CN1706502A - Antihypertensive nucleic acid vaccine and its prepn process - Google Patents
Antihypertensive nucleic acid vaccine and its prepn process Download PDFInfo
- Publication number
- CN1706502A CN1706502A CN 200510040234 CN200510040234A CN1706502A CN 1706502 A CN1706502 A CN 1706502A CN 200510040234 CN200510040234 CN 200510040234 CN 200510040234 A CN200510040234 A CN 200510040234A CN 1706502 A CN1706502 A CN 1706502A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- acid vaccine
- angii
- hbc
- plasmid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The present invention provides one kind of antihypertensive nucleic acid vaccine and its medicine effect raising method. The antihypertensive nucleic acid vaccine has hepatitis B core protein as immunological carrier and IL-4 as immunological adjuvant to strengthen the immunogenicity of antigen epitope angiotensin II (ANG II). Under the common action of the vaccine and IL-4, the body is introduced to generate antibody resisting ANG II, and the antibody is combined with endogenic ANG II to inhibit its activity. By means of the rennin-angiotensin-aldosterone system, the present invention lowers the blood pressure, protects cardiac muscle, reduces the increase rate of cardiac muscle thickness.
Description
Technical field
In medical domain, the invention provides the nucleic acid vaccine of a kind of treatment and prophylaxis of hypertension.
Background technology
It is relevant that blood pressure level and risk of cardiovascular diseases are seriality.World Health Organization (WHO) is defined as hypertension: do not obey under the antihypertensive situation systolic pressure 〉=140mmHg and/or diastolic pressure 〉=90mmHg.And the hypertension inducement much mainly contains: inherited genetic factors, environmental factors, organ disease factor.What wherein research was the most thorough is feritin-angiotensin (RAS) system, and most medicine is also at Renin-Angiotensin System (RAS) onset.The RAS system is the most important approach that hypertension forms, its rising blood pressure machine-processed as follows: the arteriolar juxtaglomerular cell secretion of the nearly ball of kidney feritin, the proangiotensin of hepatic secretion is converted into angiotensin I, angiotensin I is degraded to Angiotensin II (AngII) under Angiotensin-Converting (ACE) effect of pulmonary epithelial cells, AngII combines with angiotensin receptor, and angiotensin receptor mainly is present in blood vessel, and the heart, brain, kidney, thus cause the strong contraction of blood vessel, and the secretion of stimulation aldosterone, cause elevation of the blood pressure, make myocardial remodelling cause myocardial hypertrophy simultaneously, increase the weight of the hypertensive state of an illness.
The AngII level raises collaborative mutually with the increase of aldosterone level, can make the coronary artery permeability increase somatomedin and infiltrate matter between cardiac muscle, causes proliferation of fibrous tissue, myocardial wall thickens hardening, the formation ventricular filling is bad, and then strengthens the RAS system activity again, suppresses fibrinolysis.Studies show that AngII suppresses fibronectin and stimulates the plasminogen inhibitory factor expression, thereby lower fibrinolytic, promotion thrombosis.AngII can increase the weight of acute cerebrovascular patient's multiple organs failure.
The whole world has 20% adult to suffer from hypertension approximately at present, wherein nearly 50% hypertensive patient also is not diagnosed, had half not receive treatment among the hyperpietic who is made a definite diagnosis again, and in curer, blood pressure really is effectively controlled also only accounts for half.Hypertension is not only an independently disease, and is the main hazard factor of diseases such as heart disease, apoplexy, renal failure.Foreign study shows, gets hypertension, without treatment, develops as one pleases, and just occurs the infringement of the part heart, brain, kidney in three to five years, the average sicken age of this group patient 32 years old, 51 years old mean age at death.
Used in the market at RAS system antihypertensive drug, mainly be chemical synthetic drug, they can be divided into two kinds: 1. angiotensin-convertion enzyme inhibitor (ACEI), 2. angiotensin receptor antagonist (ARB).ACEI and ARB need patient's long-term prescription, and dosing interval is short, but and the present invention's long term inhibition hypertension can keep blood pressure stabilizations two weeks after the medication, and directly produce antibody at AngII, blood pressure lowering effect is obvious.Vaccine is as biological product; have the essence and the mechanism of action that are different from existing chemicals fully; by activating people's self immune system; generation has protection effectiveness and can keep the antibody of long duration in vivo, so the resisting hypertension developing vaccines provides new approaches and new method for preventing safely and effectively and treating hypertension.
