CN1699596A - Method for quick trace synchronous detection of bacteria - Google Patents
Method for quick trace synchronous detection of bacteria Download PDFInfo
- Publication number
- CN1699596A CN1699596A CN 200410045432 CN200410045432A CN1699596A CN 1699596 A CN1699596 A CN 1699596A CN 200410045432 CN200410045432 CN 200410045432 CN 200410045432 A CN200410045432 A CN 200410045432A CN 1699596 A CN1699596 A CN 1699596A
- Authority
- CN
- China
- Prior art keywords
- bacteria
- bacterium
- electrophoresis
- pcr
- 10min
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a fast synchronous inspection method of micro content bacteria, which comprises: 1) mould board preparation, 2) PCR augmentation, the augmentation guide object is the general guide object of bacteria ribosomal ribonucleic acid gene, 3) gel electrophoresis of denaturization gradient, i.e. gel electrophoresis of denaturization gradient for augmentation outgrowth to determine sorts. The augmentation of 16S rRNA gene segment of bacteria is realized through UPPCR technology, obtaining all corresponding bacteria gene segment sequence information, and then DGGE is employed to appraise the augmentation outgrowth of mixed bacteria, so as to confirm the inspected bacteria. The invention provides a fast synchronous inspection method of micro content bacteria by combining the technologies of UPPCY and DGGE, which achieves the advantages of micro content, fast and synchronous inspection for mixed bacteria, especially pathogenic bacteria.
Description
Technical field
The present invention relates to the particularly method of pathogenic bacteria of the quick synchronous detection bacterium of a kind of trace.
Background technology
Pathogenic bacteria serious harm people's healthy and industrial and agricultural production.If will control its caused disease, just should diagnose in time to take corresponding precautionary measures.In recent years, PCR (polymerase chain reaction) technology has been applied to the detection of pathogenic bacteria.These detection techniques can be divided into two big classes, are respectively Auele Specific Primer PCR and non-specific primer PCR.The former has different primer sequences according to purpose bacterium difference, and different primer sequences may need different amplification conditions, if bacterium to be checked is not clear, then be difficult to reach purpose (the Peng X X of quick special detection, Zhang J Y, Wang S Y, et al, Immuno-capture PCRfor Detection of Aeromonas hydrophila.J.Microbiol.Methods.2002; 49 (3): 335-338): the latter is generally according to the synthetic universal primer of bacterial 16 S rRNA (rRNA) gene conservative, the product that is increased often needs to cooperate RFLP (pvuii restriction fragment analysis), SSCP (single strand conformation polymorphism) or sequential analysis just can determine, from pathogenic bacteria more than 2 kinds, then be difficult to directly obtain the result as institute's amplified production.Based on above-mentioned situation, we utilize antibodies specific to discern bacterium to be checked at design, adopt bacterial 16 S rRNA gene universal primer to carry out pcr amplification (UPPCR) again, set up universal primer immunocapture method round pcr, can reach the purpose (CN02101983.5 that detects pathogenic bacteria in the mixture fast specifically, Xiamen University is used for the immunocapture method universal primer PCR method of bacterial detection).Because the kind of pathogenic bacteria is more, some pathogenic bacteria also has more hypotype and serotype.Adopt antibody capture method UPPCR to detect, then need more material.
Summary of the invention
Purpose of the present invention aims to provide a kind of UPPCR-DGGE of utilization (universal primer PCR amplification-denaturing gradient gel electrophoresis) trace method of synchronous detection various bacteria fast.Its technical scheme is at first to utilize 16S rRNA gene universal primer to increase, and obtains this gene fragment of all bacteriums in the sample to be checked, carries out DGGE then and analyzes to determine this bacterium.
Concrete steps of the present invention are as follows:
1) preparation template:
2) pcr amplification (UPPCR): amplimer is a bacterial ribosome ribonucleic acid gene universal primer;
3) denaturing gradient gel electrophoresis (DGGE): get amplified production and carry out denaturing gradient gel electrophoresis, compare, determine the kind of mixt bacteria with standard control.
