CN102181536A - Primer composition, kit and method for detecting mutation of exon 19 of human EGFR gene - Google Patents

Abstract

The invention belongs to the fields of biotechnology and medical science, and particularly relates to a primer composition, a kit and a method for detecting mutation of an exon 19 of a human epidermal growth factor receptor (EGFR) gene. The primer composition comprises a primer for detecting the mutation of the exon 19 of the human EGFR gene and an upstream primer SEQ ID NO:2 inside the exon 19 of the human EGFR gene, wherein a nucleotide sequence of an upstream primer for detecting the exon 19 of the human EGFR gene is SEQ ID NO:1, a nucleotide sequence of a downstream primer is SEQ ID NO:3. In the primer composition, the mutation of the exon 19 of the human EGFR gene is used as a detection object, and the detection of microfluidic chips is performed on polymerase chain reaction (PCR) products by utilizing a heminested PCR reaction of a special primer group so as to diagnose the mutation of the human EGFR gene quickly, simply, accurately and sensitively.

Description

Be used to detect primer sets compound, test kit and the method for No. 19 exons mutations of human EGFR gene

Technical field

The invention belongs to biological technical field and medical field, particularly, the present invention relates to a kind of primer sets compound, test kit and method that is used to detect No. 19 exons mutations of human EGFR gene.

Background technology

Lung cancer is comparatively common lung primary malignant tumor, and sickness rate and case fatality rate are higher, and male lung cancer accounts for first of the various carninomatosis cause of the death, and the women then is only second to mammary cancer and accounts for second.By traditional histopathologic classification, lung cancer can be divided small cell lung cancer and nonsmall-cell lung cancer.Nonsmall-cell lung cancer (Non-small-cell carcinoma, NSCLC) promptly " non-small cell carcinoma " comprises squama cancer, gland cancer, large cell carcinoma, and compare its growth of cancer cells division with small cell carcinoma slower, diffusion transfer is later relatively, and nonsmall-cell lung cancer accounts for the 80-85% of the total placate of lung cancer.

Epithelial growth factor receptor (Epidermal Growth Factor Receptor; EGFR) be the acceptor of epidermal growth factor (EGF) cell proliferation and signal conduction.EGFR belongs to a kind of of ErbB receptor family, and this family comprises EGFR (ErbB-1), HER2/c-neu (ErbB-2), Her 3 (ErbB-3) and Her 4 (ErbB-4).EGFR also is known as HER1, ErbB1, and sudden change or mistake are expressed and generally can be caused tumour.EGFR is a kind of glycoprotein, belongs to the Tyrosylprotein kinase receptor.Studies show that the EGFR mutator gene is effective in cure related with the drug use of Tyrosylprotein kinase inhibition class, these medicines comprise the Iressa(Iressa) and Tarceva(Te Luokai).The EGFR transgenation affects the clinical efficacy of EGFR tyrosine kinase inhibitor (TKI), finds that at present the sudden change of EGFR transgenation more than 90% is positioned at exons 1 9-21.Exons 19 base deletions, mainly be the base deletion sudden change of 746-752 bit codon, cause in the EGFR albumen aminoacid sequence to be lost, changed acceptor ATP in conjunction with capsule (ATP-binding poke, ABP) angle has significantly strengthened the susceptibility of tumour cell.

The detection method of EGFR mutator gene has polymerase chain reaction, fluorescence real-time polymerase chain reaction, high performance liquid chromatography, the capillary electrophoresis analysis in dna sequencing method, specificity site at present.With respect to dna sequencing, although other molecular biology method sensitivity and/or specific degree increase, most methods is still had relatively high expectations to drawing materials of tissue, needs more tumor tissues and the tumors of higher cell content is arranged.In addition, the method that has as fluorescence real-time polymerase chain reaction, high performance liquid chromatography and capillary electrophoresis etc., needs special plant and instrument, thereby still can not promote on a large scale clinically.And polymerase chain reaction-single-strand conformation polymorphism analysis (PCR-SSCP) is analyzed qualitatively although can only do, and by condition optimizing, can be used as a kind of method of primary dcreening operation sudden change clinically.

Summary of the invention

The purpose of this invention is to provide a kind of primer sets compound that is used to detect No. 19 exons mutations of human EGFR gene.

Another object of the present invention provides a kind of test kit that utilizes above-mentioned primer sets compound preparation, and the application of this test kit in detecting relevant No. 19 exons mutations of EGFR gene of nonsmall-cell lung cancer curative effect of medication.

Another purpose of the present invention provides a kind of method that detects No. 19 exons mutations of human EGFR gene, and this method utilizes test kit provided by the invention to detect, detect consuming time less, highly sensitive, specificity good, the detected result interpretation is easy, distinct.

Above-mentioned technical problem of the present invention is implemented by the following technical programs:

A kind of primer sets compound that is used to detect No. 19 exons mutations of human EGFR gene, form by primer with nucleotide sequence as described below:

5’-TAACGTCTTCCTTCTCTCTCTGTCA-3’?SEQ?ID?No:1,

5 '-GAAAGTTAAAATTCCCGTCGCTA-3 ' SEQ ID No:2 and

5’-ACACAGCAAAGCAGAAACTCACA-3’?SEQ?ID?No:3。This primer sets compound comprises the primer that is used to detect No. 19 exons mutations of EGFR gene, the upstream primer nucleotides sequence that wherein is used to detect No. 19 exons of EGFR gene is classified SEQ ID NO:1 as, the downstream primer nucleotides sequence is classified SEQ ID NO:3 as, comprises the upstream primer SEQ ID NO:2 of No. 19 exon inside of an EGFR gene in addition.

A kind of test kit comprises above-mentioned primer sets compound and PCR reaction solution at least.As preferably, described PCR reaction solution comprises Tris-HCl 40 mM of following component: pH 8.4, MgCl ₂15～24 mM, KCl 50 mM, (NH4) ₂SO ₄10 mM, dNTP 0.5mM, the Taq archaeal dna polymerase of final concentration 0.06～0.10 U/ μ L; Described primer sets compound comprises: the SEQ ID No:1 of each 10 μ M and the primer shown in the SEQ ID No:2, and the primer shown in the SEQ ID No:3 of 20 μ M.

The present invention also provides the application of a kind of described test kit in detecting No. 19 gene extron sudden changes of the relevant EGFR gene of nonsmall-cell lung cancer curative effect of medication.Described medicine is the Iressa(Iressa) or Tarceva(Te Luokai).Test kit of the present invention be used for assist clinicians diagnose out can benefit from the Iressa(Iressa) and Tarceva(Te Luokai) etc. the patients with lung cancer of specifics, being suitable for the nonsmall-cell lung cancer patient used before the course of treatment entering the individuation targeted therapy, can be the individual medication of patient the medication scientific basis is provided, reduce treatment risk and patient burden.

A kind of method that detects No. 19 gene extron sudden changes of human EGFR gene may further comprise the steps: (1) sample to be tested is handled and template DNA extracts; (2) DNA that uses test kit of the present invention that step (1) is obtained carries out the heminested PCR amplification; (3) detect the resulting pcr amplification product of step (2).

As preferably, the sample in the step (1) is fresh pathological tissue, paraffin embedding pathological anatomy, whole blood, blood plasma, serum or the hydrothorax of excision.

As preferably, the detection method in the step (3) is the micro-fluid chip detection method.

As preferably, detection method of the present invention combines with the micro-fluid chip detection method, specifically may further comprise the steps:

(1) with primer sets compound of the present invention the DNA of tested sample is carried out the heminested PCR amplification, pure wild-type, pure mutant are different with the amplified production of heterozygous mutant type;

(2) amplified production detects by micro-fluid chip;

(3) by to the quantity of each detected peaks and the judgement of detected peaks position, determine detected number of fragments and size, thereby determine detected gene, judge the sudden change situation of No. 19 exons of clinical sample EGFR gene;

(4) result judges: a) two pcr amplification products of 149bp and 98bp only occur, illustrate that the sudden change situation does not appear in No. 19 exons of EGFR gene of clinical sample, be pure wild-type; B) two pcr amplification products of 149bp and 98bp appear, and other two bands, illustrate that the part sudden change takes place No. 19 exons of EGFR gene of clinical sample.

The present invention sports detected object with No. 19 exons of human EGFR gene, utilizes the heminested PCR reaction of special primer group, detects by the PCR product being carried out micro-fluid chip, realizes quick, simple, accurate, responsive diagnosing human EGFR transgenation.Compare with test kit with conventional detection, the present invention has the following advantages:

(1) the present invention adopts PCR-SSCP(polymerase chain reaction-single-strand conformation polymorphism analysis) method, it is directed that No. 19 exon deletion mutantions detect to human EGFR gene, with combining of micro-fluid chip detection method, have that highly sensitive, speed is fast, a visual result, credible good advantage.

(2) detection method of the present invention and micro-fluid chip detection method associating, have level of automation height, the good advantage of man-machine interface, the error of having avoided many human factors to bring, required time and expense meet needs clinically well below conventional sequencing technologies.

Description of drawings

Fig. 1 is that the micro-fluid chip of No. 19 pure wild-type DNA samples of exon of EGFR gene detects figure.

Fig. 2 is that the micro-fluid chip of No. 19 exon mutant DNAs of EGFR gene sample detects figure.

Fig. 3 is the gene sequencing figure of No. 19 exon mutants of EGFR gene.

Embodiment

Followingly the present invention is described with reference to specific embodiment and accompanying drawing.It will be appreciated by those skilled in the art that these embodiment only are used to illustrate the present invention, the scope that it does not limit the present invention in any way.

Employed technology in following examples unless stated otherwise, is routine techniques known to those skilled in the art; Employed plant and instrument, reagent etc., only this specification sheets specifies, is that the research of this area and technician can be by public approach acquisition." PCR " of the present invention is meant polymerase chain reaction (polymerase chain reaction, PCR), be that a pair of oligo DNA of usefulness well known to those skilled in the art is as primer, by the repeatedly circulation of synthetic this one-period of sex change-annealing-DNA of heating, a Protocols in Molecular Biology that makes target DNA fragment obtain increasing.

The detecting instrument that micro-fluid chip detection method of the present invention is used is the full-automatic micro flow chip analyser of AMA2100 type that Geneinn Biotechnology (Ningbo) Co., Ltd. produces, and the number of patent application of this instrument is: CN200910272437.X, CN200920230097.X, CN200910272874.X, CN200910273037.0, CN200920288540.9, CN200910272436.5.

Embodiment 1Determining of EGFR to be detected mutational site

According to relevant NSCLC patient EGFR mutation research report (literature reference: Dong Qianggang, Han Baohui, the transgenation of EGFR exons 19 research in the advanced lung cancer free serum DNA, China's tumour magazine, 2006,1:59-61), find that the common mutation type of No. 19 exon genes of EGFR gene is as shown in table 1.

No. 19 exon genes mutation types of table 1 EGFR gene

Mutation type	Nucleotide sequence (5 '-3 ') 2416-2448	Aminoacid sequence (744-754)
			Wild-type	ATCAAGGAATTAAGAGAAGCAACATCTCCGAAA	LKELREATSPK
Disappearance E746-A750(1)	ATCAA----------------ACATCTCCGAAA	LK-----TSPK
			Disappearance E746-A750(2)	ATCAAG---------------ACATCTCCGAAA	LK-----TSPK
Disappearance L747-E749insP	ATCAAGGA----------GCAACATCTCCGAAA	LKE---ATSPK
			Disappearance L747-S752	ATCAAGGA-------------------CCGAAA	LKE------PK
Disappearance L747-S752insV	ATCAAGGA---TT--------------CCGAAA	LKV------PK
			Disappearance R748-T751insKA	ATCAAGGAATTAAGTGCA------TCTCCGAAA	LKELKAA-SPK

The present invention sports detected object with No. 19 exons of human EGFR gene, utilizes the heminested PCR reaction of special primer group, detects by the PCR product being carried out micro-fluid chip, realizes quick, simple, accurate, responsive diagnosing human EGFR transgenation.

This test kit has designed specific primer at the detection of the mutation type of exons 19, and when 9 transgenations of EGFR exons 1 lack, 4 amplified productions will appear in amplified production.And wild-type 2 amplified productions only appear.

Embodiment 2:The composition of test kit and preparation

Test kit of the present invention is made up of mixture, negative control thing, positive control and the sterilization distilled water of PCR reaction solution, combination of primers liquid.

1. prepare the PCR reaction solution: Tris-HCl(pH 8.4) 40 mM, MgCl ₂15～24mM, KCl 50 mM, (NH ₄) ₂SO ₄10 mM, dNTP 0.5 mM, the final concentration of Taq archaeal dna polymerase are 0.06～0.10 U/ μ L.MgCl wherein ₂Best concentration is 20 mM, and the best final concentration of Taq DNA polymerase is 0.08 U/ μ L.

2. prepare the mixed solution of primer sets compound: the SEQ ID No:1 of each 10 μ M and the primer shown in the SEQ ID No:2, and the primer mixed preparing shown in the SEQ ID No:3 of 20 μ M forms, and the volume ratio of the primer shown in primer shown in the primer shown in the SEQ ID No:1, the SEQ ID No:2 and the SEQ ID No:3 is 1:1:1;

3. distilled water (ddH sterilizes ₂O);

4. positive control: the clinical sample DNA that No. 19 exons are undergone mutation;

5. negative control thing: ddH ₂O.

Be the convenient effect of the present invention of describing, below each embodiment all adopt the optimal proportion of this test kit, test kit promptly of the present invention comprises:

1. 40 mM PCR reaction solution: Tris-HCl(pH 8.4), MgCl ₂20 mM, KCl 50 mM, (NH ₄) ₂SO ₄10 mM, dNTP 0.5 mM, the final concentration of Taq DNA polymerase are 0.08 U/ μ L;

2. the mixed solution of primer sets compound: the SEQ ID No:1 of each 10 μ M and the primer shown in the SEQ ID No:2, and the primer mixed preparing shown in the SEQ ID No:3 of 20 μ M forms, and the volume ratio of the primer shown in primer shown in the primer shown in the SEQ ID No:2, the SEQ ID No:2 and the SEQ ID No:3 is 1:1:1;

3. distilled water (ddH sterilizes ₂O);

4. positive control: the clinical sample DNA that No. 19 exons are undergone mutation;

5. negative control thing: ddH ₂O.

Embodiment 3: the extraction of clinical sample DNA

The clinical sample scope of application comprises fresh pathological tissue, paraffin embedding pathological anatomy, whole blood, blood plasma, serum, hydrothorax of excision etc., the blood/tissue genome that the DNA extraction test kit uses Geneinn Biotechnology (Ningbo) Co., Ltd. to produce extracts test kit (number of registration: No. the 1400013rd, river in Zhejiang Province, Zhejiang food medicine prison tool (standard) word 2010), operate according to the test kit specification sheets.Present embodiment uses this test kit to extract 1 normal physiological tissue samples and 9 fresh pathological tissue sample genomic dnas of clinical nonsmall-cell lung cancer respectively, concrete steps are pressed the test kit operation instructions, the normal physiological tissue samples DNA that extracts is numbered No. 1, and other pathological tissue dna sample number consecutively is 2-10 number.

Embodiment 4: with primer sets compound mixed solution DNA amplification sample

Embodiment extracted for employing primer sets compound provided by the present invention sequence amplification embodiment 3 1-10 number is totally 10 DNA samples, and the sequence of primer sees Table 2.

Table 2 pcr amplification mix primer sequence

SEQ ID NO.	The primer title	Primer direction message 5 ' 3′
			1	EGFR19.1	TAACGTCTTCCTTCTCTCTCTGTCA
2	EGFR19.2	GAAAGTTAAAATTCCCGTCGCTA
			3	EGFR19.1r	ACACAGCAAAGCAGAAACTCACA

1, the PCR reaction system sees Table 3.

Table 3

Composition	Volume/μ l
		ddH 2O	9.5
The PCR reaction solution	12.5
		Primer sets compound mixed solution	2
The DNA sample that extracts	1

2, PCR response procedures

The first round (primer shown in the SEQ ID No:1/SEQ ID No:3 carries out the PCR reaction)

94 ℃, 20 seconds; 59 ℃, 20 seconds; 72 ℃, 20 seconds; 35 circulations;

Second takes turns (primer shown in the SEQ ID No:2/SEQ ID No:3 carries out the PCR reaction)

94 ℃, 20 seconds; 60 ℃, 20 seconds; 72 ℃, 20 seconds; 35 circulations.

Embodiment 5: micro-fluid chip detects the sample method

Present embodiment detects the PCR product that is amplified among the embodiment 3 for adopting micro-fluid chip.Detection method is as follows:

(1) with primer sets compound of the present invention the DNA of tested sample is carried out the heminested PCR amplification, pure wild-type, pure mutant are different with the amplified production of heterozygous mutant type;

(2) amplified production detects by micro-fluid chip;

(3) by to the quantity of each detected peaks and the judgement of detected peaks position, determine detected number of fragments and size, thereby determine detected gene, judge the sudden change situation of No. 19 exons of clinical sample EGFR gene;

(4) result judges: a) two pcr amplification products of 149bp and 98bp only occur, illustrate that the sudden change situation does not appear in No. 19 exons of EGFR gene of clinical sample, be pure wild-type; B) two pcr amplification products of 149bp and 98bp appear, and other two bands, illustrate that the part sudden change takes place No. 19 exons of EGFR gene of clinical sample.

Micro-fluid chip detects sample and specifically comprises following operation steps:

1) connects the full-automatic micro flow chip analyser of AMA2100 type (Geneinn Biotechnology's production) power supply, instrument preheating 30 minutes.

2) joint detection pond and mainframe box front output interface, in the buffered soln bottle, add buffered soln (2% HPMC-50 that newly prepares, 80mM MES, 40mM Tris), electrode and two ends capillaceous are immersed in the buffered soln, keep the outlet of kapillary two ends on same horizontal plane, and must be full of buffered soln in the kapillary, shut the instrument main entrance, after confirming that the instrument each several part connects correctly, press the high voltage startup button, turn-off button if dynamic high-pressure takes place should press immediately unusually, after inspection and the eliminating fault, pressurization again again.

3) sample introduction: add 20 μ l sample solutions at the sample pool point.

4) set Instrument working parameter according to the experiment needs.Wherein sample introduction voltage is 380v, and electrophoretic voltage is 700v.

5) operation sample introduction and electrophoretic procedures, when the DNA band passed through check point, its information was noted by data collecting system, and is converted into electrical signal, promptly begins the analytical work of sample, collected the chip detection collection of illustrative plates.

Detect 10 DNA samples that amplified among the embodiment 4 according to the method described above, wherein 4 peaks appear in No. 3 samples and No. 7 pattern detection figure such as Fig. 2 as a result among the detected result figure, therefore judge that No. 7 samples are No. 19 exon heterozygous mutants of EGFR gene type; Other pattern detection is unanimity as a result, as Fig. 1, only occurs 2 peaks in the detected result, therefore judges that other 8 samples are No. 19 pure wild-types of exon of EGFR gene.

Entrust Invitrogen Shanghai branch office to the comparison of checking order of the amplification of No. 7 samples of No. 19 exon heterozygous mutants of the gene of EGFR shown in Fig. 2 type, the gene sequencing figure of No. 19 exon mutants of EGFR gene as shown in Figure 3, by comparison as can be known, the sequence that obtains of this clinical sample amplification compare pure wild type gene sequence exist really the 15bp gene ( GGAATTAAGAGAAGC) disappearance.

TATCAAAACATCTCCGAAAGCCAACAAGGAAATC(mutant sequence)

TATCAA GGAATTAAGAGAAGC AACATCTCCGAAAGCCAACAAGGAAATC(15bp deletion) (pure wild-type sequence)

Detection method of the present invention is compared sequence measurement, and detection is quick consuming time few, and testing cost is also relatively low, and is also relative with technical requirements loose to drawing materials.

Sequence table

 

＜110〉Geneinn Biotechnology (Ningbo) Co., Ltd.

 

＜120〉be used to detect primer sets compound, test kit and the method for No. 19 exons mutations of human EGFR gene

 

<130> ZH10093

 

<160> 3

 

<170> PatentIn?version?3.3

 

<210> 1

<211> 25

<212> DNA

＜213〉artificial sequence

 

<400> 1

taacgtcttc?cttctctctc?tgtca 25

 

 

<210> 2

<211> 23

<212> DNA

＜213〉artificial sequence

 

<400> 2

gaaagttaaa?attcccgtcg?cta 23

 

 

<210> 3

<211> 23

<212> DNA

＜213〉artificial sequence

 

<400> 3

acacagcaaa?gcagaaactc?aca 23

 

Claims (8)

1. primer sets compound that is used to detect No. 19 exons mutations of human EGFR gene is characterized in that it is made up of the primer with nucleotide sequence as described below:

5’-TAACGTCTTCCTTCTCTCTCTGTCA-3’?SEQ?ID?No:1,

5 '-GAAAGTTAAAATTCCCGTCGCTA-3 ' SEQ ID No:2 and

5’-ACACAGCAAAGCAGAAACTCACA-3’?SEQ?ID?No:3。

2. a test kit is characterized in that comprising at least primer sets compound as claimed in claim 1 and PCR reaction solution.

3. test kit according to claim 2 is characterized in that described PCR reaction solution comprises Tris-HCl 40 mM of following component: pH 8.4, MgCl ₂15～24 mM, KCl 50 mM, (NH4) ₂SO ₄10 mM, dNTP 0.5mM, the Taq archaeal dna polymerase of final concentration 0.06～0.10 U/ μ L; Described primer sets compound comprises: the SEQ ID No:1 of each 10 μ M and the primer shown in the SEQ ID No:2, and the primer shown in the SEQ ID No:3 of 20 μ M.

4. claim 2 or the 3 described test kits application in detecting No. 19 gene extrons sudden changes of the relevant EGFR gene of nonsmall-cell lung cancer curative effect of medication.

5. one kind is detected the method that No. 19 gene extrons of human EGFR gene suddenly change, and it is characterized in that may further comprise the steps:

(1) sample to be tested is handled and the template DNA extraction;

(2) DNA that uses claim 2 or 3 described test kits that step (1) is obtained carries out the heminested PCR amplification;

(3) detect the resulting pcr amplification product of step (2).

6. method according to claim 6 is characterized in that: the sample in the step (1) is fresh pathological tissue, paraffin embedding pathological anatomy, whole blood, blood plasma, serum or the hydrothorax of excision.

7. method according to claim 6 is characterized in that: the detection method in the step (3) is the micro-fluid chip detection method.

8. according to each described method among the claim 5-7, it is characterized in that may further comprise the steps:

(1) with the described primer sets compound of claim 1 DNA of tested sample is carried out the heminested PCR amplification, pure wild-type, pure mutant are different with the amplified production of heterozygous mutant type;

(2) amplified production detects by micro-fluid chip;

(3) by to the quantity of each detected peaks and the judgement of detected peaks position, determine detected number of fragments and size, thereby determine detected gene, judge the sudden change situation of No. 19 exons of clinical sample EGFR gene;

(4) result judges: a) two pcr amplification products of 149bp and 98bp only occur, illustrate that the sudden change situation does not appear in No. 19 exons of EGFR gene of clinical sample, be pure wild-type; B) two pcr amplification products of 149bp and 98bp appear, and other two bands, illustrate that the part sudden change takes place No. 19 exons of EGFR gene of clinical sample.

Images