AngII is the effector molecule of the rising blood pressure of octapeptide composition, and the rising of blood pressure is directly related with it.Produce antibody in the inductor of the present invention at AngII, the blood pressure effect that rises of shielding AngII, thus produce drug effect.Interleukin I V is a kind of cytokine, can the enhance immunity stimulation, and mediation Th1 (t helper cell) transfers the Th2 immunity to.Because the Th1 cell participates in many organ specificity autoimmune diseases, the Th2 cell then plays inhibitory action, and interleukin I V can make the caused cellular immunization and the humoral immunization of gene vaccine, become based on humoral immunization, thereby the rising antibody titer strengthens drug effect, reduces side effect.
Summary of the invention
The purpose of this invention is to provide a kind of antihypertensive nucleic acid vaccine.
Another object of the present invention provides the method for producing this antihypertensive nucleic acid vaccine.
Purposes that purpose is this antihypertensive nucleic acid vaccine in addition of the present invention.
Aspect first, provide a kind of antihypertensive nucleic acid vaccine of the present invention.This plasmid pCR3.1-X8-HBc-six ANGII carrier structure frame diagram is seen Figure of description 1, sequencer map is seen accompanying drawing Fig. 4, except that having the carrier for expression of eukaryon primary element, the nucleotide sequence that also includes coding hepatitis B core albumen (HBc), introduced the recognition site of a restricted enzyme in this HBc sequence, and introduced six sections and repeated the AngII sequence.Because people source AngII is an intrinsic small peptide in the human body, self non-immunogenicity, system tolerates by autoimmune, if adopt AngII directly as immunogen, then can't produce ideal immune effect.For strengthening the immunogenicity of AngII II, break immunologic tolerance, we adopt hepatitis B core albumen (HBc) granule as immune carrier.HBc has in the eukaryotic cell great expression, and self is assembled into the not peculiar property of the communicable virus-like particle of tool.This granule is made up of 240 HBc monomers, and the surface has 120 furcellas, and the main immunity district (MIR) of HBc promptly is positioned at the tip of furcella.The HBc virus-like particle is easy to be absorbed by full-time antigen presenting cell, has significant stimulation B cell, t helper cell and cytotoxic T cell to produce immunoreactive ability.Use six sections repeat the AngII polypeptide as epi-position can enhancing body at the immunization of Angiotensin II.
Interleukin I V (IL-4) has immunostimulation.This plasmid (pIL-4) structural framing figure sees Fig. 2, and sequencer map is seen Fig. 3.IL-4 can be used as adjuvant, strengthens the immune effect of nucleic acid vaccine, and itself suppresses the generation of autoimmune disease also bringing into play unique effect aspect the treatment autoimmune disease.
In a second aspect of the present invention, the method for producing antihypertensive nucleic acid vaccine is provided, details are as follows for its technology path:
1. the structure of antihypertensive nucleic acid vaccine plasmid pCR3.1-X8-HBc-six ANGII and corresponding gene engineering bacteria
3 primers of peptide sequence design according to Angiotensin II, with the add-on PCR method amplification six sections dna fragmentations that repeat AngII that obtain encoding, insert in the restriction enzyme site of the AgeI in the plasmid vector that this laboratory makes up pCR3.1-X8-HBc, the recombiant plasmid pCR3.1-X8-HBc-six ANGII that forms amalgamation and expression, recombinant plasmid transformed escherichia coli DH-5 α obtains the recombination engineering bacteria.
2. the acquisition of engineering bacterium fermentation and antihypertensive nucleic acid vaccine recombiant plasmid
Based on LB culture medium and fermentation medium, fermentation parameter is as follows: temperature 36-38 ℃, and PH6.8-7.2.The centrifugal collection engineering bacteria in fermentation back.With alkaline lysis the plasmid DNA in the engineering bacteria is slightly carried, crude extract is through anion exchange resin DEAE cellulose purification, in TE (pH8.0), carry out gradient elution with NaCl solution, with 0.3mol/L NaCl impurity (as protein, low molecular weight RNA) eluting is removed earlier, with 0.6mol/L NaCl the plasmid DNA eluting is collected then, and will collect liquid two volumes dehydrated alcohol precipitation, centrifugal gained precipitation is plasmid DNA purification.Recombiant plasmid purity with agarose gel electrophoresis and UV spectrophotometer measuring purification.
3 hypertension nucleic acid vaccines finally prepare
The plasmid of the pIL-4 that extracts and pCR3.1-X8-HBc-sixANGII plasmid pressed 1: 5 mixed in normal saline.