The preparation template can adopt direct heat degeneration methods or antibody capture after heat degeneration methods, and the step of said direct heat degeneration methods is heated to cracking for getting the mixt bacteria culture, the centrifuging and taking supernatant liquor.The step of said antibody capture after heat degeneration methods is to get mixed culture bacterium liquid to have added the bag quilt at the specific antibody more than 2 kinds, is heated to cracking, gets supernatant liquor.Carry out UPPCR then.
The present invention adopts the 16S rRNA gene fragment of UPPCR technology amplification bacterium, thereby obtains the information of all bacterium corresponding gene fragment sequences in the substratum, adopts DGGE to identify the amplified production of these mixt bacterias again, with the bacterium of determining to detect.Thereby set up the synchronous fast detection technique of identifying mixt bacteria of trace that a kind of UPPCR of employing and DGGE combine.Ultimate principle of the present invention is the conservative property that the 16S rRNA gene of bacterium has height, and therefore universal primer nearly all bacterium of can increasing can obtain the information of all bacteriums in the sample to be checked.According to the isolating susceptibility of DGGE the mixt bacteria product is separated one by one again, with the contrast of itself and standard diagram, then can identify bacterium at last, thus reach trace, fast, the synchronous detection mixt bacteria purpose of pathogenic bacteria especially.
Description of drawings
Fig. 1 obtains the UPPCR product collection of illustrative plates of pathogenic bacteria template and the DGGE analytical results of product for direct method.In Fig. 1, A.UPPCR result.M, molecular weight standard; 1, Pseudomonas fluorescens; 2, Vibrio anguillarum; 3, Vibrio flurialis; 4, Aeromonas hydrophila; 5, providencia rettgeri; 6, Aeromonas sobria; 7,6 kinds of bacterium mix.B.DGGE result; 1, Pseudomonas fluorescens; 2, Vibrio anguillarum; 3, Vibrio flurialis; 4, Aeromonas hydrophila; 5, providencia rettgeri; 6, Aeromonas sobria, 7,6 kinds of bacterium mix.
Fig. 2 obtains the UPPCR product collection of illustrative plates of pathogenic bacteria template and the DGGE analytical results of product for antibody act.In Fig. 2, A.UPPCR result.M, molecular weight standard; 1, the dysentery bacterium serum 1 type; 2, Bao Shi dysentery bacterium serum 1 type; 3, shigella flexneri 1a type; 4, shigella flexneri 3a type; 5,4 kinds of bacterium mix.B.DGGE result.1, the dysentery bacterium serum 1 type; 2, Bao Shi dysentery bacterium serum 1 type; 3, shigella flexneri 1a type; 4, shigella flexneri 3a type; 5,4 kinds of bacterium mix.
Embodiment
Following examples will the present invention is further illustrated in conjunction with the accompanying drawings.
Use the direct heat degeneration methods to prepare template, in the LB substratum, 28 ℃ of shaking tables are cultivated 12～18h with microbionation, and as kind of a daughter bacteria, then (bacterium liquid: substratum) ratio was inoculated in above-mentioned substratum of the same race, and 28～37 ℃ of shaking tables are cultivated 12～13h with 1: 50; Get bacterium liquid 0.5ml in aseptic 1.5ml centrifuge tube, 3,500 rev/mins of centrifugal 20min abandon supernatant; Precipitation adds aseptic double-distilled water 0.8ml with distillation washing one time, and mixing boils 10min in 100 ℃ of water-baths; Centrifuge tube after the water-bath put in 0 ℃ of ice bath cool off, use 12 again, the centrifugal 10min of 000rpm draws 15～30 μ l (25 μ l PCR reaction systems are got 15 μ l, and 50 μ l PCR reaction systems are got 30 μ l) supernatant liquor as the PCR reaction template.
Inhale in order and add 2.5 μ l, 10 * damping fluid, 0.5 μ l dNTP (mixture of ribonucleotides, each 10mM), 0.7 μ lMgCl
2(25mM), 0.16 μ l primer mixed solution (primer 1:5 '-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGGCACAAGCGGTGGAGC ATGTG, wherein added the GC clamp of 40 Nucleotide, in order that stablize the resolving power of DGGE at 5 ' end; Primer 2: 5 '-GCCCGGGAACGTATTCACCG), 0.2 μ l Taq enzyme (5u μ l
-1), and 15 μ l templates, in each PCR pipe, complementing to volume with aseptic double-distilled water at last is 25 μ l, is collected in the pipe end after the abundant mixing of each reagent is also centrifugal a little; Little centrifuge tube behind the application of sample is placed the pcr amplification instrument, and amplification program is 94 ℃ of 10min, then 94 ℃ of 1min, 68 ℃ of min, 72 ℃ of 3min, after this each cycle annealing temperature is fallen 0.5 ℃, until 58 ℃, be 58 ℃ with annealing temperature again and repeat 20 PCR circulations, last 72 ℃ of 10min; Get PCR product 5 μ l after the amplification, mix with an amount of sample loading buffer (0.25% tetrabromophenol sulfonphthalein, 40% aqueous sucrose solution), point sample in 2% sepharose that contains 0.5 μ g/mL bromination second pyridine (EB), 80V electrophoresis 30min, observations subsequently.
DGGE: with 7L1 * TAE (Tutofusin tris acetate electrophoresis) damping fluid (Tutofusin tris 48.4g, Glacial acetic acid 11.42ml, 0.5M disodium ethylene diamine tetraacetate 20ml pH8.0, adding distil water to 200ml be the 50X damping fluid, autoclaving, room temperature preservation) pour in the electrophoresis chamber, the temperature regulator frame on electrophoresis chamber, connect good electric wire, the switch on the temperature regulator, pump and well heater are opened successively; It is 56 ℃ that temperature regulator is set to preset temperature, and rate of temperature change is 200 ℃/h, to carry out the preheating of electrophoresis liquid; With clean sheet glass, the parallel gradient gel interlayer of pad assembling one cover 16cm * 16cm, and lock it on the encapsulating frame, make it the maintenance level; Link to each other with flexible pipe respectively with two supporting syringes, at syringe subscript " LO " and " HI ", use " LO " syringe and " HI " syringe to suck 0% sex change glue and 70% sex change glue (in 70% sex change glue, adding the indicating liquid that 320 μ l denatured gradients form) respectively; The volume of setting gradient mixer (cam wheel) is 14.5mL, a pair of syringe that is connected with Y tube and No. 16 syringe needles is separately fixed at the both sides of gradient mixer; Revolving gear is poured into glue in the interlayer, plugs clean comb, waits to coagulate; After coagulating, take out comb, take off interlayer; Two interlayers are individually fixed in the electrophoresis chamber, pour 350ml 1 * TAE damping fluid in last groove into, put temperature controller by correct direction, turn on the power switch, pump and well heater again, make system reach 56 ℃ of setting; Mix with 5 μ l pcr amplification samples and equivalent 2 * gel application of sample staining fluid (0.25% tetrabromophenol sulfonphthalein, 40% aqueous sucrose solution), application of sample is (for improving the concentration that susceptibility can improve the PCR product by concentration) in the well that cleaned; Transferring voltage is 20V 20min, and 100 electrophoresis, 10～12h opens temperature regulator simultaneously then, makes system held at 56 ℃; After electrophoresis was finished, powered-down and heating system were taken off interlayer, took out blob of viscose; Glue is put into the dyeing dish that 250ml 1 * TAE damping fluid and 25 μ l 0mg/ml bromination second pyridines are housed, dyeing 5～10min; After the dyeing, glue is moved on in the dish that 250ml 1 * TAE damping fluid is housed decolouring 5～20min; Glue after the dyeing is placed in the polychrome gel imaging system and scans saving result.
Similar to Example 1, its difference is to adopt antibody capture after heat degeneration methods to prepare template, can use pH9.6 with the antibody (as type, group specificity antibody) of various bacteria reaction, 0.01mol/L the carbonic acid buffer dilution is wrapped quilt respectively to 96 each hole of hole enzyme-linked reaction plate (1～10 μ g/ml), every hole 50 μ l are in 4 ℃ of refrigerator overnight; Use pH7.4 then, 0.01mol/L phosphoric acid salt-tween damping fluid (PBS-T) is washed plate 3 times, each 3～5min; Every hole adds 50 μ l, 10% calf serum, and 36～38 ℃ of sealing 1hr dry; Every hole adds bacterial liquid nutrient solution 20～40 μ l (25 μ l PCR reaction systems add 20 μ l, and 50 μ l PCR reaction systems add 40 μ l), in 36～38 ℃ of incubation 1～2h, washes plate 5 times with the PBS-T washing lotion, each 3～5min.Every hole add 20～40 μ l (with adding the bacterium liquor capacity consistent) aseptic double-distilled water, boiling water bath heating 8～10min, draw 15～30 μ l (25 μ l PCR reaction systems are got 15 μ l, and 50 μ L PCR reaction systems are got 30 μ l) lysate as the PCR reaction template.
Bacterium template preparation: adopt Pseudomonas fluorescens (Pseudomonas fluorescens), Vibrio anguillarum (Vibrioanguillarum), Vibrio flurialis (Vibrio fluvialis), Aeromonas hydrophila (Aeromonas hydrophila), providencia rettgeri (Providencia rettgeri), Aeromonas sobria (Aeromonas sobria) is for the applicant preserves bacterial classification.With above-mentioned bacterium respectively with combined inoculation in the LB substratum, totally 7 pipes, 28 ℃ of shaking tables are cultivated 12～18h, as kind of a daughter bacteria.Then (bacterium liquid: substratum) ratio was inoculated in above-mentioned substratum of the same race, and 28 ℃ of shaking tables are cultivated 12～13h with 1: 50; Get bacterium liquid 0.5ml in the new little centrifuge tube of aseptic 1.5ml, 3,500 rev/mins of centrifugal 20min abandon supernatant; Precipitation adds aseptic double-distilled water 0.8ml with distillation washing one time, and mixing boils 10min in 100 ℃ of water-baths; Place 0 ℃ of ice bath to cool off the little centrifuge tube after the water-bath, use 12 again, the centrifugal 10min of 000rpm draws 15 μ L supernatant liquors as the PCR reaction template.
UPPCR: get aseptic new rifle head and inhale in order and add 2.5 μ l, 10 * damping fluid, 0.5 μ l dNTP (each 10mM), 0.7 μ l MgCl
2(25mM), 0.16 μ l primer mixed solution (primer 1:5 '-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGGCACAAGCGGTGGAGC ATGTG+ primer 2: 5 '-GCCCGGGAACGTATTCACCG), 0.2 μ l Taq enzyme (5u μ l
-1), and 15 μ l templates, complementing to final volume with aseptic double-distilled water at last is 25 μ l, is collected in the pipe end after the abundant mixing of each reagent is also centrifugal a little; Little centrifuge tube behind the application of sample is placed the pcr amplification instrument, and setting program is 94 ℃ of 10min, then 94 ℃ of 1min, 68 ℃ of min, 72 ℃ of 3min, after this each cycle annealing temperature is fallen 0.5 ℃, until 58 ℃, be 58 ℃ with annealing temperature again and repeat 20 PCR circulations, last 72 ℃ of 10min; After finishing, amplification takes off centrifuge tube.Get PCR product 5 μ l, mix with an amount of sample loading buffer, point sample in 2% sepharose that contains 0.5 μ g/mL bromination second pyridine (EB), 80V electrophoresis 30min, observations subsequently.
DGGE: the method by embodiment 1 is carried out, 1 sample of every pipe point.
Bacterium template preparation: adopt dysentery bacterium serum 1 type (S.dysenteriae serotypel), Bao Shi dysentery bacterium serum 1 type (S.boydii serotype 1), shigella flexneri 1a type (S.flexneri serotype 1a), shigella flexneri 3a type (S.flexneri serotype 3a) is the applicant and preserves bacterial classification.With above-mentioned 4 kinds of bacteriums respectively with combined inoculation in the LB substratum, totally 5 pipes, 37 ℃ of shaking tables are cultivated 12～18h, as kind of a daughter bacteria.Then (bacterium liquid: substratum) ratio was inoculated in above-mentioned substratum of the same race with 1: 50,37 ℃ of shaking tables are cultivated 12～13h and are spent the night: get bacterium liquid 20 μ l and add bag by in the enzyme plate of dysentery bacterium antibody (this antibody all specific combination can take place to all dysentery bacteriums), in 36～38 ℃ of incubation 1h, wash plate 5 times with the PBS-T washing lotion, each 3～5min.Every hole adds 20 μ l aseptic double-distilled waters, and boiling water bath heating 8～10min draws 15 μ l lysates as the PCR reaction template.
UPPCR: with embodiment 3.
DGGE: with embodiment 3.
Claims (7)
1, the quick synchronization detecting method of bacterium trace is characterized in that step is:
1) preparation template;
2) pcr amplification: amplimer is a bacterial ribosome ribonucleic acid gene universal primer;
3) denaturing gradient gel electrophoresis: get amplified production and carry out denaturing gradient gel electrophoresis, compare, determine the kind of mixt bacteria with standard control.
2, the quick synchronization detecting method of bacterium trace as claimed in claim 1, it is characterized in that said preparation template adopts direct heat degeneration methods or antibody capture after heat degeneration methods, the step of said direct heat degeneration methods is heated to cracking for getting the mixt bacteria culture, the centrifuging and taking supernatant liquor; The step of said antibody capture after heat degeneration methods is to get mixed culture bacterium liquid to have added the bag quilt at the specific antibody more than 2 kinds, is heated to cracking, gets supernatant liquor, carries out UPPCR then.
3, bacterium as claimed in claim 1 trace synchronization detecting method fast, it is characterized in that said amplimer be 5 '-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGGCACAAGCGGTGGAGC ATGTG and 5 '-GCCCGGGAACGTATTCACCG primer.
4, the quick synchronization detecting method of bacterium trace as claimed in claim 2, it is characterized in that said direct heat degeneration methods is in the LB substratum with microbionation, 28 ℃ of shaking tables are cultivated 12～18h, as kind of a daughter bacteria, then (bacterium liquid: substratum) ratio was inoculated in 28 ℃ of above-mentioned substratum of the same race or 37 ℃ of shaking tables are cultivated 12～13h with 1: 50; Get bacterium liquid 0.5ml in aseptic 1.5ml centrifuge tube, 3,500 rev/mins of centrifugal 20min abandon supernatant; Precipitation adds aseptic double-distilled water 0.8ml with distillation washing one time, and mixing boils 10min in 100 ℃ of water-baths; Centrifuge tube after the water-bath put in 0 ℃ of ice bath cool off, use 12 again, the centrifugal 10min of 000rpm draws 15～30 μ l supernatant liquors as the PCR reaction template.
5, the quick synchronization detecting method of bacterium trace as claimed in claim 2, it is characterized in that said antibody capture after heat degeneration methods can with the antibody pH9.6 of various bacteria reaction, 0.01mol/L the carbonic acid buffer dilution is wrapped quilt respectively to each hole 1～10 μ g/ml of 96 hole enzyme-linked reaction plates, every hole 50 μ l are in 4 ℃ of refrigerator overnight; Use pH7.4 then, 0.01mol/L phosphoric acid salt-tween damping fluid is washed plate 3 times, each 3～5min; Every hole adds 50 μ l, 10% calf serum, and 36～38 ℃ of sealing 1hr dry; Every hole adds bacterial liquid nutrient solution 20～40 μ l, in 36～38 ℃ of incubation 1h, washes plate 5 times with the PBS-T washing lotion, each 3～5min, every hole adds 20～40 μ l aseptic double-distilled waters, and boiling water bath heating 8～10min draws 15～30 μ l lysates as the PCR reaction template.
6, the quick synchronization detecting method of bacterium trace as claimed in claim 1 is characterized in that said pcr amplification adds 2.5 μ l, 10 * damping fluid, 0.5 μ l dNTP, 0.7 μ l MgCl for inhaling in order
225mM, 0.16 μ l primer mixed solution, primer 1:5 '-CGCCCGCCGCGCGCGGCGGG CGGGGCGGGGGCACGGGGGGGCACAAGCGGTGGAGCATGTG has wherein added the GC clamp of 40 Nucleotide at 5 ' end, in order that stablize the resolving power of DGGE; Primer 2: 5 '-GCCCGGGAACGTATTCACCG, 0.2 μ l Taq enzyme, and 15 μ l templates, in each PCR pipe, complementing to volume with aseptic double-distilled water at last is 25 μ l, is collected in the pipe end after the abundant mixing of each reagent is also centrifugal a little; Little centrifuge tube behind the application of sample is placed the pcr amplification instrument, and amplification program is 94 ℃ of 10min, then 94 ℃ of 1min, 68 ℃ of min, 72 ℃ of 3min, after this each cycle annealing temperature is fallen 0.5 ℃, until 58 ℃, be 58 ℃ with annealing temperature again and repeat 20 PCR circulations, last 72 ℃ of 10min; Get PCR product 5 μ l after the amplification, mix with sample loading buffer, point sample in 2% sepharose that contains 0.5 μ g/mL bromination second pyridine, 80V electrophoresis 30min, observations subsequently.
7, the quick synchronization detecting method of bacterium trace as claimed in claim 1, it is characterized in that said DGGE is for to pour 7L1 * Tutofusin tris acetate electrophoretic buffer in the electrophoresis chamber into, the temperature regulator frame on electrophoresis chamber, connect good electric wire, the switch on the temperature regulator, pump and well heater are opened successively; It is 56 ℃ that temperature regulator is set to preset temperature, and rate of temperature change is 200 ℃/h, to carry out the preheating of electrophoresis liquid; With clean sheet glass, the parallel gradient gel interlayer of pad assembling one cover 16cm * 16cm, and lock it on the encapsulating frame, make it the maintenance level; Link to each other with flexible pipe respectively with two supporting syringes,, use " LO " syringe and " HI " syringe to suck 0% sex change glue and 70% sex change glue respectively at syringe subscript " LO " and " HI "; The volume of setting gradient mixer is 14.5mL, a pair of syringe that is connected with Y tube and No. 16 syringe needles is separately fixed at the both sides of gradient mixer; Revolving gear is poured into glue in the interlayer, plugs clean comb, waits to coagulate; After coagulating, take out comb, take off interlayer; Two interlayers are individually fixed in the electrophoresis chamber, pour 350ml 1 * TAE damping fluid in last groove into, put temperature controller by correct direction, turn on the power switch, pump and well heater again, make system reach 56 ℃ of setting; Mix with equivalent 2 * gel application of sample staining fluid with 5 μ l pcr amplification samples, application of sample is in the well that cleaned; Transferring voltage is 20V 20min, and 100 electrophoresis, 10～12h opens temperature regulator simultaneously then, makes system held at 56 ℃; After electrophoresis was finished, powered-down and heating system were taken off interlayer, took out blob of viscose; Glue is put into the dyeing dish that 250ml1 * TAE damping fluid and 25 μ l 0mg/ml bromination second pyridines are housed, dyeing 5～10min; After the dyeing, glue is moved on in the dish that 250ml 1 * TAE damping fluid is housed decolouring 5～20min; Glue after the dyeing is placed in the polychrome gel imaging system and scans saving result.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100454320A CN1296490C (en) | 2004-05-19 | 2004-05-19 | Method for quick trace synchronous detection of bacteria |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100454320A CN1296490C (en) | 2004-05-19 | 2004-05-19 | Method for quick trace synchronous detection of bacteria |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1699596A true CN1699596A (en) | 2005-11-23 |
| CN1296490C CN1296490C (en) | 2007-01-24 |
Family
ID=35475843
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2004100454320A Expired - Fee Related CN1296490C (en) | 2004-05-19 | 2004-05-19 | Method for quick trace synchronous detection of bacteria |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1296490C (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101974646A (en) * | 2010-11-25 | 2011-02-16 | 杭州迪安医学检验中心有限公司 | Assay kit of urine sample bacterial pathogen and detection method thereof |
| CN101475987B (en) * | 2009-01-13 | 2012-12-05 | 南京大学 | Rapid molecule detecting method for microflora composition in waste water biological treatment reactor |
| CN103196980A (en) * | 2013-03-27 | 2013-07-10 | 中国水产科学研究院淡水渔业研究中心 | Rapid pulse field gel electrophoresis typing method for streptococcus fish |
| CN109811034A (en) * | 2019-03-30 | 2019-05-28 | 西北农林科技大学 | A kind of preparation method of high-purity DNA profiling |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1176218C (en) * | 2002-01-22 | 2004-11-17 | 厦门大学 | Universal primer PCR method for immunocapture to detect bacteria |
-
2004
- 2004-05-19 CN CNB2004100454320A patent/CN1296490C/en not_active Expired - Fee Related
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101475987B (en) * | 2009-01-13 | 2012-12-05 | 南京大学 | Rapid molecule detecting method for microflora composition in waste water biological treatment reactor |
| CN101974646A (en) * | 2010-11-25 | 2011-02-16 | 杭州迪安医学检验中心有限公司 | Assay kit of urine sample bacterial pathogen and detection method thereof |
| CN103196980A (en) * | 2013-03-27 | 2013-07-10 | 中国水产科学研究院淡水渔业研究中心 | Rapid pulse field gel electrophoresis typing method for streptococcus fish |
| CN103196980B (en) * | 2013-03-27 | 2014-10-08 | 中国水产科学研究院淡水渔业研究中心 | Rapid pulse field gel electrophoresis typing method for streptococcus fish |
| CN109811034A (en) * | 2019-03-30 | 2019-05-28 | 西北农林科技大学 | A kind of preparation method of high-purity DNA profiling |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1296490C (en) | 2007-01-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105203759B (en) | A kind of method of use colloidal gold chromatographic technology for detection mycoplasma pneumoniae nucleic acid and test kit | |
| CN103911443B (en) | The gene chip of a kind of detection 11 kinds of Common infectious dysentery substances and application thereof | |
| CN104059975B (en) | To Providence O3, the Nucleotide that O4, O8, O12, O13 and O20 are special and application thereof | |
| CN106148559A (en) | The multiple PCR primer system of a kind of five kinds of animal derived materials of synchronous detecting and detection method | |
| US20230086107A1 (en) | Loop-mediated isothermal amplification (lamp) primer sets for detecting porcine susceptibility-related pathogenic bacteria, and kit, lamp chip and use based on the same | |
| CN107164497A (en) | Loop-mediated isothermal amplification technique detects the primer and kit of pseudomonas aeruginosa | |
| CN1296490C (en) | Method for quick trace synchronous detection of bacteria | |
| CN108504753A (en) | A method of detection staphylococcus aureus live bacteria in milk | |
| CN101368203B (en) | Primer, reagent kit and detection method for monotonic increasing Listeria hymenial veil mediated isothermality amplification technique fast detection | |
| WO2005005659A1 (en) | Diagnostics of diarrheagenic escherichia coli (dec) and shigella spp. | |
| CN105969864A (en) | Helicobacter pylori infected individual treatment gene chip, preparation method and detection method | |
| CN105154559A (en) | Specific nucleotide for vibrio parahaemolyticus K36, K37 and K68 and application thereof | |
| CN102041298B (en) | PCR (Polymerase Chain Reaction) rapid detection method for Bacillus coagulans | |
| CN102031282B (en) | Kit of ready-to-use salmonella identification plate, preparation method and use method | |
| CN101665826A (en) | Method for detecting clinical Mycoplasma pneumoniae by applying loop-mediated isothermal amplification technology | |
| CN105256041A (en) | Specific nucleotide for aeromonas hydrophila O44, O24, O25 and O28 and application thereof | |
| CN106636394A (en) | Isothermal amplication detection kit for nucleic acid of aeromonas and detection method of isothermal amplication detection kit | |
| CN105063172B (en) | A kind of method of quick Screening and Identification Streptococcus suis | |
| CN104342497A (en) | Method for LAMP (looped-mediated isothermal amplification) detection of trypanosoma evansi variant strain with deletion of ToTat1.2 gene | |
| CN105112406A (en) | Nucleotides specific to Hafnia alveibifermentans G58097, G5898 and G5900 and their application | |
| CN105112506B (en) | A kind of gene liquid chip and its detection method to 10 kinds of K antigens genotypings of escherichia coli in sample | |
| AU2020101928A4 (en) | Application and method of Imp gene in preparing kit for detecting Riemerella anatipestifer serotype | |
| CN105154439A (en) | Nucleotide specific to hafinia alvei G5902, G5903, G5904 and G5906, and application of nucleotide | |
| CN105154438A (en) | Nucleotide specific to hafinia alvei G5907, G5908, G5913 and G5916, and application of nucleotide | |
| CN105177144A (en) | Nucleotide for specificity of K4, K32 and K34 of vibrio parahaemolyticus and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20070124 |