplifying target genes fragment, reaction system is as follows:

The PCR system: (total system 20 μ l): 10 * PCR Buffer (contains 15_mM MgCl _2×) 2 μ l, HotStarTaq DNA Polymerase (QI AGEN company) 0.2 μ l, 5 * Q-Solution, 4 μ l, dNTP mix (10_mM of each) 2 μ l, Primer 11 μ l, Primer 21 μ l, template DNA 1 μ l, Distilled water 8.8 μ l;

PCR condition: put 95 ℃ of denaturation 15min in the ABI-2700 type amplification instrument, use TouchdownPCR, 94 ℃ of sex change 50sec, and 63 ℃-58 ℃ annealing 1min (0.5 ℃/1min, 72 ℃ are extended 1min, circulate altogether 10 times, 94 ℃ of sex change 50sec, 57 ℃ of annealing 1min, 72 ℃ are extended 1min, circulate altogether 30 times, extend 10min in 72 ℃ at last;

The control of PCR product quality: the PCR product requires band single, and concentration 30-100ng PCR enzyme is used domestic and international other enzyme of the QIAGEN HotStarTaq DNA Polymerase of company, ABI company gold medal enzyme and high-quality;

The PCR product purification:

A, mistake post purifying: Shanghai bio-engineering corporation purification kit

The PCR of Promega company purification kit

The PCR of Qiagen company purification kit

B, alcohol/EDTA purifying:

Gel video picture electrophoresis assessment purifying quality behind the product purification, numbering, file (80 ℃)

C, sequencing reaction and purifying

Because EGFR the 18th known today, 19 and 21 extrons are heterozygous mutant, disappearance, so the just oppositely primer of 10um all is diluted to 1um, adds reactant: 1ul BigDye (2.5X)+1.5 ul BigDye Seq Buffer (5X)+3ul primer+1ulPCR purified product+3.5ul ddH by following system₂O；

(8), sequencing result analysis and report

Sequencing result forms reading report operator and mirror speaker signature, notes phase, and enclose the primitive sequencer electrophoretogram, sequence chart is given clinical or trouble side;

(9), records handling registration

It is single that all detected objects are all filled in application for registration, indicates medical history, pathological diagnosis, check HE section;

All DNA template, PCR purified product are all numbered-80 degree ultralow temperature and are preserved for future reference.

The EGFR gene extron detects, and main goal of the invention and the task that will solve are as follows:

(1) all non-small cell lung cancer clinical medicine application efficacy analysis show: Ji Fei all has up to 70% for Buddhist nun and Tarciva produce effects person^-90% EGFR exons mutation rate, and accordingly sudden change rate of invalid person is almost nil, so before the clinical application, whether preliminary examination EGFR gene mutation exists is the effective ways that solve the specific aim individualized treatment.

(2) the EGFR gene extron detects, the clinical practice test item that must be transformed by experiment research, exploitation can operate, the detection method of the designs such as external Paez JG, adopt 28 whole extrons of EGFR, 106 pairs of DNA base short-movie sections have been designed, carry out the dna double chain just to reverse detection, this carried out system and comprehensively explore in the experiment research stage is necessary, but carry out workload and funds that detection of clinical will form astronomical figure, study through the inventor, comprehensive each side report, clear and definite Exon18 has G＞A to suddenly change (G719S), and Exon 19 has E746-A750del, S752-I759del, L747-T751insS, L747-P753insS, L747-A750del. Exon 21 has L858R, L861Q, 2497 T＞G to suddenly change and 2504A＞T sudden change, and the 2556th in nucleotides inserts bases G (Q852), and the extron fragment of inventor's design has contained above-mentioned whole point of observation, condenses into 3 pairs of extron fragments; Measure another DNA chain after single chain is found without positive sequence, it is feasible technically that this project clinical pathology is detected again.

Teachings herein belongs to technique of gene detection method project, and its principle is:

1, the molecular targeted agents for the treatment of non-small cell lung cancer is the invention that is different from the milestone formula of traditional chemotherapy, can be effective in cure but there is EGFR gene mutation person to treat 70%-90% with the lucky non-Buddhist nun of replacing, and its efficient is higher than 100 times of EGFR gene mutation negative patients.

2, use the lucky non-Buddhist nun of replacing and treat non-small cell lung cancer, assets demonstration both at home and abroad is best to Asian's curative effect, and main cause is that Asian EGFR gene mutation rate is the highest in the world.

3, such medicine 2004 is criticized by the FDA Shen, and be about to enter China in March, 2005, and the domestic research clinical practice that this test item was not yet arranged before application invention.

4, Chinese's EGFR gene has the feature of self, compatriots' similar detection in Gene Mutation Item Response Pattern distinct Chinese characteristics.

Object and material are used in invention

1, uses the EGFR gene mutation order-checking detection that object is applicable to Patients with Non-small-cell Lung tumour body cell.

2, use material to refer to tumour flesh tissue, cell, phlegm liquid, tumour wax piece from body, fixing organization, but blood transfer cell, puncture are organized cell, are shifted kitchen range and organize the test material such as cell.

The technique condition:

1, environment condition

Dna profiling extracts pcr amplification and the necessary subregion of sequencing reaction or locellus operation, is strictly on guard against cross pollution, and the standard pollutant is processed.

2, staff condition

Relevant operating personnel must be qualified through " National Laboratory's approval system " training class's training, has more than the pathology qualifications of a licensed doctor master postgraduate graduation, and clinical pathology diagnosis working had the molecular pathology experiment basis more than 3 years.

3, hardware condition

DNA spectrophotometric quantitative instrument, automatic gel video picture instrument, an order-checking level pcr amplification instrument, electrophoresis apparatus, refrigerated centrifuge machine, high speed centrifuge, DNA analysis instrument (gene sequencer), broadband internet.

4, software condition

Have skilled molecular biosciences and consult NCBI and relevant document storehouse with the molecular pathology knowledge expertise

Can use 3100-AvantDate Collection 2.0 running software sequenators

Can analyzing DNA sequencing analysis 5.1 software analysis initial data

The automatic icp gene sudden change of DNA seqScape software

The manual icp gene sudden change of DNA star seqman software

Include standard in

1, pathological diagnosis standard

The lung non-small cell carcinoma

The enteraden cancer

The spleen cancer

Breast cancer

Prostate cancer

The nephrocyte cancer

The pancreas cancer

Cancer of the esophagus

The thyroid gland cancer

The incidence cancer

2, observe gene mutation and include standard in

(1) 8 sudden change sites and the unusual phenomenon reported at present: G719S E746-A750del S752-I759del L747-T751insS L747-P753insS L747-A750del L858R L861Q

(2) the following sudden change site Exon21T＞G (L833V) of inventor's discovery

                                 A＞T(H835L)

The 2556th in nucleotides inserts bases G (Q852)

(3) EGFR18, the new climate abnormality phenomenon of 19 and 21 extrons of inventor's discovery.

Useful effect:

(1) EGFR gene mutation order-checking detects the good efficacy that can clearly forecast molecular targeted agents treatment non-small cell lung cancer.

1,2004 " science " publishes the article in 125 routine Patients with Non-small-cell Lungs and to treat effective 5 examples for the Buddhist nun and all have EGFR exons 18,19 and 21 sudden change (100 %) Ji is non-, and there is said mutation in 4 invalid none example of routine patient, showing non-to Ji in cell culture experiments in vitro is the non-small cell adenocarcinoma of lung strain H2355 of 50 times of high sensitivities for Buddhist nun's anticancer therapeutic, also has the L858R sudden change of EGFR the 21st extron.

2, the same period, " New England's magazine " published the article, in 275 routine non-small cell lung cancer cases, find that to selecting 9 routine effective in cure persons to detect EGFR gene extron 18,19 and 21 there is sudden change (88%) in 8 examples and none routine said mutation that occurs of the 7 example persons of failing to respond to any medical treatment.

(2) the EGFR detection in Gene Mutation is more effective to the Asian

1, above-mentioned " science " and " New England's magazine " reported that all Japanese's EGFR gene mutation rate is 26%, and the corresponding sudden change rate of American and Black people all only has 2%, and the international broad scale research (IDEAL I and II) of the single clinical treatment non-small cell lung cancer of medicine II phase of two large-scale Iressa (Iressa) is more effective to Asia women gland cancer, and in the more large-scale EAP plan in the world subsequently, Japan's 108 examples and the curative effect rates of Chinese 238 examples are respectively 19.8% and 22.2 %, the corresponding curative effect rate of American-European ethnic group only 11.8%. The EGFR gene mutation rate of 227 routine Japanese's lung cancer is 40%, far above American-European ethnic group.

2, opposite, recent INTACT project is not surveyed the EGFR gene mutation to 2600 routine non-small cell lung cancers and is not done the grouping of ethnic group, region, the lucky non-Buddhist nun of replacing and gemzar, suitable platinum, taxol, card platinum associating medication have only been done, compare with non-associating medication, do not demonstrate Ji Fei for the otherness of the single medication effect of Buddhist nun, strong explanation is not done this genetic test and is blindly taken medicine and have no curative effect.

(3) determine again whether take medicine after the detection EGFR gene mutation, can obviously control lucky non-adverse side effect for the Buddhist nun and reduce unnecessary financial burden.

1, various domestic and foreign literatures show that all the lucky non-Buddhist nun of replacing of targeted drug treats non-small cell lung cancer and obviously reduces than various toxic and side. Generally only have diarrhoea, fash, severe person that a matter pneumonia can be arranged, also can cause death such as abuse, the case that this medicine has matter pneumonia death between 14 examples is abused by Japan once report. Whether exist the rear medication of sudden change can reduce side effect so detect gene.

2, Ji Fei not yet introduces for the Buddhist nun is domestic, more can not produce, medication person need consume expensive price from buying (80 yuan/of $) abroad, because this medicine mainly is that advanced lung cancer is reduced pectoralgia, coughs the effect that the control state of an illness sharply worsens of having breathed heavily, so need Long-term taking medicine to reach 16-18 month, detect whether there is medication after the gene mutation, can reduce country and the huge financial burden of patient.

(4) the present technique method is that the experimental technique Transformation Application is to the great innovation of detection of clinical

1, no matter be that " science " and " New England's magazine " all are that the section of short-movie more than 200 is carried out the detection of nest-type PRC EGFR full-length gene group, this is necessary in experiment scientific research method, but can not drop into application clinically, the inventor has designed targetedly observation sequence of EGFR gene the 18th, 19 and 21 extrons, the detection of redundant and complicated is become cause succinct, can be observed whole sudden changes site of present various countries report, and combine the clinical pathology sections observation and have more science.

2, the gene observation sequence fragment of inventor's design, not only can observe existing gene mutation situation, can also check out the EGFR sudden change mode that Chinese are distinctive or do not reported, such as finding EGFR gene the 21st extron T＞G, A＞T heterozygosity sudden change at routine male sex's adenocarcinoma of lung body cell, have no the data at home and abroad report.

3, developed country is commonplace abroad is applied to clinically for the pathological gene test item, and China there is not yet medical institutions except inventor unit one belongs to has similar clinical practice project to enter conventional diagnosis and treatment service.

Description of drawings

Fig. 1 is EGFR order-checking effect figure of the present invention

Concrete enforcement mode:

One, draw materials: check patient's name: so-and-so, pathological number: 0406013, pathological diagnosis is: adenocarcinoma of lung. Get its lung cancer specimen wax piece, micro-Microscopic observation after routine section HE dyeing guarantees that focus cancerous tissue regional structure is clear, cuts 6 of the thick sections of 10 μ m after hemorrhage without self-dissolving, necrosis and sheet.

Two, the extraction of DNA is extracted DNA with Roche company paraffin extracting genome DNA reagent box by explanation.

Three, DNA Quality Identification: measure with eppendorf nucleic acid quantification instrument first and extract rear DNA concentration. (the 260nm absorptance is greater than (dna content is greater than 2.0ug/ ul) more than 0.05, between the absorptance A260/A280 ratio 1.6-1.8,320nm wavelength place absorptance is close to 0), then in 1% agar sugar gel electrophoresis, carry out electrophoresis, show that take JD-801 gel electrophoresis figure picture analysis systems single, bright band is as qualified template.

Four, pcr amplification

1, the design of primer is with synthetic: the result of study that provides according to the relevant document of NCBI, determine EGFR genes of interest segment (seeing above-mentioned), the sequence that provides on the genebank is provided, by O ligo software design primer, and the adaptability assessment of checking order, synthetic by Shanghai bio-engineering corporation. Sequence is:

18 extron upstream primers, 5 ' TCC AAA TGA GCT GGC AAG TG 3 '

Downstream primer 5 ' TCC CAA ACA CTC AGT GAA AC 3 '

19 extron upstream primers, 5 ' GTG CAT CGC TGG TAA CAT CC 3 '

Downstream primer 5 ' TCT GGA GAT GAG CAG GGT CT 3 '

21 extron upstream primers, 5 ' GCT CAG AGC CTG GCA TGA AC 3 '

Downstream primer 5 ' CAT CCT CCC CTG CAT GTG TT 3 '

2, PCR reaction system (total system 20 μ l): 10 * PCR Buffer (contains 15_mM MgCl _2×) 2 μ l, HotStarTaq DNA Polymerase (QIAGEN company) 0.2 μ, 1,5 * Q-Solution 4 μ l, dNTP mix (10_mM of each) 2 μ l, Primer 11 μ l, Primer 21 μ l, template DNA 1 μ l, Distilled water 8.8 μ l.

3, PCR reaction condition: put 95 ℃ of denaturation 15min in the ABI-2700 type amplification instrument, use TouchdownPCR, 94 ℃ of sex change 50sec, and 63 ℃-58 ℃ annealing 1min (0.5 ℃/1min, 72 ℃ are extended 1min, circulate altogether 10 times, 94 ℃ of sex change 50sec, 57 ℃ of annealing 1min, 72 ℃ are extended 1min, circulate altogether 30 times, extend 10min in 72 ℃ at last.

4, PCR product purification: whether be the single goal band with 1.5% agar sugar gel electrophoresis observation pcr amplification product, the PCR purification kit that provides according to Promega company, the PCR product crossed the post purifying after, carry out sequencing reaction.

Five, sequencing reaction

1, reaction system: 1ul BigDye (2.5X)+1.5ul BigDye Seq Buffer (5X)+3ul primer (1pmol/ul)+1ulPCR purified product (3-10ng)+3.5ul ddH₂O. (the whole concentration of guaranteeing Bi gDye is 1X)

2, order-checking PCR thermal cycle conditions: 96 ℃, → 60 ℃ of 10sec → (96 ℃ of 10sec → 50 ℃ 5 sec → 60 ℃ 4min) * 25 circulations, 4min → 4 ℃ insulation

3, purifying behind the sequencing reaction

1) every pipe adds 1 μ L 125mM EDTA to the pipe end, adds 1 μ L 3M NaAc again.

2) every pipe adds 25 μ L, 100% alcohol, and aluminum foil sealing is tight, mixed even 4 times of concussion, and room temperature is placed 15min.

3) the centrifugal 45min of 1600 * g is inverted 96 hole ABI plates at once, centrifugal stop to 185 * g centrifugal.

4) every pipe adds 35 μ L, 70% alcohol, 4 ℃ of centrifugal 15min of 1650 * g (JOUAN-BR4i); Be inverted 96 orifice plates at once, centrifugal stop to 185 * g centrifugal.

5) repeating the 4th goes on foot 1 time.

6) the room temperature clean alcohol that volatilizees adds 10 μ L Hi-Di Formamide dissolving DNAs;

7) sample is put rapidly and is cooled off 4min in the ice at 95 ℃ of sex change 4min.

4, gene sequencing

1) before the order-checking electrophoresis, in data collection (Datecollection2.0) software, selects correct operation module and analysis module.

2) sample preparation, loading to 3100-Avant genetic analyzer checks order.

3) Datecollection software automatically carries out the data processing and analyzes.

Six, as a result analysis

Sequencing result is analyzed the primitive sequencer data automatically with DNA sequencing analysis5.1, obtain order-checking electrophoretogram and sequence. Sample sequence is compared with DNA star seqman and standard sequence, observe sample gene order observation sample and whether have the changes such as sudden change or disappearance.

Seven, sequencing result:

Genetic test request slip and account

Province institute of traditional Chinese medicine

The DNA of pathology department gene sequencing request slip

So-and-so affiliated hospital of university of TCM

Chain store: detect number

G050035

Name	So-and-so		Age	57	Sex	The man	The native place				The birthplace		National
															Censorship unit					Department			The lesion bed label		X10     -5	Outpatient service number		Be in hospital number
Censorship sample (ˇ namely send pathology department)					Take the position						Pathological examination number:0406013Pathological diagnosis:Adenocarcinoma of lungBlood relation's pathological diagnosis:
															1. anti-freezing blood (2ml)
2. organize (fixing)					Paraffin specimen
															Other
Case history summary and clinical labororatory's inspection, chemotherapy, western medicines in treatment scheme etc.:
															Individual and blood relationship concern medical history: (ˇ) disease and family history before tumour, the cancer: hypertension: prenatal and postnatal care, sterile, inferior health (high fat of blood, fat, neurasthenia etc.): diabetes: paternity test: the mammary gland gynecological disease: irritated immunological diseases: infectious disease: lipogastry is scorching, intestines: heart and brain blood vessel disease: liver kidney, tuberculosis disease: enteropathy, intestinal polyp: congenital disorders: other (such as mouth, eye diseases, motion selection etc.):
Application purpose and project (or are come pathology department's consulting, phone: 86617141-70307) EGFR18,19,21 extrons
															The advanced high-tech pathological diagnosis technology such as the order-checking of my known is before utilizing the genomics method to detect cause of disease, tumour, cancer, inferior health, susceptibility, blood relationship classification, transplanting and prenatal and postnatal care check to this that I have known the inside story and have agreed and detect. Telephone number: signature:

Clinical diagnosis and postscript: censorship doctor: _ _ _ _ _ _ _ _ _ _ 2004 dates

Attention: 1. draw materials or extract not blood coagulation after send immediately pathology department, need not fix, post label.

2. testing result needs with reference to pathological diagnosis consulting doctor.

3. as testing result is had query, please contact with pathology department.

Chain store: chain store: chain store:

Chain store:

Sample type (ˇ): flesh tissue, new blood, fixing organization, the puncture tissue, chest ascites, the cell that comes off, body fluid, other huge inspection:

Gene sequencing result: 1, EGFR the 18th extron, the 2155th nucleotides is not found G＞A sudden change; 2, EGFR the 19th extron, 2235-2249 position nucleotides and 2236-2250 position nucleotides are not found disappearance; 3, EGFR the 21st extron, the 2576th nucleotides are not found T＞G sudden change, and the 2497th nucleotides finds that T＞G suddenly change (L833V), the 2504th nucleotides discovery A＞T suddenly change (H835L).

Molecular pathological diagnosis and relevant clinical meaning: 1, pathological diagnosis is: adenocarcinoma of lung. 2, paraffin cancerous lung tissue EGFR gene the 18th, 19 extrons do not detect sudden change and the disappearance of clinical pathogenic meaning. The 21st extron has found that the 2497th nucleotides T not reported＞G suddenlys change (L833V), the 2504th nucleotides A＞T suddenly change (H835L). Prompting Iressa medicine molecular targeted therapy adenocarcinoma of lung may have better curative effect. Diagnosis doctor: on November 4th, 1 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 2004

Jiangsu Province institute of traditional Chinese medicine

The DNA of pathology department gene sequencing report

So-and-so affiliated hospital of university of TCM

Gene sequencing detects number:

G050035

Name	So-and-so		Sex	The man	Age	57	Department
									Censorship unit			The lesion bed label	X10-5	Outpatient service number		Be in hospital number
The check number			Clinical diagnosis
									Pathological number and pathological diagnosis		Pathological number: 0406013 adenocarcinoma of lung
Sample type (ˇ): flesh tissue, new blood, fixing organization, puncture tissue, chest ascites, the cell that comes off, body fluid, other huge inspection: paraffin specimen
									Gene sequencing result: (the face accompanying drawing of passing away) (two-way order-checking) 3, EGFR the 18th extron, the 2155th nucleotides is not found G＞A sudden change; 4, EGFR the 19th extron, 2235-2249 position nucleotides and 2236-2250 position nucleotides are not found disappearance; 3, EGFR the 21st extron, the 2576th nucleotides are not found T＞G sudden change, and the 2497th nucleotides finds that T＞G suddenly change (L833V), the 2504th nucleotides discovery A＞T suddenly change (H835L).
Molecular pathological diagnosis and relevant clinical meaning: 2, pathological diagnosis is: adenocarcinoma of lung. 2, paraffin cancerous lung tissue EGFR gene the 18th, 19 extrons do not detect sudden change and the disappearance of clinical pathogenic meaning. The 21st extron has found that the 2497th nucleotides T not reported＞G suddenlys change (L833V), the 2504th nucleotides A＞T suddenly change (H835L). Prompting Iressa medicine molecular targeted therapy adenocarcinoma of lung may have better curative effect. Diagnosis doctor: on November 4th, 1 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 2004

Annotate: 1. organize cell based to need to assess with reference to pathological diagnosis because of sequencing result.

2. sequencing result can be seeked advice from clinical and Pathology Doctors '.

Claims (4)

1, EGF-R ELISA (EGFR) gene sequencing detection method, it comprises the following steps:

(1) test material and object

The section of the body cell tissue of the non-small cell carcinoma that various approach obtain, the paraffin-embedded tissue of lung cancer, advanced lung cancer shift cancer cell, cells in pleural fluids from lung cancer cases and puncture cell or phlegm cell in kitchen range tissue and the blood;

(2) use reagent and instrument

The reagent box that DNA extracts

The PCR purification kit

The ABI sequencing kit

Instrument: the automatic gel video picture of the DNA quantitative instrument electrophoresis apparatus PCR of system instrument is cold

Freeze centrifuge gene sequencer genetic analysis software

(3) testing process

At first test material is carried out the pathological technique film-making, observe, provide the pathological diagnosis report;

Put on record, determine whether non-small cell lung cancer and pathological classification, the section of drawing materials behind the selected focus zone is included gene sequencing in and is detected;

Organize pre-treatment and extracting DNA, every batch of group is set up the contrast of lung cancer surrounding tissue;

The DNA quantitative instrument detects sample quality (the 260nm absorptance is greater than 0.05, A260/A280 ratio 1.6-1.8, and 320nm wavelength place absorptance approaches zero);

Use the primer (EGFR exons 18,19 and 21 full length DNA sequences) of having set to carry out pcr amplification;

Gel is analyzed the PCR effect from the electrophoresis observation that develops;

The PCR product purification;

The PCR product carries out sequencing reaction;

Use gene sequencer to carry out order-checking and the analysis of EGFR gene; Do two-way order-checking as a result the time and detect as negative;

According to pathological diagnosis, clinical examination treatment situation and the sequencing results are carried out comprehensive assessment;

Finish EGFR pathological gene sequencer address;

(4) observation index

The sequence of the open sequence (NM-005228) of the EGFR DNA that provides according to u.s. national library of medicine (www.NCBI.NLM.NIH.GOV) and mRNA is determined EGFR the 18th, 19 and 21 extron total length segments;

1. EGFR the 18th extron fragment length is 437bp,

The main nucleotides 2155G＞A that observes suddenlys change, and namely amino acid G719s changes

2. EGFR the 19th extron fragment length is 411bp,

Main nucleotides 2235-2249Del, i.e. the amino acid E746-A750del deficient phenomena observed

Nucleotides 2236-2250Del, i.e. amino acid E746-A750del deficient phenomena

Nucleotides 2254-2277Del, i.e. amino acid S752-I 759del deficient phenomena

Other nucleotide fragments disappearance, insertion, repetition phenomenon, such as amino acid L747-T75linsS, L747-P753insS and L747-A750del;

3. EGFR the 21st extron, fragment length is 399bp,

The main nucleotides 2576T＞G that observes, namely amino acid L858R phenomenon changes

Nucleotides 2497T＞G (L833V) 2504A＞T (H835L) nucleotides q852

Other nucleotides heterozygous mutant phenomenon changes such as amino acid L861Q;

At first determine EGFR the 18th, 19 and 21 exon genes base sequences and sudden change site thereof:

The EGFR complete genome sequence (NM-005228) and the mRNA sequence that openly provide according to the U.S. state-run library (www.NCB5.NLM.NIH.gov), with reference to the American AB I Cerelar of company database phase correlation gene document and " science " 2004,304 (5676): 1457-1500, the full genome document of Epub EGFR, the selected EGFR gene extron of order-checking that needs of the present invention is as follows:

Exon18

The EGFR18 exon sequence

cctgctgggccatgtctggcactgctttccagcatggtgagggctgaggtgacccttgtctc

tgtgttcttgtcccccccagCTTGTGGAGCCTCTTACACCCAGTGGAGAAGCTCCCAACCAA

GTTCGGCACGGTGTATAAGgtaaggtccctggcacaggcctctgggctgggccgcagggcct

ctcatggtctggtggggagcccagagtccttgcaagctgtatatttccatcatctactttac

Exon19

The EGFR19 exon sequence

cagttaacgtcttccttctctctctgtcatagGGACTCTGGATCCCAGAAGGTGAGAAAGTT

Exon21

EGFR21 shows subsequence

tgtccctcacagcagggtcttctctgtttcagGGCATGAACTACTTGGAGGACCGTCGCTTG

GTGCACCGCGACCTGGCAGCCAGGAACGTACTGGTGAAAACACCGCAGCATGTCAAGATCAC

AAtaaggaggtggctttaggtcagccagcattttcctgacaccagggaccaggctgccttcc

Observation sudden change site to the said gene fragment mainly comprises three aspects:

(1) the sudden change site of having reported

The 2155th G of Exon18 nucleotides＞A suddenly change (G719S)

Exon19 nucleotides 2235-2249 lacks (E746-A750del)

Nucleotides 2236-2250 lacks (E746-A75 0del)

Nucleotides 2254-2277 lacks (S752-I759del)

Nucleotides disappearance (L747-T751insS)

Nucleotides disappearance (L747-P753insS)

Nucleotides disappearance (L747-A750del)

Exon21 nucleotides the 2573rd T＞G suddenly change (L858R)

Coding mutation (L861Q)

(2) Chinese's sudden change site

The 2497th T＞G of Exon21 nucleotides (L833V)

The 2504th A＞T of nucleotides (H835L)

The 2556th in nucleotides inserts bases G (Q852)

(3) EGFR18,19 and 21 extrons of being found by the inventor site that newly suddenlys change

(4) design primer

According to above-mentioned EGFR genetic fragment, determined EGFR the 18th, 19 and 21 extrons, utilize the corresponding primer of Oligo software independent design, and with reference to the PCR condition of optimizing and order-checking Adaptability Analysis, synthetic primer sequence is as follows:

18 extron upstream primers, 5 ' TCC AAA TGA GCT GGC AAG TG 3 '

Downstream primer 5 ' TCC CAA ACA CTC AGT GAA AC 3 '

19 extron upstream primers, 5 ' GTG CAT CGC TGG TAA CAT CC 3 '

Downstream primer 5 ' TCT GGA GAT GAG CAG GGT CT 3 '

21 extron upstream primers, 5 ' GCT CAG AGC CTG GCA TGA AC3 '

Downstream primer 5 ' CAT CCT CCC CTG CAT GTG TT 3 '

(5), extract template DNA

Flesh tissue: extract the reagent box with DNA

Fix and paraffin: extract the reagent box with DNA

Blood and liquid cell: extract the reagent box with DNA

More than all by specification indication method operations, detect dna profiling and quality with gel electrophoresis system, then measure DNA concentration with the nucleic acid quantification instrument, select dsDNA for measuring target, the 260nm absorptance is greater than (dna content is greater than 2.0ug/ul) more than 0.05, between the absorptance A260/A280 ratio 1.6-1.8,320nm wavelength place absorptance is close to 0 sample as applicable template;

(6), pcr amplification and purifying

To the eligible dna profiling that obtains, with the amplifying target genes fragment, reaction system is as follows:

The PCR system: (total system 20 μ l): 10 * PCR Buffer (contains 15mM MgCl_2x) 2 μ 1, HotStarTaq DNA Polymerase 0.2 μ l, 5 * Q-Solution, 4 μ 1, dNTP mix (10mM of each) 2 μ l, Primerl 1 μ l, Primer 21 μ l, template DNA 1 μ l, Distilled water 8.8 μ l;

PCR condition: put 95 ℃ of denaturation 15min in the amplification instrument, use TouchdownPCR, 94 ℃ of sex change 50sec, and 63 ℃-58 ℃ annealing 1min (0.5 ℃/1min, 72 ℃ are extended 1min, circulate altogether 10 times, 94 ℃ of sex change 50sec, 57 ℃ of annealing 1min, 72 ℃ are extended 1min, circulate altogether 30 times, extend 10min in 72 ℃ at last;

The control of PCR product quality: the PCR product requires band single, concentration 30-100ng;

The PCR product purification:

A, mistake post purifying: use respectively purification kit and PCR purification kit

B, alcohol/EDTA purifying:

Gel video picture electrophoresis assessment purifying quality behind the product purification, numbering, file (80 ℃)

C, sequencing reaction and purifying

Because EGFR the 18th known today, 19 and 21 extrons are heterozygous mutant, disappearance, so the just oppositely primer of 10um all is diluted to 1um, adds reactant: 1ul BigDye (2.5X)+1.5ul BigDye Seq Buffer (5X)+3ul primer+1ulPCR purified product+3.5ul ddH2O by following system;

(7), sequencing result analysis and report

Sequencing result forms the reading report operator and the speaker signs, the notes phase, and encloses the primitive sequencer electrophoretogram;

(8), records handling registration

It is single that all detected objects are all filled in application for registration, indicates medical history, pathological diagnosis, check HE section;

All DNA template, PCR purified product are all numbered-80 degree ultralow temperature and are preserved for future reference.

Images