The third aspect at this paper is the purposes of antihypertensive nucleic acid vaccine.With antihypertensive nucleic acid vaccine recombiant plasmid direct immunization animal, the system that translates by host cell gives expression to the reorganization HBC virus-like particle that the surface has the AngII epi-position in body, and excitating organism produces the specific antibody at AngII.Anti-AngII antibody capable combines with endogenous AngII in the body, blocking-up AngII and its receptors bind, thus bring high blood pressure down, avoid myocardial remodelling, reduce myocardial fibrosis.Interleukin I V (IL-4) can induce Th1 to be converted into the Th2 immunity by changing partial cytokine levels on the other hand, has promptly strengthened the humoral immunization effect of nucleic acid vaccine, has reduced the autoimmune damage that is caused by cellular immunization.
Description of drawings
Fig. 1 pCR3.1-X8-HBc-six ANGII plasmid structure chart
Fig. 2 pIL-4 plasmid structure chart
Fig. 3 pIL-4 plasmid sequencer map
Part HBC and six sections AngII sequencer maps among Fig. 4 pCR3.1-X8-HBc-six ANGII
Comparison diagram before and after the medication of Fig. 5 rat systolic pressure.The result shows that pCR3.1-X8-HBc-six ANGII can make Hypertensive Rats systolic pressure decline 20mmHg (mercury column).
Comparison diagram before and after the medication of Fig. 6 rat diastolic pressure.The result shows that pCR3.1-X8-HBc-six ANGII+Il-4 can make Hypertensive Rats diastolic pressure decline 10mmHg (mercury column).
Fig. 7 rat heart muscle plumpness is respectively organized comparison diagram.The result shows that pCR3.1-X8-HBc-six ANGII+IL-4 immune rat can alleviate the plump degree of rat heart muscle.
Fig. 8 ELISA antibody test figure.The ELISA measurement result shows: nucleic acid vaccine pCR3.1-X8-HBc-six ANGII+IL-4 is immune rat altogether, can make rat produce the highest antibody titer.
The nervous plain II ria-determination of Fig. 9 serum medium vessels.The result shows: nucleic acid vaccine pCR3.1-X8-HBc-six ANGII+IL-4 is immune rat altogether, can effectively reduce the concentration of the nervous plain II of serum medium vessels.
Figure 10 myocardial fibrosis slice map.The result shows: pCR3.1-X8-HBc-six ANGII+IL-4 immune rat altogether can effectively must protect cardiac muscle, alleviates the plump degree and the Fibrotic degree of cardiac muscle.
The specific embodiment
(1) bacterial strain, cell line and plasmid:
Host bacterium Escherichia coli DH-5 α is a genetic engineering common tool strain, and the laboratory relevant with genetic engineering research generally all has preservation.
Plasmid pCR3.1uni is available from Invitrogen company.
(2) hepatitis B virus
Extraction is from the HBcAg of Nanjing City No.2 Hospital positive patients serum
(3) enzyme and reagent:
The molecular cloning toolenzyme is available from MBI company reagent
It is Promega company product that PCR purification kit, glue reclaim test kit
It is Qiagen company product that the hepatitis B virus gene group is extracted test kit
Other reagent is that worker's biological engineering company limited order is given birth in Shanghai
(4) culture medium:
The LB culture medium, the document Sambrook J that sees reference that fills a prescription, Fristsh E F, Maniatis T.Molecular Cloning; A Laboratory Manual 2nd ed.NY:Cold Spring Harbor Laboratory Press, 1989.
(5) Cellouse-DEAE52 is a Whatman company product.
(6) horseradish peroxidase-labeled rabbit Chinese People's Anti-Japanese Military and Political College Mus two is anti-is Wuhan doctor's moral company product.
(7) 3,3`, 5,5`-tetramethyl benzidine (TMB), hydrogen peroxide urea and bovine serum albumin (BSA) are U.S.'s sigma (Sigma) company product.
(8) 96 hole ELISA Plate are U.S. CORNING (Corning) company product.
(9) BESN-11 multichannel animal noinvasive measuring cell, Nanjing Bioisystech Co., Ltd of DESAY
Method
The recovery of plasmid extraction, polymerase chain reaction, endonuclease digestion, dna segment, connection and transformed into escherichia coli, referring to Sambrook J, Fristsh E F, Maniatis T.Molecular Cloning; A Laboratory Manual 2nd ed.NY:Cold Spring Harbor Laboratory Press, 1989, pp.16-340.
