CN105063172B - A kind of method of quick Screening and Identification Streptococcus suis - Google Patents
A kind of method of quick Screening and Identification Streptococcus suis Download PDFInfo
- Publication number
- CN105063172B CN105063172B CN201510459749.7A CN201510459749A CN105063172B CN 105063172 B CN105063172 B CN 105063172B CN 201510459749 A CN201510459749 A CN 201510459749A CN 105063172 B CN105063172 B CN 105063172B
- Authority
- CN
- China
- Prior art keywords
- strain
- tested
- catalase
- streptococcus suis
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of method that biochemistry and molecular biology are combined quick Screening and Identification Streptococcus suis, this method is divided into two parts and is completed.The characteristics of first with nature streptococcus intermedius category catalase test feminine gender, the strain to be tested of catalase-positive can be quickly excluded in 30 seconds, then using design Streptococcus suis specific primer, performing PCR detection is entered to strain to be tested.The advantage that present invention comprehensive utilization biochemistry and molecular biology are combined, compared to the detection method of domestic and foreign current, when carrying out large-scale analysis of clinic pathogenic microorganism Screening and Identification, can save more than 50% it is artificial when, numerous detection field requirements are disclosure satisfy that, in the application prospect that following quick diagnosis detection field has had.
Description
Technical field
The invention belongs to technical field of microbial detection, it is related to the quick detection of Streptococcus suis, especially a kind of bioid
Learn method and the application that quick detection Streptococcus suis group is combined with molecular biology.
Background technology
Streptococcus suis is one of Important cause of disease for causing pig ill.Streptococcus suis is newly discovered strain, and one is slightly raw
The related data of the not no strain of thing automatic identifying system, how quick detection streptococcosis, to help pig farm and pig farmer fast
The streptococcosis of fast prevention and control pig, it is an important problem urgently to be resolved hurrily.
Currently used for detect Streptococcus suis method be：Biochemical method, serological method and PCR detection techniques.Current
The detection box of bacterium class uses biochemical method more, streptococcus can glucose fermentation, sucrose, but to lactose, synanthrin, trehalose,
The Utilization ability of mannitol, salicin, sorbierite, raffinose, gill fungus sugar etc. is different then because of different strain.Due to biochemical test knot
Fruit changes greatly, and the degree of accuracy is inadequate, now the complementary testing only using biochemical test as serological test.Serologic detection pig chain
Coccus method, based on cardinal principle is the specific reaction of antigen and antibody, typically carry out, commonly use under certain condition in vitro
Method for CA etc., can be with people and a variety of food in one's mouths by means of the A albumen in aureus cell wall composition
The characteristic that the Fc sections of IgG antibody-likes combine in newborn animal (pig, rabbit, sheep, mouse etc.) serum, indicate specific agglutination phenomenon.This method
Complex operation, stability is poor, and differences between batches are big.
, can one-time detection Streptococcus suis and streptococcus equi although establishing a variety of multiplex PCR detection architectures both at home and abroad at present
Epizootic disease subspecies and its a variety of virulence factors, but in the application of clinical pathological material of disease, the Sensitivity and Specificity of the multiple system by
Huge challenge, the repeatability and confidence level of detection architecture are relatively low.When identifying a small amount of sample or germ bacterium colony
PCR detection techniques have the advantage that：Easy to operate, time saving, high sensitivity, high specificity.But detected in analysis of clinic pathogenic microorganism
Cheng Zhong, existing situation are that mixed infection situation is more, and Species of Pathogens is various, and every kind of doubtful bacterium enters performing PCR identification, detects sample
Amount is big, and workload and experimentation cost are significantly lifted.
By comparing, the main distinction of the invention existing for the file disclosed above delivered is, special with reference to Streptococcus suis
Property and efficiently biochemical test technology and the advantage of Streptococcus suis gdh genetic fragment specific PCR technology both sides, by it is simple easily
The biochemical test technology of operation carries out preliminary quickly screening for (30 seconds), and then remaining doubtful bacterial strain is entered using round pcr
Row is further quickly and accurately identified.Present patent application advantageous combination catalase test technology and gdh gene PCR technologies,
Reach quick to analysis of clinic pathogenic microorganism by preliminary screening and accurate detection accurately to detect, ensureing quick and accurate basis
On, save substantial amounts of man power and material.
Summary of the invention
The invention provides a kind of method for quick Screening and Identification Streptococcus suis.
In one embodiment, method of the invention comprises the following steps：
(a) primary election is carried out to strain to be tested by catalase test, excludes the strain to be tested of catalase-positive, wherein specific steps
For：Sterile working picking strain to be tested, the strain to be tested is immersed to 3% hydrogen peroxide solution 30 seconds, then observation is in double
The strain to be tested in the oxygen aqueous solution, when the strain to be tested by bubble surround or its nearby there is bubble to emerge, then judge
The bacterial strain is catalase-positive bacteria, is excluded, without by bubble surround and its nearby strain to be tested for emerging of no bubble is then
It is determined as catalase negative strain；
(b) for showing as the negative strain to be tested of catalase by step (a) primary election, detection is used as using the strain to be tested
Template, bacterium colony PCR is carried out using following primer：
Sense primer：TCCATCTTGAAGTTCCTCGGTTTTG
Anti-sense primer：CTTTGAAGGATTTACCGTTTGCT
(c) electrophoresis detection is carried out to the PCR primer in step (b), when band of the appearance more than 250bp and less than 500bp
When, then judge the strain to be tested for Streptococcus suis.
In another embodiment, method of the invention is in step (c), is more than 250bp for described and is less than
500bp band, purifying recovery is further carried out, the product after then being reclaimed to purifying is sequenced, when its length is 384bp
When, then judge the strain to be tested for Streptococcus suis.
In another embodiment, in method of the invention, the detection template in step (b) is made by the following method
It is standby：The bacterium colony of strain to be tested, is placed in sterilized water described in sterile working picking, mixes, 100 DEG C of water-baths 5 minutes,
12000r/min is centrifuged 30 seconds, then takes supernatant as detection template.
In another embodiment, in method of the invention, the bacterium colony PCR reaction systems wherein in step (b) are 25 μ
L, and consist of the following composition：10 × buffer solution (contains MgCl2)2.5μL；dNTP2μL；The μ L of detection template 2；Above and below described
Swim each 1 μ L (20pmol/L) of primer；The μ L of Taq archaeal dna polymerases 0.2；Sterilizing distilled water is adjusted to 25 μ L.
In another embodiment, in method of the invention, the program of the bacterium colony PCR wherein in step (b) is:
95 DEG C of pre-degeneration 5min；
Repeat 32 circulations：94 DEG C of denaturation 30s, 52.3 DEG C of annealing 30s, 72 DEG C of extension 30s,；
72 DEG C of extension 6min.
Detailed description of the invention
Unless otherwise indicated, all technologies and scientific terminology all have implication common to those skilled in the art.It is all special
Profit, patent application, public publication, GenBank sequences, website and other open materials quote addition herein in full, remove
It is non-to be otherwise noted.
It is an object of the present invention in place of overcome the deficiencies in the prior art, there is provided a kind of simple and fast detects Streptococcus suis
Method, strains of streptococcus can be screened in a short time, and can quickly determines whether it is Streptococcus suis, with help pig farm and
Pig farmer prevention and control Streptococcus suis.
What the present invention ran into when carrying out batch or the detection of large-scale pig farm Streptococcus suis cause of disease according to laboratory actually asks
Topic, there is provided the method quick detection Streptococcus suis cause of disease that biochemistry and molecular biology are combined.
Catalase is also known as catalase, has the bacterium of catalase, and energy catalyzing hydrogen peroxide turns into water and atomic state
Oxygen, oxygen molecule is then formed, bubble occur.Mostly aerobic and facultative anaerobic bacteria produces catalase, but Streptococcaceae is cloudy
Property, therefore this experiment is commonly used to identify.
The present invention is achieved by the following technical solutions：
1. catalase test reagent and operation：
Reagent and consumptive material：30% hydrogen peroxide 1ml is taken, ultra-pure water 9ml, is placed in after mixing according to 2ml/ bottles in penicillin bottle
It is standby.The disposable 200ul of sterilizing some boxes of pipette tips.
Catalase test：Using 3% hydrogen peroxide solution is immersed after sterile pipette tips picking single bacterium colony, 30 seconds are stood, catalase-positive
Bacterium is it can be seen that surrounding has a large amount of bubbles to surround or has a large amount of bubbles to emerge, catalase negative bacterium then bubble-free.It is cloudy to mark catalase
The bacterium colony of property.
2.PCR is detected
The negative bacterium colony of catalase further enters performing PCR detection, to further determine that Streptococcus suis.Therefore, according to pig hammer
The conserved regions design primer of bacterium gdh genes, a kind of bacterium PCR method that can detect Streptococcus suis is established, determines the major class of pathogen,
Laid the foundation to further investigate the work such as the serotype of Streptococcus suis in next step.
Template extraction：
The sterile pipette tips picking strain to be tested of pipettor blows and beats 3-6 mixing, 100 DEG C of water-baths repeatedly in 100ul ultra-pure waters
5 minutes, 12000r/min was centrifuged 30 seconds, and supernatant is as detection template.
Design of primers：
By the gene sequencing to 17 plants of Streptococcus suis GDH albumen in GenBank, its high conservative region is selected respectively
1 pair of primer using the Software for Design of Primer Premier 5.0.
gdhL-1 TCCATCTTGAAGTTCCTCGGTTTTG
gdhL-2 CTTTGAAGGATTTACCGTTT GCT
PCR response procedures：
The μ L of PCR reaction systems 25：10 × buffer solution (contains MgCl2)2.5μL；dNTP 2μL；The μ L of DNA profiling 2；Condition optimizing
GDH upstream and downstream primer additions are 1 μ L (20pmol/L)；The μ L of Taq archaeal dna polymerases 0.2；Sterilizing distilled water is adjusted to 25 μ L.
PCR optimum reaction conditions are:95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 52.3 DEG C of annealing 30s, 72 DEG C of extension 30s, 32 are followed
Ring；72 DEG C of extension 6min.
Result judgement：
During nucleic acid electrophoresis, using DL2000 as DNA Marker, if appearing in more than 250bp and below 500bp piece
Disconnected (384bp) is determined as Streptococcus suis, such as the band occurred in Fig. 1.
The detection method of the present invention, have detection accurate, high sensitivity, high specificity, simple and rapid advantage, have good
Good clinical.
Brief description
Fig. 1 is the electrophoresis result figure that positive Streptococcus suis cause of disease is detected with PCR
Fig. 2 is catalase detection Test Drawing, and the left side is catalyst positive map；The right is the negative figure of catalyst
Fig. 3 is sensitivity tests result
Fig. 4 is specific test result
Fig. 5 is testing inspection flow
Below in conjunction with specific embodiment, the present invention is further elaborated.
Embodiment
Unless otherwise indicated, the molecular engineering used in following examples is routine well known to those skilled in the art
Technology.The specific implementation step of such technology can be found in various laboratory manuals and textbook etc., such as J.Sambrook
Molecular Cloning:A Laboratory Manual(Cold Spring Harbour Laboratory Press,
1989), J.Perbal A Practical Guide to Molecular Cloning (John Wiley and Sons,
1984), T.A.Brown etc. Essential Molecular Biology:A Practical Approach(IRL
Press, 1991) and D.M.Glover etc. DNA Cloning:A Practical Approach(IRL Press,1995
With 1996) etc..
Embodiment 1：Catalase test carries out primary election to object bacteria
1) principle：Bacterium with catalase, energy catalyzing hydrogen peroxide generation water and nascent oxygen, then form and divide
There is bubble in sub- oxygen.
2) reagent：3% hydrogenperoxide steam generator：Take 9ml ultra-pure waters add 1ml30% hydrogen peroxide (it is now with the current, pressed when measuring big
Ratio increase), after mixing packing cover standby after plug to 5 penicillin bottles；Some boxes of pipettor gun head of sterilizing are standby
With；Clean pipettor is standby；
3) test method
After pipettor or other equipment equipment pipette tips, sterile working picking strain to be tested, each bacterium colony is changed
One new pipette tips, the pipette tips that picking has bacterium mud are immersed to 3% hydrogen peroxide solution 30 seconds configure, observing near bacterium mud is
No bubble surrounds or has continual bubble to emerge.
4) result
In observing bacterium mud in 30 seconds, nearby whether bubble surrounds or has continual bubble to emerge, and is catalase if having
The positive, negative for catalase if nothing, such as Fig. 2.The negative bacterium colony of catalase is doubtful Streptococcus suis, is labeled and carries out follow-up
Qualification test.
Tested using the crucial and simple to operate biochemical characteristic of streptococcus, the quick preliminary screening for carrying out Streptococcus suis,
Reach the effect got twice the result with half the effort, save downstream molecular biology identification resources costs.
Embodiment 2：The molecular Biological Detection of catalase negative bacterium
1) experiment material
It is clinically separated strain to be tested：Separated and preserved by Shandong Province Binzhou animal and veterinary research institute, use the flat of increase serum
The initial gross separation experiment that ware carries out pathogen (should not use the bacterium colony grown on blood agar plate, because red blood cell contains catalase, can cause
False positive reaction).
Reagent：Pancreas soy agar (TSA and TSB) culture medium is U.S.'s B D Products；Horse serum and Swine serum are orchid
Zhou Min marine growths Engineering Co., Ltd product；DNA glue reclaims kit is omega Products；Conventional molecular biological is tested
Reagent and kit are purchased from precious bioengineering (Dalian) Co., Ltd.
Primer：
gdhL-1 TCCATCTTGAAGTTCCTCGGTTTTG
gdhL-2 CTTTGAAGGATTTACCGTTT GCT
2) test method
It is prepared by the pcr template of catalase feminine gender bacterium colony
The sterile pipette tips picking strain to be tested of pipettor blows and beats 3-6 mixing, 100 DEG C of water-baths repeatedly in 100ul ultra-pure waters
5 minutes, 12000r/min was centrifuged 30 seconds, and supernatant is as detection template.
PCR is expanded：
The μ L of PCR reaction systems 25：10 × buffer solution (contains MgCl2)2.5μL；dNTP 2μL；The μ of detection template 2 described above
L；Condition optimizing GDH upstream and downstream primer additions are 1 μ L (20pmol/L)；The μ L of Taq archaeal dna polymerases 0.2；Sterilize distilled water
Adjust to 25 μ L.PCR optimum reaction conditions are:95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 52.3 DEG C of annealing 30s, 72 DEG C are prolonged
Stretch 30s, 32 circulations；72 DEG C of extension 6min.
3) result is observed
During nucleic acid electrophoresis, using DL2000 as DNA Marker, if appearing in more than 250bp and below 500bp piece
Disconnected (384bp) is determined as Streptococcus suis, such as the band occurred in Fig. 1.
Embodiment 3：The sensitivity tests of molecular Biological Detection
1) experiment material
It is clinically separated strain to be tested：Separated and preserved by Shandong Province Binzhou animal and veterinary research institute, use the flat of increase serum
The initial gross separation experiment that ware carries out pathogen (should not use the bacterium colony grown on blood agar plate, because red blood cell contains catalase, can cause
False positive reaction).
Reagent：Pancreas soy agar (TSA and TSB) culture medium is U.S.'s B D Products；Horse serum and Swine serum are orchid
Zhou Min marine growths Engineering Co., Ltd product；DNA glue reclaims kit is omega Products；Conventional molecular biological is tested
Reagent and kit are purchased from precious bioengineering (Dalian) Co., Ltd.
Primer：
gdhL-1 TCCATCTTGAAGTTCCTCGGTTTTG
gdhL-2CTTTGAAGGATTTACCGTTT GCT
2) test method
The 384bp purpose fragments of amplification are connected into carrier T, in conversion such as DH5 bacterial strains, pMD-gdh plasmids is extracted, passes through
Nucleic acid quantification is tested, and pMD-gdh plasmids are done to 10 times of doubling dilution, in diluting in 7 gradients per 10uL respectively containing 1 ×
105、1×104、1×103、1×102、1×101、1×100、1×10-1Individual copy, as detection template.
PCR is expanded：
The μ L of PCR reaction systems 25：10 × buffer solution (contains MgCl2)2.5μL；dNTP 2μL；The μ L of DNA profiling 2；Condition optimizing
GDH upstream and downstream primer additions are 1 μ L (20pmol/L)；The μ L of Taq archaeal dna polymerases 0.2；Sterilizing distilled water is adjusted to 25 μ L.
PCR optimum reaction conditions are:95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 52.3 DEG C of annealing 30s, 72 DEG C of extension 30s, 32 are followed
Ring；72 DEG C of extension 6min.
3) result is observed
During nucleic acid electrophoresis, using DL2000 as DNA Marker, if appearing in more than 250bp and below 500bp piece
Disconnected (384bp) is determined as the Streptococcus suis positive, such as sensitivity tests result in Fig. 3；The test method susceptibility is high, Ke Yijian
Measure the gene template of 1 copy.
Embodiment 4：The specific test of molecular Biological Detection
1) experiment material
It is clinically separated strain to be tested：Separated and preserved by Shandong Province Binzhou animal and veterinary research institute, use the flat of increase serum
The initial gross separation experiment that ware carries out pathogen (should not use the bacterium colony grown on blood agar plate, because red blood cell contains catalase, can cause
False positive reaction).
Reagent：Pancreas soy agar (TSA and TSB) culture medium is U.S.'s B D Products；Horse serum and Swine serum are orchid
Zhou Min marine growths Engineering Co., Ltd product；DNA glue reclaims kit is omega Products；Conventional molecular biological is tested
Reagent and kit are purchased from precious bioengineering (Dalian) Co., Ltd.
Bacterial strain：Escherichia coli, Malian drainage, Diplococcus pneumopniae, staphylococcus, haemophilus parasuis, pig lung
Scorching mycoplasma
Primer：
gdhL-1 TCCATCTTGAAGTTCCTCGGTTTTG
gdhL-2 CTTTGAAGGATTTACCGTTT GCT
2) test method
Escherichia coli, Malian drainage, Diplococcus pneumopniae, staphylococcus, haemophilus parasuis, pig pneumonia branch are former
Body etc. in 100ul ultra-pure waters, blows and beats 3-6 mixing, 100 DEG C of water-baths repeatedly using the sterile pipette tips picking strain to be tested of pipettor
5 minutes, 12000r/min was centrifuged 30 seconds, and supernatant is as detection template.
PCR is expanded：
The μ L of PCR reaction systems 25：10 × buffer solution (contains MgCl2)2.5μL；dNTP 2μL；The μ L of DNA profiling 2；Condition optimizing
GDH upstream and downstream primer additions are 1 μ L (20pmol/L)；The μ L of Taq archaeal dna polymerases 0.2；Sterilizing distilled water is adjusted to 25 μ L.
PCR optimum reaction conditions are:95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 52.3 DEG C of annealing 30s, 72 DEG C of extension 30s, 32 are followed
Ring；72 DEG C of extension 6min.
3) result is observed
During nucleic acid electrophoresis, using DL2000 as DNA Marker, if appearing in more than 250bp and below 500bp piece
Disconnected (384bp) is determined as the Streptococcus suis positive, such as specific test result in Fig. 4, with the common respiratory tract that can cause pig
Disease and the cause of disease of arthritic conditions occur without specific and non-specific band, and test method specificity is high.
Claims (5)
1. a kind of method of quick Screening and Identification Streptococcus suis, the described method comprises the following steps：
(a) primary election is carried out to strain to be tested by catalase test, the strain to be tested of catalase-positive is excluded, wherein concretely comprising the following steps：
Sterile working picking strain to be tested, the strain to be tested is immersed to 3% hydrogen peroxide solution 30 seconds, then observation is in hydrogen peroxide
The strain to be tested in solution, when the strain to be tested by bubble surround or its nearby there is bubble to emerge, then judge the bacterium
Strain is catalase-positive bacteria, is excluded, without then being judged by strain to be tested that bubble is surrounded and no bubble is emerged near it
For catalase negative strain；
(b) for showing as the negative strain to be tested of catalase by step (a) primary election, detection mould is used as using the strain to be tested
Plate, bacterium colony PCR is carried out using following primer：
Sense primer：TCCATCTTGAAGTTCCTCGGTTTTG
Anti-sense primer：CTTTGAAGGATTTACCGTTTGCT
(c) electrophoresis detection is carried out to the PCR primer in step (b), when there is the band more than 250bp and less than 500bp, then
Judge the strain to be tested for Streptococcus suis.
2. the method for claim 1 wherein in step (c), for the band more than 250bp and less than 500bp, enter one
Step carries out purifying recovery, and the product after then being reclaimed to purifying is sequenced, and when its length is 384bp, then judges that this is to be measured
Bacterial strain is Streptococcus suis.
3. the method for claim 1 or 2, the wherein detection template in step (b) are prepared by the following method：Sterile working picking
The bacterium colony of the strain to be tested, is placed in sterilized water, mixes, 100 DEG C of water-baths 5 minutes, and 12000r/min centrifuges 30 seconds, so
After take supernatant as detection template.
4. the bacterium colony PCR reaction systems in any one of claim 1-3 method, wherein step (b) are 25 μ L, and by below into
It is grouped into：The μ L of 10 × buffer solution 2.5；dNTP 2μL；The μ L of detection template 2；Each 1 μ L of upstream and downstream primer；Taq DNA gather
The μ L of synthase 0.2；Sterilizing distilled water is adjusted to 25 μ L.
5. the program of the bacterium colony PCR in any one of claim 1-3 method, wherein step (b) is:
95 DEG C of pre-degeneration 5min；
Repeat 32 circulations：94 DEG C of denaturation 30s, 52.3 DEG C of annealing 30s, 72 DEG C of extension 30s；
72 DEG C of extension 6min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510459749.7A CN105063172B (en) | 2015-07-30 | 2015-07-30 | A kind of method of quick Screening and Identification Streptococcus suis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510459749.7A CN105063172B (en) | 2015-07-30 | 2015-07-30 | A kind of method of quick Screening and Identification Streptococcus suis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105063172A CN105063172A (en) | 2015-11-18 |
| CN105063172B true CN105063172B (en) | 2018-01-26 |
Family
ID=54492678
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510459749.7A Active CN105063172B (en) | 2015-07-30 | 2015-07-30 | A kind of method of quick Screening and Identification Streptococcus suis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105063172B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109055584A (en) * | 2018-08-24 | 2018-12-21 | 暨南大学 | Primer and its kit and method based on digital LAMP technology detection Streptococcus suis |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101020929A (en) * | 2007-03-14 | 2007-08-22 | 浙江省疾病预防控制中心 | Kit and process for PCR amplification detecting type 2 pig streptococcus virulence gene |
| CN101812518A (en) * | 2010-03-08 | 2010-08-25 | 上海交通大学 | Multiple PCR detection kit for virulence factors of streptococcus suis and detection method thereof |
| CN103409546A (en) * | 2013-08-20 | 2013-11-27 | 长沙市疾病预防控制中心 | Kit for detecting streptococcus suis type 2 and application of kit |
-
2015
- 2015-07-30 CN CN201510459749.7A patent/CN105063172B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101020929A (en) * | 2007-03-14 | 2007-08-22 | 浙江省疾病预防控制中心 | Kit and process for PCR amplification detecting type 2 pig streptococcus virulence gene |
| CN101812518A (en) * | 2010-03-08 | 2010-08-25 | 上海交通大学 | Multiple PCR detection kit for virulence factors of streptococcus suis and detection method thereof |
| CN103409546A (en) * | 2013-08-20 | 2013-11-27 | 长沙市疾病预防控制中心 | Kit for detecting streptococcus suis type 2 and application of kit |
Non-Patent Citations (3)
| Title |
|---|
| A polymerase chain(PCR) assay specific for Streptococcus suis based on the gene encoding the glutamate dehydrogenase;Ogi Okwumabua等;《FEMS Microbiology Letters》;20030109;第218卷(第1期);第79-84页 * |
| 猪链球菌的鉴定及其PCR分型;张秀亮等;《黑龙江畜牧兽医》;20051231(第9期);第86-87页 * |
| 筛选与确诊试验在检测香港海鸥菌中的建立与应用;谭海芳等;《热带医学杂志》;20100630;第10卷(第6期);第675-680页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105063172A (en) | 2015-11-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103409546B (en) | Kit for detecting streptococcus suis type 2 and application of kit | |
| CN104059975B (en) | To Providence O3, the Nucleotide that O4, O8, O12, O13 and O20 are special and application thereof | |
| CN101144775B (en) | Bacteria real-time fluorescence quantitative polymerase chain reaction detection reagent kit | |
| CN107746890A (en) | Identify the multiple PCR detection primer and method of Listeria monocytogenes serotype | |
| CN101712987A (en) | Method for quickly, qualitatively and quantitatively measuring Lactobacillus plantarum in probiotic dairy products | |
| CN101712989B (en) | Method for quickly, qualitatively and quantitatively measuring Lactobacillus casei in probiotic dairy products | |
| CN103937884A (en) | Loop-mediated isothermal amplification kit for detecting mycobacterium tuberculosis and application method of kit | |
| CN101235413B (en) | Method and kit for detecting Shigella and ipaH pathogenicity island thereof | |
| CN105063172B (en) | A kind of method of quick Screening and Identification Streptococcus suis | |
| CN102154487A (en) | Reagent for detecting francisella tularensis and complex probe and fluorescent quantitative polymerase chain reaction (PCR) method for detecting francisella tularensis | |
| CN104830848A (en) | Reverse dot blot hybridization kit for detection of mycobacterium tuberculosis and usage method thereof | |
| CN100386442C (en) | Prime and probe sequence for detecting nucleotide fregment of 01 Group comma bacillus | |
| CN109234432A (en) | A kind of primer, probe and kit based on recombinase polymeric enzymatic amplification method detection soybean samping off | |
| CN102041298B (en) | PCR (Polymerase Chain Reaction) rapid detection method for Bacillus coagulans | |
| CN104561263A (en) | Rapid detection kit and detection method for clostridium botulinum B employing loop-mediated isothermal gene amplification | |
| CN100395350C (en) | Prime and probe sequence for detecting nucleotide fregment of comma bacillus | |
| CN105256041A (en) | Specific nucleotide for aeromonas hydrophila O44, O24, O25 and O28 and application thereof | |
| CN106435000A (en) | Constant-temperature heat insulation type PCR (polymerase chain reaction) detection method for streptococcus agalactiae | |
| CN102154466B (en) | Nucleotides with specificity to internal transcribed spacer(ITS) of neisseria meningitidis and application thereof | |
| CN101712990A (en) | Method for quickly, qualitatively and quantitatively measuring Lactobacillus rhamnosus in probiotic dairy products | |
| CN107083434A (en) | A kind of fluorescent PCR quantitatively detects the streptococcic Sample pretreatment method of B races and application | |
| CN101712988A (en) | Method for quickly, qualitatively and quantitatively measuring Bifidobacteria in probiotic dairy products | |
| CN105200045A (en) | Nucleotides specific to vibrio fluvialis O11, O14, O16 and O17 as well as application of nucleotides | |
| CN100467615C (en) | Fluorescent PCR primer and probe sequence for detecting swine chain coccus II virulence factor MRP | |
| CN100449006C (en) | Primer and probe sequence for pig streptococcus 2 type ectofactor (EF) fluorescence PCR detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |