CN1654667A - Attenuated HSV-1 vector for gene therapy - Google Patents
Attenuated HSV-1 vector for gene therapy Download PDFInfo
- Publication number
- CN1654667A CN1654667A CN 200410006492 CN200410006492A CN1654667A CN 1654667 A CN1654667 A CN 1654667A CN 200410006492 CN200410006492 CN 200410006492 CN 200410006492 A CN200410006492 A CN 200410006492A CN 1654667 A CN1654667 A CN 1654667A
- Authority
- CN
- China
- Prior art keywords
- hsv
- gene
- plasmid
- dna
- icp6
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a sort of new attenuation carrier for the gene therapy of H S V-1. The present invention also relates to the method for preparation of the new gene therapy carrier about the H S V-1 and its utility as well as one sort of compositon pharmaceutique which contains the treating carrier.
Description
Technical field
The present invention relates to a kind of gene therapy vector that is applicable to China (Asia) crowd.The used virus strain of this carrier is hsv (HSV-1) I type, be the human HSV-1 genome of wild-type, or deleted ICP34.5, ICP6 and ICP47 in the existing HSV-1 type 17+ strain (ECCACC:X14112), through gene recombination technology, the attenuation HSV-1 gene therapy vector of structure.The invention still further relates to the preparation method and the purposes of described attenuation HSV-1 gene therapy vector.
Background technology
HSV-1 carrier at present commonly used in the world is that the wild-type HSV-1 virus strain (17+ strain or F strain) used of American-European laboratory is constructed mostly.These virus strain are each laboratory going down to posterity many times through recent two decades.In addition, molecular biology research shows, infects Asia (comprising China), and America and Europe, and the HSV-1 virus of African ethnic group have different hypotype (seeing J.Gen, Virol., P513-527,75,1994).The carrier of being developed with the HSV-1 virus that infects American-European crowd is difficult to produce identical effect to asian population.This carrier is to use from Chinese patient oral cavity isolating wild herpes simplex virus I-type (HSV-1 type), makes up through gene recombination technology to form.This clinical isolating wild-type (HSV-1 type) has very similarly restriction enzyme resolution model with the HSV-1 17+ strain that database is put down in writing.The ID:NC_001806 of dna sequence dna in NCBI of HSV-1 17+ strain.
Summary of the invention
An object of the present invention is to provide a kind of new attenuation HSV-1 gene therapy vector.
Another object of the present invention provides a kind of preparation method of attenuation HSV-1 gene therapy vector.
The object of the invention also is to provide a kind of pharmaceutical composition that contains attenuation HSV-1 gene therapy vector.
The object of the invention also is to provide the application of a kind of attenuation HSV-1 gene therapy vector in genetic treatment of tumor.
On the one hand, the invention provides a kind of new attenuation HSV-1 gene therapy vector.This attenuation HSV-1 gene therapy vector, its sequence be for having deleted ICP34.5 in the human HSV-1 genome of wild-type, ICP6 and ICP47, and insert human GMCSF gene in former ICP34.5 position, and introduced the WPRE fragment with shown in the expression that increases GMCSF.The Genbank registration number GI:9629378 of known human HSV-1 gene.
Another aspect of the present invention provides a kind of pharmaceutical composition, and it contains attenuation HSV-1 gene therapy vector of the present invention and in case of necessity medicine acceptable carrier or vehicle.Attenuation HSV-1 gene therapy vector of the present invention can combine with pharmaceutically-acceptable excipients or carrier and form pharmaceutical composition.Medicine acceptable carrier or vehicle refer to nontoxic solid-state, semi-solid state or liquid weighting agent, thinner, coating material or other pharmaceutical adjuncts, for example, include but not limited to salt solution, buffering saline solution, glucose, water, glycerine, ethanol and composition thereof.Described pharmaceutical composition is suitable in parenteral, hypogloeeis, the brain pond, in the intravaginal, intraperitoneal, internal rectum, cheek, in the tumour or the epidermis administration.
Parenteral admin comprises that intravenously, intramuscular, intraperitoneal, breastbone are interior, subcutaneous, intra-articular injection and infusion.The pharmaceutical composition that is suitable for parenteral admin comprises aseptic aqueous solution or non-aqueous solution, dispersion liquid, suspension or emulsion, and is used for before facing use in sterile injectable solution or dispersion liquid powder formulated.Suitable water-based or non-aqueous carrier, thinner, solvent or vehicle comprise water, ethanol, glycerine, interior glycol, polyoxyethylene glycol, carboxymethyl cellulose, vegetables oil and injectable organic ester such as ethyl oleate.These compositions can also contain adjuvants such as sanitas, wetting agent, emulsifying agent and dispersion agent.Adding isotonic agent may be favourable as carbohydrate, sodium-chlor etc.
The epidermis administration is included on skin, the mucous membrane and in lung and the surperficial administration of eye.Such pharmaceutical composition comprises pulvis, ointment, drops, transdermal patch, Iontophoretic device and inhalation etc.
The composition of rectum or vagina administration is preferably suppository, it can be by being mixed with carrier of the present invention and suitable non-irritating excipient or carrier such as theobroma oil, polyoxyethylene glycol or suppository wax, described vehicle or carrier are solid-state in room temperature, be liquid under body temperature, therefore fusing and discharge active compound in rectum or vaginal canal.
When treating with above-mentioned or other modes, pharmaceutically-acceptable excipients is used or do not used to the independent form that the attenuation HSV-1 gene therapy vector of the present invention of treatment significant quantity can be an attenuation HSV-1 gene therapy vector of the present invention.The treatment significant quantity refers to the amount of suitable therapeutic modality to the effective attenuation HSV-1 gene therapy vector of the present invention of treatment tumour.Concrete treatment effective dose to any particular patient depends on many factors, comprises gentle its severity of the disease of being treated; The activity of used attenuation HSV-1 gene therapy vector; Used particular composition; Patient's age, body weight, sex, diet and general health situation; Administration time; Route of administration; The drainage rate of attenuation HSV-1 gene therapy vector; The time length associating of treatment or the other drug of taking simultaneously etc.
On the basis of a large amount of experiments of the present invention, the present invention further provides the application of attenuation HSV-1 gene therapy vector of the present invention in the medicine of preparation treatment tumour.
The gene therapy vector that the present invention is constructed is to have deleted ICP6 from the HSV-1 of wild-type, and ICP47 and r34.5 (ICP34.5) gene inserts human GMCSF gene (hGMCSF) then in the genome of carrier.Behind the GM-CSF gene, add that WPRE (Woodchuckhepatitispost-regulationElement) .WPRE can improve the expression amount of GM-CSF.The genome of gene therapy vector HSV-1 Δ ICP6hGM-CSF-WPRE Δ ICP34.5 Δ ICP47 behind the structure, as shown in Figure 1.
Attenuation HSV-1 gene therapy vector of the present invention, it is characterized in that, this carrier is in clinical isolating herpes simplex virus I-type viral genome, deleted ICP34.5, ICP6 and ICP47 gene, and inserted human GM-CSF (Graulocyte Macrophage Colony Stimulating Fator granular leukocyte macrophage stimulus factor) gene at the position of former ICP34.5, and introduced the WPRE fragment and obtained by IE (ImmediateEarly, very early time) the promotor guiding of hCMV.
Virus strain of the present invention is isolated herpes simplex disease (HSV-1) I type in the state patient oral cavity therefrom, and it and existing HSV-1 type 17+ strain (ECCACC:X14112) can generally be exchanged.
The concrete construction process of carrier of the present invention:
HSV-1 virus is difficult to carry out genomic recombination to construct with the method that simple restriction enzyme decomposes because of its genome huge (150kb), adopts the technology of homologous recombination to delete a certain gene or insert allogenic gene at specific position from genome more.This technical requirements makes up a plasmid earlier, includes one section specific HSV-1DNA fragment in this plasmid, and allogenic gene then advances in the middle of the HSV-1DNA fragment, with the HSV-1 viral DNA transfectional cell of this plasmid with total length.The HSV-1 viral DNA of total length begins propagation in cell, between plasmid DNA and the viral genome homologous recombination takes place like this, and foreign gene promptly is recombined into and comprises the identical position of specific HSV-1DNA fragment in the HSV-1 geneome plasmid.(see figure 2).
As mentioned above, the inventor successively deletes ICP34.5 from wild-type HSV-1 viral genome, ICP6 and ICP47 gene, and at the human GM-CSF gene of the position of former ICP34.5 insertion by the IE promotor guiding of hCMV, and introducing WPRE fragment strengthens the expression of GM-CSF in carrier.
Pharmacodynamic experiment
With 10
8This carrier behind pfu (the viral plaque formation unit) attenuation injects mouse peritoneal, and the vital sign of mouse is not had influence; And 10
3Pfu wild-type HSV-1 then is fatal after injecting.
Be further proof attenuation effect, 30 Balb/c mouse are divided into two groups, and experimental group and control group be 15 Balb/c mouse respectively, and experimental group is injected 100 microlitres 1 * 10 every day
8This carrier behind the pfu/ml attenuation is subcutaneous to the mouse dorsal part, injects altogether 5 days; The control group injecting normal saline.It is as follows to observe mouse body weight (gram) changing conditions in January:
In 1 week of injection back in 3 all 4 weeks of 2 weeks before the body weight injection
Control group 21.1 ± 0.8 21.9 ± 1.0 22.6 ± 0.9 23.3 ± 0.8 24.2 ± 0.7
Experimental group 21.3 ± 1.1 22.1 ± 0.7 22.9 ± 0.6 23.5 ± 0.7 24.4 ± 0.7
Continuous 5 days more heavy dose of this attenuation of subcutaneous injection HSV-1 carriers do not have influence to the mouse body weight.
The ELISA Kit (Cat.no.CYT210) that produces with U.S. CHEMICON company detects the expression of GMCSF and finds that the introducing of WPRE can make the GMCSF expression amount improve 2-3 doubly.
Therapy of tumor animal experiment method and result:
1. vitro culture and gather in the crops different mouse tumor cells, as breast tumor cell, melanoma cell, lymphoma cell, lung carcinoma cell etc.;
2. it is subcutaneous mouse tumor cell suspension to be injected mouse left side back, and injection rate is 10
4Individual cell through injection, forms subcutaneous hillock at the injection point position;
3. tumour cell injects 2-3 after week, and mouse left side back can grow 0.5 centimetre of left and right sides tumour lump; At this moment, mouse is divided into 2 groups: control group and experimental group, every group of 10 animals;
4. in the control group mice tumour, inject 0.5 ml physiological saline; In the experimental group tumour, inject 10
8Pfu/0.5 milliliter HSV-I gene therapy medicament notes answering multi-direction injection, and injection is every other day once injected three times altogether.
5. measure the tumour size weekly one time, and the mean diameter of record lump;
6. the result shows, mice in control group, and its tumour lump continues growth, can reach more than 1.5 centimetres after all around.And in the experimental group, lump then constantly dwindles, injected for 4 weeks after, the lump of 80% mouse disappears, the lump of all the other mouse all significantly dwindles.(seeing experimentation on animals figure)
Pathologic finding shows that the normal tissue cell around the experimental mice tumour is unaffected.
Experiment shows that this carrier has good result to kinds of tumors, sees the following form.
After using this attenuated carrier, the variation of tumour lump size is as follows: (diameter millimeter)
1). growth HSV-1 virus in BHK (ECACC no.85011433) cell.Cell culture fluid is to add 10% N of tire serum, 1% mycillin in the DMEM basal liquid.Long 5 175cm of symbiosis
2Culturing bottle, 370 ℃, 5%CO
2Hatching.
2). after cultivating hatching 48h, cell and supernatant liquor are gathered in the crops together (containing a large amount of HSV-1 viruses), 12000 rev/mins of high speed centrifugations, 2h is under the 40C condition, with Beckman JA14 whizzer.
3). remove supernatant liquor, in the centrifugal deposition thing, add 15 milliliters of proteolytic ferment K damping fluids, shake up settling after, transfer to together in one 50 milliliters the Falcon test tube.
4). add proteolytic ferment K, making its ultimate density is 50 mcg/ml, again this test tube is placed the 370C shaking table, shakes 12h (spending the night) with 200 rev/mins.At this moment solution has slight thickness state, invisible settling.
5). add 10 milliliters of distilled waters, total volume reaches 25 milliliters.Adding waits the Phenol of capacity (25 milliliters): Chloroform: IAA (25: 24: 1) then.Jog mixed 10 minutes.
6). with the mixed solution five equilibrium in two Beckman centrifuge tubes, centrifugal 15000 rev/mins, totally 20 minutes.With SW41 model centrifugal pan.
7). at this moment visible mixed solution is divided into three sections, and epimere is the limpid relatively viral DNA part that contains, and the stage casing is a protein portion, and hypomere is Phenol: Chloroform: IAA, jog mixing 10 minutes.
8). repeating step 6)-7) disappear up to the stage casing protein layer.Generally need triplicate.
9). limpid epimere liquid layer is transferred in 50 milliliters of new Falcon test tubes, adds the Chloroform of equivalent: IAA (24: 1), jog mixing 5 minutes.
10). centrifugal with the experiment table whizzer, 2000 rev/mins, 10 minutes, supernatant liquor is changed in 50 milliliters of new Falcon test tubes.
11). in above-mentioned test tube, slowly add 2 times of volumetrical dehydrated alcohols, the interface between visible ethanol and the former supernatant liquor along test tube wall.
12). shake test tube as circumferential motion gently, visible viral DNA (comprising some cell DNAs) precipitation begins to appear at solution interface.Behind the complete mixing, centrifugal 3000 rev/mins, 5 minutes.
13). outwell supernatant liquor, clean centrifugation (DNA) with 70% ethanol.After outwelling ethanol, place the aseptic technique case to spend the night dry DNA in the Falcon test tube that DNA is housed.
14). add 300 microlitre distilled waters, dissolving DNA.Be kept at after the packing-200 ℃ standby.
(2) make up the plasmid that contains ICP34.5FlankingRegion:
How Fig. 5 is for to insert human GMCSF gene and introduce the WPRE fragment in ICP34.5FlankingRegion.
Thereby Fig. 6 demonstration is inserted human GMCSF gene and is introduced the WPRE fragment through the dna homology reorganization in the HSV-1 genome.
Fig. 7 is cloned in the pBlueScript plasmid for ICP6 Flanking Region.
Fig. 8 is a pGEMT-MMLVEGFP plasmid fragment.
Fig. 9 is a pBS Δ ICP6EGFP plasmid.
Figure 10 is a HSV-1 genome synoptic diagram of having deleted ICP34.5 and ICP6 gene.
Figure 11 is cloned in the pBlueScript plasmid for ICP47 Flanking Region.
Figure 12 is the attenuation HSV-1 gene therapy vector genome synoptic diagram of final gained.
Figure 13 is the not restriction enzyme hydrolysis pattern of homophyletic of HSV-1, and used restriction enzyme is respectively EcoR1, Nco1, Not1 and Xho1.The sample of analyzing has: 1. the used clinical isolating wild-type HSV-1 of this case; 2. laboratory HSV-1 17+ strain commonly used; 3.HSV-2 type, the HG52 strain; 4.HSV-1 Δ ICP34.5CMVhGMCSF; 5.HSV-1 Δ ICP34.5CMVEGFP; 6.17+ Δ ICP34.5CMVEGFP.Please note comparative sample 1 and sample 2.
Embodiment
The present invention further describe the present invention in order more to be expressly understood referring now to the following example.Embodiment only is used for explaining and does not limit the present invention in any way.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, or the condition of advising according to manufacturer.
Embodiment:
1. deletion ICP34.5 gene from wild-type HSV-1 makes up HSV-1 Δ ICP34.5.
(1) growth wild-type HSV-1 hsv in bhk cell is extracted total length HSV-1 viral DNA with the phenol extraction method.
Phenol extraction method total length HSV-1 viral DNA method:
The required solution that gives preparation:
A. proteolytic ferment K damping fluid: 0.01M Tris pH8,0.005M EDTA, 0.5%SDS.
B.Tris equilibrated phenol (phenol): Chloroform (chloroform): IAA (25: 24: 1)
Experimental procedure:
1). growth HSV-1 virus in BHK (ECACC no.85011433) cell.Cell culture fluid is to add 10% N of tire serum, 1% mycillin in the DMEM basal liquid.Long 5 175cm of symbiosis
2Culturing bottle, 370 ℃, 5%CO
2Hatching.
2). after cultivating hatching 48h, cell and supernatant liquor are gathered in the crops together (containing a large amount of HSV-1 viruses), 12000 rev/mins of high speed centrifugations, 2h is under the 40C condition, with Beckman JA14 whizzer.
3). remove supernatant liquor, in the centrifugal deposition thing, add 15 milliliters of proteolytic ferment K damping fluids, shake up settling after, transfer to together in one 50 milliliters the Falcon test tube.
4). add proteolytic ferment K, making its ultimate density is 50 mcg/ml, again this test tube is placed the 370C shaking table, shakes 12h (spending the night) with 200 rev/mins.At this moment solution has slight thickness state, invisible settling.
5). add 10 milliliters of distilled waters, total volume reaches 25 milliliters.Adding waits the Phenol of capacity (25 milliliters): Chloroform: IAA (25: 24: 1) then.Jog mixed 10 minutes.
6). with the mixed solution five equilibrium in two Beckman centrifuge tubes, centrifugal 15000 rev/mins, totally 20 minutes.With SW41 model centrifugal pan.
7). at this moment visible mixed solution is divided into three sections, and epimere is the limpid relatively viral DNA part that contains, and the stage casing is a protein portion, and hypomere is Phenol: Chloroform: IAA, jog mixing 10 minutes.
8). repeating step 6)-7) disappear up to the stage casing protein layer.Generally need triplicate.
9). limpid epimere liquid layer is transferred in 50 milliliters of new Falcon test tubes, adds the Chloroform of equivalent: IAA (24: 1), jog mixing 5 minutes.
10). centrifugal with the experiment table whizzer, 2000 rev/mins, 10 minutes, supernatant liquor is changed in 50 milliliters of new Falcon test tubes.
11). in above-mentioned test tube, slowly add 2 times of volumetrical dehydrated alcohols, the interface between visible ethanol and the former supernatant liquor along test tube wall.
12). shake test tube as circumferential motion gently, visible viral DNA (comprising some cell DNAs) precipitation begins to appear at solution interface.Behind the complete mixing, centrifugal 3000 rev/mins, 5 minutes.
13). outwell supernatant liquor, clean centrifugation (DNA) with 70% ethanol.After outwelling ethanol, place the aseptic technique case to spend the night dry DNA in the Falcon test tube that DNA is housed.
14). add 300 microlitre distilled waters, dissolving DNA.Be kept at after the packing-200 ℃ standby.
(2) make up the plasmid that contains ICP34.5FlankingRegion:
(nt123462-126790, HSV-1DNA fragment NC_001806) (Sau3A fragment) is inserted the BglII site of plasmid pSP72 will to include the ICP34.5 gene.The fragment (nt124948-125713) of the NotI of coding ICP34.5 gene is deleted (psp72 Δ ICP34.5) after limiting inscribe via NotI.The marker gene EGFP of expressing green fluorescent protein is controlled (its polyA signal comes from bGHpolyA) by the IE promotor of human CMV virus.Common clone enters the NotI site of pSP72 Δ ICP34.5, obtains pSP72 Δ ICP34.5CMVEGFPpA.(see figure 3).
(3) make up the HSV-1 virus strain of deleting the ICP34.5 gene: HSV-1 Δ ICP34.5
Total length HSV-1 viral DNA and the common transfection bhk cell of pSP72 Δ ICP34.5hCMVEGFP with the purifying extraction.
Common transfection viral DNA and plasmid DNA
Required solution and the cell that gives preparation:
A.2M CaCl2 (room temperature preservation)
B. viral DNA, 1 mg/ml, phenol extraction method prepared (on seeing).
A.Hepes transfection damping fluid, 140mM NaCl, 5mM KCl, 0.75mM Na2HPO4,5.5mMD-glucose, 20mM Hepes, pH 7.05.
B. plasmid DNA 5 mg/ml.
C.6, the bhk cell that the growth of 80% density is arranged on the well culture plate.
Experimental procedure:
1). get two aseptic eppendorf test tubes, add 400 microlitre Hepes transfection damping fluids therein in one.
2). 31 microlitre 2M CaCl2 in the another one test tube, 20 microlitre viral DNAs, 1 microlitre plasmid DNA.Behind the mixing, it is slowly joined in the 400 microlitre Hepes damping fluids gently with pipettor.
3). behind the mixing, under room temperature, left standstill 40 minutes gently.
4) inhale the nutrient solution that removes bhk cell after .40 minute in 6 well culture plates, above-mentioned transfection mixed solution is slowly added in the culture plate, the corresponding transfection mixed solution in each hole was placed 30 minutes in the 370C incubator then.
5) in every hole, directly add 1 ml cells nutrient solution after .30 minute, and then Tissue Culture Plate is put back in the 370C incubator, hatched 7 hours.
6). get 8 milliliters of Hepes damping fluids, add 2 milliliters of DMSO, the 20%DMSO damping fluid that obtains is placed cooled on ice.
7) after .7 hour, remove all nutrient solutions in the Tissue Culture Plate, and clean cell twice with 1 milliliter of fresh medium.
8). add 1 milliliter of 20%DMSO damping fluid in every hole, placed 90 seconds under the room temperature.
9). remove the 20%DMSO damping fluid rapidly, clean cell twice with fresh medium.
10). add 2 milliliters of fresh cell culture fluids in every hole, place 37 ℃, the 5%CO2 incubator.Can gather in the crops after 4 days, at this moment visible viral plaque.
11). be ready to 6 well culture plates of bhk cell 100% growth, every hole adds 10 or 100 microlitres results liquid.Cultivate after 2 days, as required, under the microscope direct-view, have viral plaque green fluorescence or colourless with the extraction of 20 microlitre pipettors.
Expression has the viral plaque of green fluorescence EGFP, is the HSV-1 virus strain (see figure 4) of having deleted the ICP34.5 gene.The green fluorescence viral plaque is extracted in gradation, after the purifying HSV-1 Δ ICP34.5hCMVEGFP virus strain, uses the phenol extraction method, extracts this viral full length DNA.
2. insert human GM-CSF gene, make up HSV-1 Δ ICP34.5/hGMCSFWPRE
(1) at first designs primer, pcr amplification hGMCSF gene from human lung cDNA storehouse.
Positive primer CTGAAGCTTATGTGGCTGCAGAGCCTGCTG
Anti-primer TGGCTCGAGTCACTCCTGGACTGGCTCCCA
The PCR product is cloned in the pGEM-T cloned plasmids, obtains plasmid pGEMT-hGMCSF.This plasmid is confirmed as the hGMCSF gene through determined dna sequence.
From pGEMT-hGMCSF, decomposite hGMCSF together with HindIII and XhoI, hGMCSF is cloned in the HindIII/xhoI site of pSP72 Δ ICP34.5CMVEGFP, replace the EGFP gene, obtain new plasmid pSP72 Δ ICP34.5CMhGMCSF with hGMCSF
(2) introduce WPRE fragment (the Woodchuck hepatitis virus is transcribed the back regulatory factor)
WPRE can stablize RNA, and helps mRNA to enter endochylema from karyon, thereby improves this expression of gene level.(GenBankNo.J04514 nt1093-1684) with behind the pcr amplification, inserts the XhoI site (see figure 5) of pSP72 Δ ICP34.5CMVhGMCSF to the WPRE fragment, obtains plasmid pSP72 Δ ICP34.5CMVhGMCSF/WPRE
(3) the total length HSV-1 Δ ICP34.5hCMVEGFP viral DNA (method is the same) and the plasmid DNA psp72 Δ common transfection bhk cell of ICP34.5hCMVhGMCSFWPRE (method is the same) that purifying is extracted, do not express the viral plaque of green fluorescence and represent that the EGFP gene in the provirus is substituted through reorganization by the hGMSCF gene, purifying and growth HSV-1 Δ ICP34.5hCMVhGMCSFWPRE virus vector extract this carrier full length DNA (see figure 6) for future use.
3. deletion ICP6 gene makes up HSV-1 Δ ICP34.5GMCSFWPRE Δ ICP6 virus vector
(1) makes up p Δ ICP6 plasmid.
The product of ICP6 gene (UL39) can make HSV-1 virus breed in nonproliferating cell and produce cytotoxic effect.Deletion ICP6 gene makes this carrier have higher security from the HSV-1 virus vector.The ICP6 gene is positioned at nt86444-89857 in the HSV-1 genome.Be deletion ICP6 gene, ad hoc meter also increases from HSV-1DNA through PCR and to obtain the FlankingRegions in its upstream and downstream: upstream (U/S) 84859-86119; Downstream (D/S) 90960-92579.Above-mentioned two dna fragmentations of pcr amplification gained are cloned in the pBlueScript plasmid, obtain pBS Δ ICP6 plasmid (see figure 7).
(2) (see figure 8) in the following plasmid that has originally made up decomposites the MMLV-EGFP-SPA fragment with SalI and XhoI, inserts the pstI site of pBS Δ ICP6, promptly obtains pBS Δ ICP6EGFP plasmid (see figure 9).
(3) DNA of the HSV-1 Δ ICP34.5hGMCSFWPRE total length virus that the front is purified is with the common transfection bhk cell of pBS Δ ICP6EGFP plasmid DNA, selecting also purifying expression has the viral plaque of green fluorescence, and resulting virus vector is HSV-1 Δ ICP34.5hGMCSFWPRE Δ ICP6EGFP.Growth is also extracted this carrier full length DNA.
(4) with purified HSV-1 Δ ICP34.5hGMCSFWPRE Δ ICP6EGFP total length viral DNA with the common transfection bhk cell of pBS Δ ICP6 plasmid DNA, the viral plaque of not expressing green fluorescence represents that promptly the EGFP gene in the provirus carrier deletes after recombinating, thereby obtain virus vector HSV-1 Δ ICP34.5hGMCSFWPRE Δ ICP6 (see figure 10), grow and extract this carrier full length DNA.
4. deletion ICP47 gene makes up HSV-1 Δ ICP34.5GMCSFWPRE Δ ICP6 Δ ICP47 virus vector.
(1) makes up Δ ICP47 plasmid
The ICP47 gene product of HSV-1 is handled relevant transhipment (TAP1 and TAP2) with antigen and is acted on mutually, blocking-up is through the antigen treating processes of MHCI molecule, deletion ICP47 gene can improve the antigen treating processes of suppressed by vector cells infected from virus vector, thereby strengthens the immune response to infected cell.
The ICP47 gene is positioned at nt145310-145570 in the HSV-1 genome.Be deletion ICP47 gene, ad hoc meter also increases from HSV-1DNA through PCR and to obtain the FlankingRegions in common upstream and downstream, upstream (U/S) nt145570-146980DNA fragment.
Used positive primer is: GCATCGATCTTGTTCTCCGACGCCATC
Used anti-primer is: GCAAGCTTGCTCCCCCCCGACGAGCAGGAAG
Downstream (D/S) nt 143675-145290DNA fragment.
Used positive primer is: TCTAGAGGGTTCGATTGGCAATGTTGTCTCCCG
Used anti-primer is: TTAACGATCGAGTCCCGGGTACGACCATCACCCG
The ICP47FlankingRegionDNA fragment cloning is advanced in the pBlueScript plasmid, promptly obtain pBS Δ ICP47 plasmid.
(2) from aforesaid pGEMT-MMLVEGFP plasmid, decomposite the MMLV-EGFP-SpaDNA fragment, be inserted in the BamHI site of pBS Δ ICP47, promptly obtain pBS Δ ICP47EGFP plasmid (seeing Figure 11) with SalI/xhoI.
(3) front is purified HSV-1 Δ ICP34.5hGMCSFWPRE Δ ICP6 total length viral DNA is with the common transfection bhk cell of pBS Δ ICP47EGFP plasmid DNA, selecting also purifying expression has the viral plaque of green fluorescence, resulting virus vector is HSV-1 Δ ICP34.5hGMCSFWPRE Δ ICP6 Δ ICP47EGFP, grows and extracts this carrier full length DNA.
(4) with the HSV-1 Δ ICP34.5hGMCSFWPRE Δ ICP6 Δ ICP47EGFP total length viral DNA of purified extraction with the common transfection bhk cell of pBS Δ ICP47 plasmid DNA, the viral plaque of not expressing green fluorescence represents that promptly the EGFP gene in the provirus carrier deletes after recombinating, obtained final virus vector HSV-1 Δ ICP34.5hGMCSFWPRE Δ CP6 Δ ICP47 (seeing Figure 12) at last.
The Δ ICP34.5hGMCSFWPRE Δ ICP6 Δ ICP47 that puts down in writing in the above-mentioned literary composition is a code name, represents attenuation HSV-1 gene therapy vector of the present invention.
5. clinical isolating wild-type HSV-1 and the laboratory HSV-1 17+ strain of using with restriction enzyme enzymatic hydrolysis process analysis comparison carrier construction of the present invention.
1) with BHK21CB cell incubation growth in 24 porocyte culture plates.Second day when cell after 100% density growth on the culture plate, in different holes, infect clinical isolating wild-type HSV-1 or HSV-1 17+ strain respectively, or the wild-type HSV-1 after gene recombination.
2) behind the virus infection 1 hour, remove used nutrient solution, and clean cell twice with fresh medium.Every then hole adds the EagleShi nutrient solution that 500 microlitres contain 1% bovine serum, places 2 hours in 37 ℃ of incubators.After 2 hours, add 5 microcurie P in every hole
32Cell is put back to 37 ℃ again, 5%CO
2Cultivated 48 hours in the incubator.After 48 hours, gather in the crops cell and virus in every hole, extract the viral DNA (method is the same) in every hole.
3) get each viral DNA of 10 microlitres respectively, with the hydrolysis of restricted type restriction endonuclease, the method for hydrolysis is: 10 microlitre viral DNAs, add 2 microlitre restriction enzymes, and the damping fluid of 5 microlitres and restriction endonuclease coupling, adding distilled water to total volume again is 50 microlitres.Behind the mixing, place 37 ℃ of water baths, water-bath 12 hours.Used restriction enzyme has EcoR1 respectively, Nco1, Not1 and Xho1.
4) 12 hours water-bath afterreaction products are walked gel electrophoresis on 1%Agarose glue, 80 volts, walk glue 5 hours.Then this glue is placed on the sheet glass, be positioned in 80 ℃ of hybridization casees, dried 5 hours.
5) with the glue of oven dry with behind the plastics film parcel, in dark place, stick X-ray film, place after 30 seconds to 1 minute, develop photographic film, promptly get Figure 13.In Figure 13, pay special attention to first and second and walk the glue sample, as seen the HSV-1 17+ strain commonly used of the wild-type HSV-1 that uses of this vector construction and laboratory has extremely similarly resolution model.
Among the application all just, the design of anti-primer is all determined by the dna sequence dna of genes involved.For convenient with the PCR product cloning in plasmid, it is prefix that some primer is added with the nucleotide sequence that restriction enzyme recognizes.
Claims (6)
1, a kind of attenuation HSV-1 gene therapy vector, this carrier is encoded by human HSV-1 virogene; This carrier is with recently from Chinese patient oral cavity isolating wild herpes simplex virus I-type (HSV-1 type), forms through the gene recombination technology structure; This clinical isolating wild-type (HSV-1 type) has very similarly restriction enzyme resolution model with the HSV-1 17+ strain that database is put down in writing; The ID:NC_001806 of dna sequence dna in NCBI of HSV-1 17+ strain.
2, a kind of attenuation HSV-1 gene therapy vector, it is characterized in that, this carrier is in the herpes simplex virus I-type viral genome, deleted ICP34.5, ICP6 and ICP47 gene, and inserted human GM-CSF gene at the position of former ICP34.5, and introduced the WPRE fragment and obtained by the IE promotor guiding of hCMV.
3, as the preparation method of claim 1 a described attenuation HSV-1 gene therapy vector, described preparation method comprises: from wild-type HSV-1 viral genome, successively delete ICP34.5, ICP6 and ICP47 gene, and at the human GM-CSF gene of the position of former ICP34.5 insertion by the IE promotor guiding of hCMV, and introducing WPRE fragment strengthens the expression of GM-CSF in carrier.
4, as the preparation method of claim 3 a described attenuation HSV-1 gene therapy vector, comprising:
(1) deletion ICP34.5 gene from above-mentioned wild-type HSV-1 makes up HSV-1 Δ ICP34.5;
A. growth wild-type HSV-1 hsv in bhk cell is extracted total length HSV-1 viral DNA with the phenol extraction method;
B. make up the plasmid that contains ICP34.5FlankingRegion:
The BglII site that will include the HSV-1DNA fragment insertion plasmid pSP72 of ICP34.5 gene; The fragment of the NotI of coding ICP34.5 gene via NotI restriction inscribe after after the deletion, obtain pSP72 Δ ICP34.5 plasmid; The marker gene EGFP of expressing green fluorescent protein is controlled by the IE promotor of human CMV virus; Common clone enters the NotI site of pSP72 Δ ICP34.5, obtains pSP72 Δ ICP34.5CMVEGFP plasmid;
C. make up the HSV-1 virus strain of deletion ICP34.5 gene:
Total length HSV-1 viral DNA and the common transfection bhk cell of pSP72 Δ ICP34.5hCMVEGFP with the purifying extraction;
Expression has the viral plaque of green fluorescence EGFP, is the HSV-1 virus strain of having deleted the ICP34.5 gene; The green fluorescence viral plaque is extracted in gradation, after the purifying HSV-1 Δ ICP34.5hCMVEGFP virus strain, uses the phenol extraction method, extracts this viral full length DNA;
(2) insert human GM-CSF gene, make up HSV-1 Δ ICP34.5/hGMCSFWPRE
A. at first design primer, pcr amplification hGMCSF gene from human lung cDNA storehouse;
Positive primer CTGAAGCTTATGTGGCTGCAGAATTTA
Anti-primer TGGCTCGAGTCATTTTTGGACTGGTTT
The PCR product is cloned in the pGEM-T cloned plasmids, obtains plasmid pGEMT-hGMCSF; With two restriction enzyme HindIII and XhoI together, from pGEMT-hGMCSF, decomposite hGMCSF, hGMCSF is cloned in the HindIII/XhoI site of pSP72 Δ ICP34.5CMVEGFP, replaces the EGFP gene, obtain new plasmid pSP72 Δ ICP34.5CMhGMCSF with hGMCSF;
B. introduce the WPRE fragment, the WPRE fragment with pcr amplification after, the XhoI site of inserting pSP72 Δ ICP34.5CMVhGMCSF obtains plasmid pSP72 Δ ICP34.5CMVhGMCSF/WPRE;
C. total length HSV-1 Δ ICP34.5hCMVEGFP viral DNA and the common transfection bhk cell of plasmid DNA pSP72 Δ ICP34.5hCMVhGMCSFWPRE that purifying is extracted, do not express the viral plaque of green fluorescence and represent that the EGFP gene in the provirus is substituted through reorganization by the hGMSCF gene, purifying and growth HSV-1 Δ ICP34.5hCMVhGMCSFWPRE virus vector extract this carrier full length DNA for future use;
(3) deletion ICP6 gene makes up HSV-1 Δ ICP34.5GMCSFWPRE Δ ICP6 virus vector
A. make up p Δ ICP6 plasmid:
Deletion ICP6 gene from the HSV-1 virus vector, the ICP6 gene is positioned at nt86444-89857 in the HSV-1 genome;
Increase from HSV-1DNA through PCR and to obtain the FlankingRegions in upstream and downstream: upstream (U/S) 84859-86119; Downstream (D/S) 90960-92579;
Above-mentioned two dna fragmentations of pcr amplification gained are cloned in the pBlueScript plasmid, obtain pBS Δ ICP6 plasmid;
B. in the plasmid PGEMT-MMLVEGFP that has originally made up:
Decomposite the MMLV-EGFP-SPA fragment with two restriction enzyme SalI and XhoI, insert the PstI site of pBS Δ ICP6, promptly obtain pBS Δ ICP6EGFP plasmid;
The DNA of c. that the front is purified HSV-1 Δ ICP34.5hGMCSFWPRE total length virus is with the common transfection bhk cell of pBS Δ ICP6EGFP plasmid DNA, selecting also purifying expression has the viral plaque of green fluorescence, and resulting virus vector is HSV-1 Δ ICP34.5hGMCSFWPRE Δ ICP6EGFP; Growth is also extracted this carrier full length DNA;
D. with purified HSV-1 Δ ICP34.5hGMCSFWPRE Δ ICP6EGFP total length viral DNA with the common transfection bhk cell of pBS Δ ICP6 plasmid DNA, the viral plaque of not expressing green fluorescence represents that promptly the EGFP gene in the provirus carrier deletes after recombinating, thereby obtain virus vector HSV-1 Δ ICP34.5hGMCSFWPRE Δ ICP6, grow and extract this carrier full length DNA;
(4) deletion ICP47 gene makes up HSV-1 Δ ICP34.5GMCSFWPRE Δ ICP6 Δ ICP47 virus vector
A. make up Δ ICP47 plasmid:
Increasing from HSV-1DNA through PCR obtains the FlankingRegions in its upstream and downstream,
Upstream (U/S) nt145570-146980DNA fragment;
Used positive primer is: GCATCGATCTTGTTCTCCGACGCCATC
Used anti-primer is: GCAAGCTTGCTCCCCCCCGACGAGCAGGAAG
Downstream (D/S) nt143675-145290DNA fragment;
Used positive primer is: TCTAGAGGGTTCGATTGGCAATGTTGTCTCCCG
Used anti-primer is: TTAACGATCGAGTCCCGGGTACGACCATCACCCG
Above-mentioned PCR gained ICP47FlankingRegionDNA fragment cloning is advanced in the pBlueScript plasmid: earlier with the upstream dna fragmentation, after HindIII and Sal1 hydrolysis, be connected to the HindIII and the Sal1 site of pBlueScript plasmid, get pBS47US;
The downstream DNA fragment cloning is advanced the pGEMT plasmid, from wherein downcutting downstream DNA, be inserted into the Spel site of pBS47US, promptly obtain pBS Δ ICP47 plasmid with EcoRI;
B. from aforesaid pGEMT-MMLVEGFP plasmid, decomposite the MMLV-EGFP-SpaDNA fragment, be inserted in the BamHI site of pBS Δ ICP47, promptly obtain pBS Δ ICP47EGFP plasmid with SalI/xhoI;
℃. the HSV-1 Δ ICP34.5hGMCSFWPRE Δ ICP6 total length viral DNA that the front is purified is with the common transfection bhk cell of pBS Δ ICP47EGFP plasmid DNA, selecting also purifying expression has the viral plaque of green fluorescence, resulting virus vector is HSV-1 Δ ICP34.5hGMCSFWPRE Δ ICP6 Δ ICP47EGFP, grows and extracts this carrier full length DNA;
D. with the HSV-1 Δ ICP34.5hGMCSFWPRE Δ ICP6 Δ ICP47EGFP total length viral DNA of purified extraction with the common transfection bhk cell of pBS Δ ICP47 plasmid DNA, the viral plaque of not expressing green fluorescence represents that promptly the EGFP gene in the provirus carrier deletes after recombinating, obtained final virus vector HSV-1 Δ ICP34.5hGMCSFWPRE Δ ICP6 Δ ICP47 at last, this carrier promptly is an attenuation HSV-I gene therapy vector.
5, a kind of pharmaceutical composition, it comprises as claim 1 or 2 s' attenuation HSV-1 gene therapy vector and medicine acceptable carrier or vehicle in case of necessity.
6, the application of attenuation HSV-1 gene therapy vector as claimed in claim 1 in the medicine of preparation gene therapy tumour.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200410006492 CN1283803C (en) | 2004-02-09 | 2004-03-10 | Attenuated HSV-1 vector for gene therapy |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200410039552 | 2004-02-09 | ||
| CN200410039552.X | 2004-02-09 | ||
| CN 200410006492 CN1283803C (en) | 2004-02-09 | 2004-03-10 | Attenuated HSV-1 vector for gene therapy |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1654667A true CN1654667A (en) | 2005-08-17 |
| CN1283803C CN1283803C (en) | 2006-11-08 |
Family
ID=34913004
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200410006492 Ceased CN1283803C (en) | 2004-02-09 | 2004-03-10 | Attenuated HSV-1 vector for gene therapy |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1283803C (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101230334B (en) * | 2007-01-22 | 2011-06-01 | 北京奥源和力生物技术有限公司 | Herpes simplex virus and recombinant virus as well as host cell and medicinal combination thereof |
| CN101376893B (en) * | 2007-08-28 | 2011-07-13 | 李小鹏 | Herpes simplex virus vector, recombinant virus, host cell and pharmaceutical composition thereof |
| CN104080477A (en) * | 2011-07-01 | 2014-10-01 | 因波特医疗股份有限公司 | Methods and compositions of protein antigens for the diagnosis and treatment of herpes simplex viruses type 1 and 2 |
| CN105219738A (en) * | 2015-09-21 | 2016-01-06 | 北京神源德生物科技有限公司 | Recombinant herpes simplex virus and its infect and prepare its host cell and their application |
| CN108841796A (en) * | 2017-06-15 | 2018-11-20 | 杭州睿可特生物科技有限公司 | Recombinant herpes simplex virus and its preparation method and application |
| WO2021175293A1 (en) | 2020-03-05 | 2021-09-10 | 北京唯源立康生物科技有限公司 | Herpes simplex virus and use thereof |
| CN116334010A (en) * | 2023-05-30 | 2023-06-27 | 中义(北京)健康研究院 | Recombinant herpes simplex virus and preparation method and application thereof |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108635380A (en) | 2018-04-13 | 2018-10-12 | 北京唯源立康生物科技有限公司 | Recombination oncolytic virus composition and its application in preparing the drug for treating tumour |
| WO2022006745A1 (en) * | 2020-07-07 | 2022-01-13 | Oriengene Biotechnology Ltd | Guide rna for hsv-1 gene editing and method thereof |
-
2004
- 2004-03-10 CN CN 200410006492 patent/CN1283803C/en not_active Ceased
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101230334B (en) * | 2007-01-22 | 2011-06-01 | 北京奥源和力生物技术有限公司 | Herpes simplex virus and recombinant virus as well as host cell and medicinal combination thereof |
| CN101376893B (en) * | 2007-08-28 | 2011-07-13 | 李小鹏 | Herpes simplex virus vector, recombinant virus, host cell and pharmaceutical composition thereof |
| CN104080477A (en) * | 2011-07-01 | 2014-10-01 | 因波特医疗股份有限公司 | Methods and compositions of protein antigens for the diagnosis and treatment of herpes simplex viruses type 1 and 2 |
| CN105219738A (en) * | 2015-09-21 | 2016-01-06 | 北京神源德生物科技有限公司 | Recombinant herpes simplex virus and its infect and prepare its host cell and their application |
| CN108841796A (en) * | 2017-06-15 | 2018-11-20 | 杭州睿可特生物科技有限公司 | Recombinant herpes simplex virus and its preparation method and application |
| WO2021175293A1 (en) | 2020-03-05 | 2021-09-10 | 北京唯源立康生物科技有限公司 | Herpes simplex virus and use thereof |
| CN116334010A (en) * | 2023-05-30 | 2023-06-27 | 中义(北京)健康研究院 | Recombinant herpes simplex virus and preparation method and application thereof |
| CN116334010B (en) * | 2023-05-30 | 2023-08-29 | 中义(北京)健康研究院 | Recombinant herpes simplex virus and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1283803C (en) | 2006-11-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102268453B (en) | LMP-1 recombinant adeno-associated virus (rAAV) vector and construction method as well as application thereof | |
| EA024878B1 (en) | Gene encoding human glucokinase mutant characterized by enhanced stability, and use thereof for controlling blood glucose or for preventing and treating disturbances of carbonydrate metabolism | |
| CN1283803C (en) | Attenuated HSV-1 vector for gene therapy | |
| CN111118046A (en) | Gene capable of regulating and controlling fat-forming differentiation capability of MSCs and derivative product thereof | |
| WO2016015684A1 (en) | Nrecombinant adeno-associated virus vector carrying human papillomavirus type 16 mutation e7 antigen gene, construction method therefor, and application thereof | |
| CN113201508A (en) | Recombinant Newcastle disease oncolytic virus and preparation method and application thereof | |
| CN105087648A (en) | Recombinant adeno-associated virus vector carrying MAGE-A3 gene as well as construction method and application | |
| CN105018525B (en) | Carry HPV 16 saltant type E7m91The recombined glandulae correlation viral vectors and its construction method of antigen gene and application | |
| CN102660579B (en) | HBx and human IL-12 double-gene recombinant vector and liver caner-resistant vaccine | |
| CN1718242A (en) | The canine adenovirus type 2 recombiant vaccine of rabies virus sugar/structural protein such as nuclear | |
| CN113166763B (en) | Nucleic acid molecule targeting CYP4V2 gene mutation site and application thereof | |
| CN105177048B (en) | Carry HPV 16 multipoint mutation type E7mmThe recombined glandulae correlation viral vectors and its construction method of antigen gene and application | |
| CN1781551A (en) | Fumor invasion and metastasis resisting function and use of venin cysteine proteinase inhibitor | |
| CN1686566A (en) | Application of CARK gene in preparation of medicine for treating cardiac muscle hypertrophy and medicine for inhibiting cardiac muscle hypertrophy | |
| CN103589693B (en) | A kind of expression IBDV VP2 and bursa of Fabricius bursin chimeric protein recombinant herpesvirus of turkeys | |
| CN113699117A (en) | Application of genetically modified oligodendrocyte progenitor cells in multiple sclerosis | |
| CN1213145C (en) | Modified EB virus LMP1 coding sequence and its prepn and application | |
| CN1177057C (en) | Recombinant of viral vector and human tumor suppressor gene, and use thereof | |
| CN1277925C (en) | Recombinant Baculovirus for expressing CTB and human insulin fusion protein and use thereof | |
| CN116426527B (en) | IBDV siRNA enrichment region gene fragment, recombinant plasmid, siRNA produced by recombinant plasmid, construction method and application | |
| CN1232643C (en) | Nucleic acid vaccine | |
| JP3681933B2 (en) | Birna virus subunit vaccine | |
| CN1117858C (en) | Hepatitis B virus nucleus and fore S1 area gene transfected mouse cell line (P99-815) and its preparation | |
| CN1844376A (en) | Recombinant herpes simplex virus type 2 and its preparing method and use | |
| CN105177047A (en) | Recombinant adeno-associated viral vector with human papillomavirus type 16 mutant E7<m94> antigen genes, method for constructing recombinant adeno-associated viral vector and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Owner name: BEIJING ORIENGENE BIOTECHNOLOGY LTD. Free format text: FORMER OWNER: LI XIAOPENG Effective date: 20060714 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20060714 Address after: 100096 No. 2 East roundabout road, Beijing, Xisanqi Applicant after: Beijing OrienGene Biotechnology Ltd. Address before: 430017 Hubei province Wuhan City Jiang'an District Youyi Street No. 5, 3 people such as SUSATO Building 1 unit 301 room Applicant before: Li Xiaopeng |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C57 | Notification of unclear or unknown address | ||
| DD01 | Delivery of document by public notice |
Addressee: Beijing sea days Ruixiang Biotechnology Co. Ltd. Wu Xiaodong Document name: Notification of Acceptance of Request for Invalidation |
|
| ASS | Succession or assignment of patent right |
Owner name: LI XIAOPENG Free format text: FORMER OWNER: BEIJING ORIENGENE BIOTECHNOLOGY LTD. Effective date: 20080718 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20080718 Address after: No. 2, gate 6, building 11, Dacheng Road, Beijing, Fengtai District, 202 Patentee after: Li Xiaopeng Address before: No. 2, Huandao East Road, Beijing, Xisanqi Patentee before: Beijing OrienGene Biotechnology Ltd. |
|
| C35 | Partial or whole invalidation of patent or utility model | ||
| IW01 | Full invalidation of patent right |
Decision date of declaring invalidation: 20080901 Decision number of declaring invalidation: 12131 |