The quantitative assay of nucleic acid: referring to Sambrook J, Fristsh E F, Maniatis T.Molecular Cloning; A Laboratory Manual 2nd ed.NY:Cold Spring Harbor Laboratory Press, 1989.
Embodiment 1: carrier for expression of eukaryon pCR3.1-X
8The structure of-HBc
From the HBcAg of Nanjing City No.2 Hospital positive patients serum, extract hepatitis B virus gene group RNA with QIAamp DNA Blood Mini Kit.And be cDNA with the random primer of market sale with the RNA reverse transcription, according to the primer P1-P4 of the synthetic respectively two pairs of energy of hepatitis B virus core antigen gene order with this gene complementation.5 ' the end of primer P1, P3 and P4 contains HindIII, AgeI and XbaI enzyme cutting site respectively, and the 5 ' end of primer P2 contains PstI and two restriction enzyme sites of AgeI successively.The first step is a primer with P1 and P2, and the hepatitis B virus DNA that obtains with reverse transcription is that template is carried out PCR, 94 ℃, and 5min; 94 ℃, 1min, 58 ℃, 1min, 72 ℃, 1min 30 takes turns totally; 72 ℃, 10min.The PCR product that amplification obtains is that the N end of HBc digests with restricted enzyme HindIII and PstI, is connected with the pCR3.1uni plasmid that digests with the same restrictions restriction endonuclease.Be primer with P3 and P4 again, the hepatitis B virus DNA that obtains with reverse transcription is that template is carried out PGR, 94 ℃, and 5min; 94 ℃, 1min, 58 ℃, 1min, 72 ℃, 1min 30 takes turns totally; 72 ℃, 10min.The PCR product that amplification obtains is that the C end of HBc digests with restriction enzyme A geI and XbaI, and the plasmid that makes up with the first step that digests with the same restrictions restriction endonuclease is connected.So just the pairing nucleotide of the 80th, the 81 amino acids place in the HBcAg sequence has introduced the AgeI site.
P1：5’AAAAAGCTTATGGACATTGACACGTATAAAGAA?3’
P2：5’TTTTTCTGCAGACCGGTTGGGTCTTCCAAATTACTTCC?3’
P3：5’ATCACCGGTCGGGAATTAGTAGTCGGTTATGTCAATG?3’
P4：5’TTGTCTAGACTAACATTGAGATTCCCGAGATTG?3’
Design T1 and T2 primer 3 ' end 25 base complementrities are introduced single endonuclease digestion site Age1 with primer from obtain three sections sequence and two ends of repeating AngII as template PCR, at 3 ' the terminal Kpn1 restriction enzyme site of introducing.Design P3 and P2,3 ' end, 25 base complementrities are introduced single endonuclease digestion site Kpn1 with primer from obtain three sections sequence and two ends of repeating AngII as template PCR.Primer is rich inferior synthetic by Shanghai.
The PCR reaction system: 100pmo1 T1,100pmol T2, the PFU archaeal dna polymerase of 2 μ l dNTP (10mmol/L) and 5 units totally is 50 μ l.
100pmol T3,100pmol T2, the PFU archaeal dna polymerase of 2 μ l dNTP (10mmol/L) and 5 units totally is 50 μ l.
PCR reaction condition: 94 ℃ of 5min; 94 ℃ of 45s, 58 ℃ of 45s, 72 ℃ of 30s, period 30; 72 ℃ of 10min.
With primer P1 and the P2 after the amplification purification, the dna fragmentation that P3 and P2 amplify adopts Age1 to carry out enzyme action, and reaction system is as follows: ddH
2O 27 μ l; 10 * Buffer O
+6 μ l; Ang II dna fragmentation 24 μ l; AgeI 3 μ l, totally 60 μ l, react 2h by 37 ℃.The enzyme action product reclaims through PCR product purification test kit.
The pCR-X8-HBc plasmid that adopts alkaline lysis that the last step was made up carries out extracting, and the plasmid that extracting obtains also carries out enzyme action with AgeI.The enzyme action system is as follows: ddH
2O 39ul, 10 * Buffer O
+6 μ l, pCR-X8-HBc plasmid 12 μ l, AgeI 3 μ l, totally 60 μ l, 37 ℃ of enzyme action 2h.The enzyme action product reclaims through PCR product purification test kit, and proves conclusively through 0.8%agarose gel electrophoresis detection.This plasmid enzyme restriction product is carried out dephosphorylation (CIAP1) to be handled.The CIAP system is as follows: ddH
2O 37 μ l, 10 * CIAP Buffer, 7 μ l, pCR-X8-HBc plasmid enzyme restriction product 24 μ l, CIAP 2 μ l, totally 70 μ l.The CLAP product reclaims through PCR product purification test kit, and through 0.8%agarose gel electrophoresis detection, the high efficiente callback of conclusive evidence CIAP product.The P1 dna fragmentation that amplification obtains with P2 that obtains after the above-mentioned enzyme action recovery is connected with pCR-X8-HBc plasmid fragment.The coupled reaction system is as follows: 10 * T4DNA ligase Buffer, 1 μ l, P1 and P2 amplification of DNA fragments 4 μ l; PCR-X8-HBc plasmid fragment 4 μ l, T4DNA ligase 1 μ l, totally 10 μ l, 16 ℃ of connections are spent the night, and it is pCR-X8-HBc-3 * ANGII plasmid that gained connects product.
With alkaline lysis method of extracting pCR-X8-HBc-3 * ANG plasmid, use the Kpn1 enzyme action behind the plasmid purification test kit purification with China's wink.Reaction system is as follows: ddH
2O 39 μ l, 10 * L, 6 μ l, pCR-X8-HBc-3 * ANG plasmid 12 μ l, KpnI 3 μ l, totally 60 μ l, 37 ℃ of enzyme action 2h.The enzyme action product reclaims through PCR product purification test kit, and proves conclusively through 0.8%agarose gel electrophoresis detection.This plasmid enzyme restriction product is carried out dephosphorylation (CIAP) to be handled.The CIAP system is as follows: ddH
2O 37 μ l, 10 * CIAPBuffer, 7 μ l, pCR-X8-HBc plasmid enzyme restriction product 24 μ l, CIAP 2 μ l, totally 70 μ l.The CIAP product reclaims through PCR product purification test kit, and through 0.8%agarose gel electrophoresis detection, conclusive evidence CIAP product is efficiently with receiving.The T3 dna fragmentation that amplification obtains with T2 that obtains after the above-mentioned enzyme action recovery is connected with pCR-X8-HBc-3 * ANG II plasmid fragment.The coupled reaction system is as follows: 10 * T4DNA ligase Buffer, 1 μ l, the dna fragmentation 4 μ I of T3, T2 amplification; PCR-X8-HBc-3 * ANG plasmid fragment 4 μ l, T4DNA ligase 1 μ l, totally 10 μ l, 16 ℃ of connections are spent the night, and it is pCR-X8-HBc-sixANG II plasmid that gained connects product.
T1：TTCACCGGTGACCGTGTTTACATCCATCCGTTCGATCGCGTGTATATTCATCCATTTGA
T2：TTTACCGGTACCGAACGGGTGGATGTAAACACGGTCAAATGGATGAATATACACGCGAT
T3：AAAGGTACCGACCGTGTTTACATCCATCCGTTCGATCGCGTGTATATTCATCCATTTGA
Preparation E.coli DH-5 α competent cell, transform with above-mentioned connection liquid, to transform the positive colony called after pCR-X8-HBc-sixANG II of the anti-amp that occurs on the flat board of back coating, and behind the employing alkaline process extracting plasmid, adopt the PCR screening to pick out positive colony.Increase with X1, T2 in the PCR screening, the dna fragmentation that if can obtain 462bp length is positive colony
X1：5’AAA
ATGGACATTGACACGTATAAAGAA?3’
The acquisition of interleukin I V pIL-4: interleukin-6 gene is by Department of pathology and laboratorymedicine, University of Pennsylvania is so kind as to give, designed two primer C1, C2 amplification IL-4 also introduces EcoRI and Kpn I restriction enzyme site is packed in the Ptarget plasmid.
C1：5’CGAATTATGGGTCTCAACCCC
C2：5’GGTACCCTACGAGTAATCCATTT
Embodiment 2: the mass preparation of engineering bacterium fermentation and antihypertensive nucleic acid vaccine recombiant plasmid
The engineering bacteria that contains pCR3.1-X8-HBc-six ANGII plasmid is cultivated to shake in the bottle at 1000ml and is carried out.Picking list bacterium colony inserts in the LB fluid medium from the plate of fresh switching, 37 ℃ cultivate 8 hours to logarithmic (log) phase as first order seed, be linked into the 1000ml that contains the 250mlLB fluid medium with 1/250 inoculum concentration and shake in the bottle, 37 ℃ of violent joltings continue to cultivate 12 hours.Collect thalline with the centrifugal 15min of 5000rpm, the bacterial precipitation thing fully is resuspended in 9ml solution I [50mmol/L glucose, 25mmol/LTris-HCl (pH8.0), 10mmol/L EDTA (pH8.0)] in, add 100 μ lRNase solution [10mg/ml RNase again, 10mmol/L Tris-HCl (pH7.5), 15mmol/L NaCl], ice bath 10min behind the mixing.Slowly add the solution II [0.2mmol/L NaOH, 1%SDS] of the new preparation of 20ml, place 5min in room temperature behind the mixing gently.Add the ice-cold solution III of 10ml [5mol/L KAc60ml, HAc 11.5ml, H
2O 28.5ml], ice bath 10min behind the abundant mixing content.4 ℃ with the centrifugal 30min of 12000rpm, gets supernatant, adds the isopropyl alcohol of 0.6 volume, and room temperature is placed 10min.Room temperature with 70% washing with alcohol precipitation, with 2ml TE (pH8.0) dissolution precipitation, promptly gets the plasmid DNA crude product with the centrifugal 30min of 12000rpm.With (the φ 1.6cm * 30cm) of DEAE cellulose DE52 post on the plasmid DNA crude product, in TE (pH8.0), carry out gradient elution with NaCl, with 0.3mol/L NaCl impurity (as protein, low molecular weight RNA) eluting is removed earlier, with 0.6mol/L NaCl the plasmid DNA eluting is collected then, and will collect the dehydrated alcohol precipitation of liquid with two volumes, centrifugal gained precipitation is plasmid DNA purification.With the recombiant plasmid purity of agarose gel electrophoresis and UV spectrophotometer measuring purification and carry out quantitatively.
Embodiment 3: the blood pressure pharmacodynamic study of antihypertensive nucleic acid vaccine
Make two kidneys, one folder type renal hypertensive rat model.Get the healthy SD rat, body weight 180-220g, under the anesthesia of chloral hydrate, cropping exposes left kidney, peel off renal artery with the glass minute hand, put U type crack and close muscle and fur, wound divides with iodine disinfection and with the emery cloth parcel raises in cages, continuous three days lumbar injection penicillin 2-3 of postoperative ten thousand units/only, once a day.Behind the first quarter moon every approximately 3-5 days can measuring blood pressure, pressure measurement is three times at first continuously, every systolic pressure is higher than 160mmHG and promptly got renal hypertension.
Each 8 of model control group and normal saline negative control group.With physiological saline solution nucleic acid vaccine or vector plasmid are diluted to 1 μ g/ μ L; each injects interleukin I V (pIL-4) nucleic acid, vector plasmid or the normal saline of 100 μ L nucleic acid vaccines and 20ul respectively at every rat two hind leg tibialis anterior places, and promptly nucleic acid vaccine experimental group and vehicle group inoculum concentration only are 240 μ gDNA/.Later on once, carry out 5 immunity altogether every 2 all booster immunizations.Get blood once every 2 all eye socket endocanthions behind the initial immunity, blood volume is 1.5ml, and is centrifugal, gets the freezing preservation of serum.Detect anti-AngII antibody in the serum with ELISA, ELISA the results are shown in Figure 8, find that pCR3.1-X8-HBc-six ANG II and pIL-4 can bring out the antibody of special anti-Ang II by 5: 1 hybrid injections, and make the systolic pressure reduction 20mmHg of rat see accompanying drawing 5, make the diastolic pressure reduction 10mmHg of rat see accompanying drawing 6 (T checks P＜0.05) simultaneously.
Embodiment 4: the blood pressure pharmacodynamic study of antihypertensive nucleic acid vaccine
After producing the rat administration of renal hypertension, put to death in one month after the drug withdrawal.The dirty isolating cardiac left ventricle of coring is weighed, and calculates left ventricle and body weight ratio.PCR3.1-X8-HBc-six ANG II and pIL-4 can alleviate myocardial hypertrophy degree (T checks p＜0.05) by 5: 1 hybrid injections, and detecting index is the ratio of left ventricle and body weight, sees accompanying drawing 7, pCR3.1-X
8-HBc-six ANGII+pIL-4 injection group altogether left ventricular hypertrophy degree is lighter than hypertension model matched group.Section detects and to have confirmed further that pCR3.1-X8-HBc-six ANGII+pIL-4 injects altogether myocardial protective effect is seen Figure 10.
Figure 10 is to immune group, model group, and the cardiac muscle of normal saline group is cut into slices, and finds that the cardiac muscle of immune group is compared with the cardiac muscle of model group, and the cardiac muscle fiber thickened degree of immune group weakens, and vessel wall thickening suppresses to some extent, and cardiac muscle fiber hamartoplasia suppresses to some extent.
Claims (7)
1. an antihypertensive nucleic acid vaccine is characterized by the DNA sequence that contains coding hepatitis B core albumen (HBc), and introduces the DNA sequence that coding people source Angiotensin II polypeptide repeats segment (hereinafter to be referred as AngII) in this HBc sequence.This nucleic vaccine plasmid and interleukin 4 (pIL-4) are united and are used to strengthen its immunogenicity.
2. the described nucleic acid vaccine of claim 1 is characterized by the recognition site of a restricted enzyme (AgeI) is introduced in the pairing nucleotide sequence of 80-81 amino acids of HBc, is used to insert six of foreign epitopes and repeats the AngII sequence.After multiple AngII sequence is inserted, still can be assembled into nano-scale particle, greatly strengthen the immunogenicity of AngII through the fusion rotein of transfection expression.
3. the described nucleic acid vaccine of claim 2 is characterized by the epitope AngII that the HBc particle surface inserts, and its aminoacid sequence is Asp-Arg-Val-Tyr-Ile-His-Pro-Phe.
4. the described nucleic acid vaccine of claim 1 is characterized in that nucleic acid vaccine mixes the back injection with the eukaryon expression plasmid of interleukin 4, can induce the high titre antibody at Angiotensin II.Interleukin 4 can specific enhancing humoral immunization, and enhancing body can be brought out extremely strong immunne response to the immunne response of exogenesis material with this nucleic acid vaccine coupling.
5. nucleic acid vaccine according to claim 1, it is characterized in that behind the immune animal can excitating organism producing the antibody of antiangiotensin II polypeptide, combine with endogenous Angiotensin II in the body by this antibody, regulate the organism blood pressure, reduce the groundwater increment of cardiac muscle, delay the formation of myocardial hypertrophy, treatment hypertension and myocardial hypertrophy.
6. according to the described nucleic acid vaccine of claim 1, it is characterized in that this nucleic acid vaccine and interleukin 4 eucaryon plasmids were by 5: 1 mixed, can produce immunostimulation preferably, alleviate the side effect that the cellular immunization of this nucleic acid vaccine brings, strengthen humoral immunization, induce the antibody of generation at AngII.
7. according to the described antihypertensive nucleic acid vaccine of claim 1, it is characterized in that and to make pharmaceutical composition with the combination of other drug active component.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510040234 CN1706502A (en) | 2005-05-25 | 2005-05-25 | Antihypertensive nucleic acid vaccine and its prepn process |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510040234 CN1706502A (en) | 2005-05-25 | 2005-05-25 | Antihypertensive nucleic acid vaccine and its prepn process |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1706502A true CN1706502A (en) | 2005-12-14 |
Family
ID=35580733
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200510040234 Pending CN1706502A (en) | 2005-05-25 | 2005-05-25 | Antihypertensive nucleic acid vaccine and its prepn process |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1706502A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102905719A (en) * | 2010-03-26 | 2013-01-30 | 南加利福尼亚大学 | Methods for treating combined radiation and thermal injury |
| CN103566378A (en) * | 2013-09-09 | 2014-02-12 | 南京海智生物工程有限公司 | Tumor nucleic acid vaccine based on tissue factor as well as preparation method and application of vaccine |
| CN103796673A (en) * | 2011-04-15 | 2014-05-14 | 国立大学法人大阪大学 | Dna vaccine |
| US9913886B2 (en) | 2012-09-21 | 2018-03-13 | Anges, Inc. | DNA vaccine containing specific epitope of apolipoprotein (a) |
| CN109663124A (en) * | 2019-02-14 | 2019-04-23 | 武汉华纪元生物技术开发有限公司 | Chimeric bivalent antihypertensive vaccine aiming at human vascular smooth muscle cell L-type calcium channel and angiotensin 1 receptor and application thereof |
-
2005
- 2005-05-25 CN CN 200510040234 patent/CN1706502A/en active Pending
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102905719A (en) * | 2010-03-26 | 2013-01-30 | 南加利福尼亚大学 | Methods for treating combined radiation and thermal injury |
| CN102905719B (en) * | 2010-03-26 | 2015-04-22 | 南加利福尼亚大学 | Methods for treating combined radiation and thermal injury |
| CN103796673A (en) * | 2011-04-15 | 2014-05-14 | 国立大学法人大阪大学 | Dna vaccine |
| US9446120B2 (en) | 2011-04-15 | 2016-09-20 | Osaka University | DNA vaccine |
| CN107519498A (en) * | 2011-04-15 | 2017-12-29 | 国立大学法人大阪大学 | DNA vaccination |
| US9913886B2 (en) | 2012-09-21 | 2018-03-13 | Anges, Inc. | DNA vaccine containing specific epitope of apolipoprotein (a) |
| CN103566378A (en) * | 2013-09-09 | 2014-02-12 | 南京海智生物工程有限公司 | Tumor nucleic acid vaccine based on tissue factor as well as preparation method and application of vaccine |
| CN103566378B (en) * | 2013-09-09 | 2016-09-14 | 南京海智生物工程有限公司 | Tumor nucleic acid vaccine based on tissue factor, preparation method and applications |
| CN109663124A (en) * | 2019-02-14 | 2019-04-23 | 武汉华纪元生物技术开发有限公司 | Chimeric bivalent antihypertensive vaccine aiming at human vascular smooth muscle cell L-type calcium channel and angiotensin 1 receptor and application thereof |
| CN109663124B (en) * | 2019-02-14 | 2022-05-13 | 武汉华纪元生物技术开发有限公司 | Chimeric bivalent antihypertensive vaccine aiming at human vascular smooth muscle cell L-type calcium channel and angiotensin 1 receptor and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102020716B (en) | Gene recombination human collagen fusion peptide segment, preparation method and application thereof | |
| CN1793177A (en) | Recombined collagen and synthesizing and expressing purifying process thereof | |
| CN1706502A (en) | Antihypertensive nucleic acid vaccine and its prepn process | |
| CN101921733A (en) | Preparation method and application of Qbeta-2aa phage virus-like particle protein | |
| EP3034515B1 (en) | Fusion protein of ganoderma lucidum immunoregulatory protein and human serum albumin and its use for treating cancer | |
| CN102757945B (en) | Human urate oxidase protein and preparation method and polyethylene glycol composite thereof | |
| CN106084038A (en) | A kind of people recombinates the expression in Pichia sp. of the Irisin albumen and purification process | |
| CN105176897A (en) | Recombinant engineering strain expressing GnRH/M2 fusion polypeptide and construction and application thereof | |
| CN101851620B (en) | Method for producing FGFs by utilizing edible medicinal fungus | |
| CN102174110B (en) | Rabies virus glycoprotein-derived peptide and application thereof | |
| CN102191207A (en) | Gene engineering bacterium of expression of soluble FGF-21 and construction method and application thereof | |
| CN102241776B (en) | RANKL-TNF (Receptor Activator of Nuclear Factor Kappa-B Ligand-Tumour Necrosis Factor) sample region fusion protein and preparation method and application thereof | |
| CN108840950A (en) | A kind of fusion protein and preparation method thereof being made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha | |
| CN102838679B (en) | The preparation and application of Her2 neu antigen positive tumor therapeutic vaccines | |
| CN102260346B (en) | Exendin-4 analog | |
| CN101838325B (en) | Antigen-presenting protein for swines and encoding gene and application thereof | |
| CN100451116C (en) | Human tissue factor pathway inhibitory factor mutation gene mTFPI, recombination carrier including the same and host cell thereof | |
| CN104761631A (en) | P-nitrophenylalanine multi-locus introduction human tumor necrosis factor-alpha | |
| CN103397040A (en) | Recombinant plant-derived antihypertensive peptide | |
| CN1167799C (en) | Method for secreting and expressing acid fibroblast growth factor | |
| CN101818167A (en) | Method for producing Delta sleeping peptide by utilizing escherichia coli prokaryotic expression system | |
| CN1277921C (en) | Method for producing recombinant human lactoferrin in silkworm body by gene engineering technology | |
| CN1944644A (en) | Process for preparing HIV-lgp120 and human gamma-interferon fusion protein | |
| CN1129454C (en) | DNA vaccine for foot-and -mouth disease | |
| CN1443850A (en) | Method for preparing recombinant human CTLA4 extracellular region protein, and obtained product and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |