CN1213145C - Modified EB virus LMP1 coding sequence and its prepn and application - Google Patents

Abstract

The present invention provides a DNA sequence on the basis of Epstein-Barr virus (EBV), particularly a DNA sequence of an antigenic gene of a modified encoding EBV hiding membrane protein 1 and a preparation method thereof. The present invention also relates to an application of the DNA sequence to produce medicine for controlling diseases which are relevant to EBV infection and DNA vaccines.

Description

The Epstein-Barr virus LMP1 encoding sequence of modifying, its preparation and application

The present invention relates to sequence based on Epstein-Barr virus (EBV) DNA, the dna sequence dna that particularly relates to modified coding EBV latent membrane protein 1 antigen (LMP1) gene, its preparation method and be used for controlling EBV in production and infect the medicine of relative disease and the application of dna vaccination.

EBV is the pathogenic agent that causes the infectious monocytosis that is common in children and young man.Among the crowd, on average there is the grownup more than 90% to suffer the infection of EBV approximately.This virus produces and propagates by the saliva approach at pars oralis pharyngis throughout one's life.Wherein illness then usually takes place in young adult's infection, and performance has high fever, white blood cell count(WBC) to increase, have sore throat and symptom such as hepatosplenomegaly.The Childhood infected person generally without any clinical symptom or only show slight upper respiratory tract infection symptoms (referring to EP-A0726315).Some individuality is because host immune response and the lasting interaction that has these two kinds of factors of band poison cell may cause the generation of EBV related neoplasms.Wherein the generation of burkitt's lymphoma is relevant with development and chromosome rearrangement.Although all contain the EBV genome in the tumour cell of not all case,, there is uncle's lymphomas of 97% relevant, and controls the generation that EBV reduces by primary lymphomas probably with EBV in some hotspot.It should be noted that especially that with regard to other tumours relevant similar 100% human nasopharyngeal carcinoma (NPC) infects relevant with EBV with EBV.Most of nasopharyngeal carcinoma all at first occur in the pharyngeal recess portion of nose back zone, and along with sb.'s illness took a turn for the worse very fast the transfer.At present clinically usually by detect that antibody such as VCA/IgA and EA/IgA come the early diagnosis nasopharyngeal carcinoma and with it as the secondary prevention means.

Relation in view of EBV and certain this tumour, people are studying always and are attempting to prepare EBV specificity related antigen, its mutain and their antibody and nucleotide coding sequence, with its instrument, especially for medicine or the vaccine of preparation may command tumour generation with one or more factors of development as early diagnosis EBV related neoplasms.For example, international patent application discloses the cytotoxicity EBV virus T cell antigen determinant that can be used for preparing subunit vaccine or nucleic acid vaccine for No. 97/45444.International Patent Application WO has been described for No. 95/24925 as subunit vaccine to induce CD8 ⁺The EBV cytotoxic T cell antigenic determinant of ctl response.International Patent Application WO 94/25599 discloses hamster cell system and the preparation and the cultural method of stably expressing EBV antigenicity glycoprotein gp250 and gp350 or its mixture.

Existing more and more evidences shows, Epstein-Barr virus latent membrane protein 1 (LMP1) cell growth and differentiation play an important role, generation and closely related (the Rickinson AB etal. of development with several human malignant's diseases such as nasopharyngeal carcinoma (NPC), Hokdkin disease and immunoblast lymphatic cancer, Virology, 3nd ed., NY, Raven Press, 2397-446,1996).People such as Wang (WangD et al, An EBV membranee proteim expressed in immortalized lymphocytestransforms established rodent cells, cell 43:831-40,1995) studies have shown that in early days the EBV-LMP1 gene has carcinogenic activity, and illustrated latent EBV and infected and certain this tumorigenic direct correlation.Bone-marrow-derived lymphocyte can carry Epstein-Barr virus for a long time, but and instantaneous cross the to express inducing DNA of LMP1 in bone-marrow-derived lymphocyte synthetic.In epidermic cell, LMP1 can induce the expression of known EGF-R ELISA (EGFR) that can stimulate cell growth.In addition, found that particularly the interior C-terminal of endochylema is relevant with the EBV carcinogenic activity for the proteic active region of LMP1.

We at first prove, ebv infection people embryo nasopharyngeal epithelial cells is transplanted in nude mice, can bring out human nasopharyngeal carcinoma under TPA and butyro-synergy.

At present, though structure and the function of LMP1 have been carried out more deep research, do not see the relevant LMP1 gene of modifying and the report of relevant vaccine thereof so far as yet.

An object of the present invention is to provide Epstein-Barr virus latent membrane protein gene deutero-dna sequence dna, this sequence is made up of the part latent membrane protein gene order that has lacked carcinogenic relevant range basically.

This purpose preferred embodiment according to the present invention, wherein said sequence has the nucleotide sequence shown in the SEQ ID NO:3.

Another object of the present invention provides the method for producing the recombinant DNA sequence that carries the gene fragment that is defined as above, and this method comprises:

(1) provides the dna fragmentation of the carcinogenic relevant range of part of having deleted latent membrane protein 1.

(2) use suitable primer, with the dna fragmentation of PCR method amplification step (1).

(3) will be connected on the suitable expression according to the dna fragmentation that step (2) method makes, to obtain carrying the recombinant DNA of latent membrane protein 1 gene that has lacked the carcinogenic zone of EBV.

A further object of the present invention relates to above-mentioned recombinant dna fragment is used for diagnosing or treating the medicine or the vaccine of EBV relative disease in preparation application.

Fig. 1 demonstration acquisition from the recombinant plasmid pUC18-DhetI of the known LMP1 of carrying gene has lacked the operation of the big fragment of LMP1 gene (LMP1 Δ) of carcinogenic correlated series.

Fig. 2 shows the structure that carries the big segmental recombinant plasmid pcDNAIII-LMP1 Δ of LMP1 Δ.

Fig. 3 shows the NIH3T3 cell imported LMP1, LMP1 Δ respectively and does not import cell proliferation curve in 6 day time of normal NIH3T3 cell cultures of any foreign DNA.

Fig. 4 is presented at the percentage cytotoxic T lymphocyte killing activity that records under different effector cells/target cell ratio condition.

The present invention relates to the DNA sheet of the modification of the Latent membrane protein 1 gene (LMP1) based on EBV Section, its preparation and amplification method and in production for the diagnosis and treatment of the EBV that comprises nasopharyngeal carcinoma The medicine of relevant disease or the application in the vaccine.

EBV is a kind of lymphocyte virus of having a liking for that belongs to herpetoviridae. The primate host In, it can be hidden in the B cell with integrated state, causes transfected B cell proliferation and forever Biochemical. During the EBV latent infection, latent gene is for transformation and separately performance of propagation Different functions, wherein known particularly importantly eb nuclear antigen 2 (EBNA2) and the film of hiding Albumen 1 (LMP1).

Known Latent membrane protein 1 gene is positioned on the genomic BamHI-Nhet large fragment of EBV, its Open read frame (ORF) is about 1311bp, is equivalent to the nucleotides sequence number 169474 in the EBV complete sequence To 168163 (left-hands). The phosphoric acid that LMP1 is made up of 386 amino acid The complete transmembrane protein of changing. At present known, LMP1 is that EBV gene code unique has to transform and drench The memebrane protein of bar cell and Epithelial cell alive. LMP1 gene expression positive cell shows higher Multiplication capacity and low differentiation degree. LMP1 albumen is structurally similar to certain this ionophorous protein, It is striden the film district and participates in ligand binding, and the amino and the carboxyl terminal that are free in the endochylema then have coupling Function is participated in intracellular signal transmission.

In addition, LMP1 also stops Apoptosis by the activity of regulating a series of active factorses, causes The cell malignancy. For example, it can participate in cell carcinogenesis by activation NFKb, and induces The expression of A20. Research finds that the variation of LMP1 gene order causes particularly LMP1 of amino acid sequence The change of carboxyl terminal sequence, and then change its antigenicity, and the change tumor cell surface is organized phase Capacitive antigen sign makes the supervision of the host cell escape host immune system of oncogene activation, Cause cell generation canceration.

More particularly, in nasopharyngeal carcinoma generation and evolution, LMP1 is present known EBV Unique memebrane protein with conversion Epithelial cell alive of gene code. LMP1 is also at MHC-1 in addition Performance was heavy during the immunity of class restrictive cell toxic T lymphocyte (CTL) was presented, identified and processes Act on. LMP1 N end bay diaphragm area is that human specific T cytotoxicity that EBV induces is killed and wounded and carried Supplied specific target antigen. On the other hand, in the cell of LMP1 transfection, adhere in the cell and divide The expression of son (such as LFA1, LFA3, ICAM etc.) improves, thereby strengthens at immune recognition phase The combination of effector molecule and target molecule. Based on these functional characters of LMP1 gene, the inventor Attempt to delete LMP1 gene 3 ' end to the requisite partial sequence of cell transformation function, and protect Stay the CTL epi-position part that wherein has immunogen activity and specific killing activity, obtain through lacking The mutant LMP1 coded sequence of decorations in bad repair. Can use based on known LMP1 amino acid sequence The primer of design, screening LMP1 coded sequence from suitable DNA library. In addition, also can from Suitably tissue-derived RNA as preparing in people's nasopharyngeal tissue prepares LMP1 with reverse transcription method then Gene. Certainly, for convenience's sake, preferably use suitable endonuclease from carrying the LMP1 base Directly obtain required dna fragmentation in the recombinant plasmid of cause.

In front two kinds of situations, can be after said fragment be carried out suitable modification, at F4 DNA Ligase exists lower, is connected to on the same definite suitable carrier (such as pcDNAIII), and is right After cut away from the recombinant vector that carries LMP1 with suitable restriction endonuclease again, unwanted fragment, with Requisite to comprising for expression product specific cytotoxic killing activity and immunogen activity The dna encoding sequence has lacked the not dna fragmentation with cell transformation and carciongenic potency of rapids of C simultaneously The recombinant expression carrier of (NcoI-NcoI fragment).

Can use the suitable eucaryon host of any known method transient transfection known in the art thin Born of the same parents are such as mammalian cells such as CHO, COS, BHK. Spendable transfection method comprises, but not Be only limited to partickle bombardment method, electroporation, directly micro-injection, by lipofectin reagent (as Lipofectarmine or Lipofectin reagent) method, and virus is (as through suitably Adenovirus or the retroviruse modified) the DNA orientation of mediation send and passs or transfer method etc.

According to a preferred embodiment of the invention, the contriver is at first from pre-preparation, carry among the EBV recombinant plasmid pVC18-Dhet I of the full gene of LMP1 and cut out the NcoI-NcoI fragment that is about 495bp, thereby make said LMP1 gene lose transformant and the further ability that cancerates of inducing cell.

Can use the LMP1 gene (MtuI-MiuI fragment) in the EBV genome, after single enzyme is cut, obtain deleting the MS187 fragment (LMP1 Δ-MS187 fragment) of LMP1 partial sequence.Be template and use suitable substance P CR primer that it is carried out pcr amplification with this fragment, separate with agarose electrophoresis then and reclaim it.

Then at T ₄There is the LMP1 gene that will lack carcinogenic relevant portion sequence (NcoI-NcoI fragment) down in dna ligase, and the big fragment of promptly said herein LMP1 Δ is connected in the suitable eukaryon expression plasmid such as PCNAIII.With the suitable competence Bacillus coli cells of the recombinant plasmid transformed that so obtains (as bacillus coli DH 52 cells), grow required recombinant plasmid with amplification.After a large amount of preparations, purifying and quantitative analysis, with resulting recombinant expression plasmid (pcDNAIII-LMP1 Δ) instantaneous conversion hamster,syrian kidney inoblast (bhk cell).Preferably use Lipofectamine reagent infection protocol known in the art to finish the eukaryotic cell transfection step.

Above-described all DNA operation stepss, except that the person of particularly pointing out all according to people (Molecular Cloning, Alaboraory Manual such as following Sanbrook, 2nd, ed., Cold SpringHarbor laboretory Press, 1989) described standard method finishes.

Above-mentioned recombinant plasmid (pcDNAIII-LMP1 Δ) and empty plasmid carrier (pcDNAIII) can be imported the BHK target cell respectively, with NPC positive serum and LMP1 monoclonal antibody specific (S12), the expression of LMP1 Δ in indirect immumofluorescent method detection cell.On the other hand, the recombinant plasmid (pcDNAIII-LMP1 Δ) that will carry the recombinant plasmid (pSG5-LMP1) of the LMP1 gene that does not lack described fragment respectively and carry the LMP1 gene (LMP1 Δ) that has lacked carcinogenic correlated series imports the NHI3T3 cell, and observation of cell form and serum dependency change behind the culturing cell.In addition, 3T3 cell and the normal 3T3 cell of having imported LMP1 gene, LMP1 Δ gene for respectively the nude mice subcutaneous vaccination, 4 week the back observe the tumor growth of inoculation position under the animal skin.The result as seen, the animal local subcutaneous of 3T3 cell that inoculation contains the LMP1 gene has the growth of warty lump, the animal that inoculation contains LMP1 Δ gene and do not contain the 3T3 cell of any alien gene does not then see have subcutaneous warty lump to grow.

In above-mentioned external and body on the experiment basis, the Balb/c mouse that various dose pcDNAIII-LMP1 Δ and empty plasmid carrier (100 μ g/ animal) are inoculated in further use respectively is as animal model, and the internal antibody of animal generates and the cytotoxic T lymphocyte activity after the observation immunization.

The spleen lymph of the immune animal that stimulates with recombinant DNA is cell action effect cell also, and with the G418 resistant cell that imported recombinant plasmid pcDNAIII-LMP1 Δ as target cell, after suitable target/effect cell proportion mixing and conventional insulation, in the presence of corresponding substrate, detect the kill and wound level of effector cell to target cell with the lactic dehydrogenase enzyme process, the activity level (percentage kill rate) of the interior CTL of animal body of dna immunization of the present invention is accepted in indirect judgement.、、、、、、、、、、、、、、、、、、、、、、

In sum, inventor's recombinant expression vector of LMP1 gene of carcinogenic correlated series that at first successfully made up the disappearance of carrying modification.Behind this heavy transient transfection eucaryon place cell (bhk cell), can use corresponding specific antibody (S12) to detect the proteic expression of LMP1.Use the comparative experiments result of LMP1 and LMP1 Δ vitro conversion NIH3T3 cell to show, the LMP1 gene can reduce or get rid of the biological behaviour abilities such as serum dependency, the formation of soft agar colony and conversion effet cell of cell significantly.Owing to left out the carcinogenic correlated series of the part among the LMP1, so after inoculating nude mice, do not see that animal had tumor growth in 18 months with LMP1 Δ dna sequence dna.Particularly we use the experiment demonstration that the Balb/c mouse model carries out, and as seen 2-8 week different time all has the specific antibody reaction after animals received LMP1 Δ dna encoding sequence.On the other hand,, can express, process and be the specific antigens determinant that delivery cell is represented in vivo, and then activate and induce the spy to lead sexual cell poison t cell responses with after carrying the recombinant DNA immune animal of LMP1 Δ encoding sequence.

Therefore, we studies have shown that, can use deleted the part cell in conjunction with the dna encoding sequence of the EBV latent membrane protein 1 of carcinogenic correlated series (the NcoI-NcoI fragment of about 495bp), make with simple relatively method and can be used for treatment and to prevent the purpose recombinant DNA sequence.For example, can be with LMP1 Δ of the present invention, or carry and make in the recombinant DNA of said gene and the known EBV cells infected that corresponding sequence is carried out necessary homology comparison and/or expression level is measured, whether exist EBV to infect the pathogenic tendency of relative disease to detect in the host.Particularly, LMP1 Δ of the present invention can be mixed with suitable auxiliary DNA, or be connected to and make dna vaccination on the suitable expression, and use suitable DNA introduction method, DNA of the present invention or nucleic acid vaccine are imported target tissue/cell, as a kind of valuable treatment and preventative vaccine, be used for the treatment of and prevent some EBV to infect relative disease, particularly nasopharyngeal carcinoma.

Down routine embodiment is intended to further to describe for example rather than limit by any way the await the reply scope of claim of the present invention.It will be appreciated by those skilled in the art that,, this is illustrated the various changes of described technology implementation scheme and modify all will fall into the present invention and await the reply in the scope of claim under the prerequisite of the spirit and principles in the present invention.

Embodiment 1: the big segmental preparation of LMP1 Δ of having deleted carcinogenic correlated series

The recombinant plasmid Puc18-DhetI (providing by professor Kieff of Harvard University) of LMP1 gene at first is provided with restriction enzyme NcoI digestion, therefrom cuts away down the carcinogenic associated clip that is about 495bP.After mending big segmental two ends of flat gained with the Khenw enzyme, recirculation obtains recombinant plasmid pUC18-MS187.Be template with this fragment then, and use upstream primer: 5 '-GGGGCTAGATGGAACGCGACCTT-3 ' (SEQ ID NO:1) and downstream primer: 5 '-GCCTTAAGTTAGTCATGTAGCTT-3 ' (SEQ ID NO:2), carry out pcr amplification by following reaction conditions: 94 ℃ of sex change are after 5 minutes, carry out 35 circulations altogether according to 1 minute, 55 ℃ annealing of 94 ℃ of changes 2 minutes and 2 minutes program of 72 ℃ of polymerizations (extension), last 72 ℃ were extended 15 minutes.

Separate and reclaim required PCR product through 1.5% agarose gel electrophoresis.Confirm to have obtained disappearance through sequencing analysis and change the cancer correlated series and have the big fragment of modification LMP1 gene of nucleotide sequence shown in the SEQ ID NO:3, and it is named be LMP1 Δ (referring to Fig. 1).

Example executes 2: the structure of recombinant expression plasmid pcDNAIII-LMP1 Δ

Digest (37 ℃, 1 hour) eukaryon expression plasmid pcDNAIII (this chamber treasured is deposited) respectively and press the LMP1 Δ gene fragment that method described in the embodiment 1 prepares with single restriction enzyme BamHI.Under above-mentioned reaction conditions, disappear with the EcoRI enzyme once more then.

Electricity trip separates two enzymes and cuts product with 1.5% sepharose with 1% respectively, and the use plasmid reclaims test kit (Promaga) fast and reclaims it.The pcDNAIII plasmid DNA that recovery is obtained and with the LMP1 Δ dna fragmentation of handling by 1: 2 mixed, after 45 ℃ of water-baths of successive and ice-water bath are handled, in the gained mixture, add 10XT ₄Dna ligase damping fluid and T ₄Dna ligase, with the 10ml total reaction volume in 16 ℃ of following incubated overnight (referring to Fig. 2).

Transform and use 0.1McaCl with so obtaining ligation mixture (5 μ l) ₂Competence bacillus coli DH 52 cells of handling, and on the LB agar plate that contains penbritin (1 μ g/ml) 37 ℃ of incubated overnight.

Collect the amicillin resistance bacterium colony from agar plate, and use the LB nutrient solution that contains penbritin that the positive is transformed bacterial strain and continue 37 ℃ of overnight incubation.Cultivate the mycetocyte that collect the back, behind the multigelation smudge cells, extract from centrifugal (12000rpm, 5 minutes) supernatant with phenol/chloroform, and use ethanol sedimentation DNA.

The recombinant plasmid that obtains as stated above with single BamHI, BamHI+EooR and single XhoI enzymic digestion carries out enzyme to it and cuts evaluation respectively.Prepare plasmid DNA then in a large number, and carry out quantitative analysis with spectrophotometry.

Embodiment 3: the expression of recombinant plasmid pcDNAIII-LMP1 Δ in eukaryotic host cell

(1) in containing the LB nutrient solution of 10% foetal calf serum, hamster,syrian kidney inoblast (bhk cell) is cultivated (16-24 hour) to the logarithmic phase of growing, wash behind the cell with Lipofecfmine (20 μ l) infection protocol with the recombinant DNA transfection that obtains among the embodiment 2 it (37 ℃, 5%CO ₂, 5 hours).Change the RPMI-1640 that closes 10% foetal calf serum after the transfection into, and continue to cultivate 48 hours in 37 ℃.

After cultivation is finished, with 0.25% trypsin treatment cultured cells individual layer.Coat on the microtiter plate after washing cell with above-mentioned nutrient solution, wash twice with acetone fixed 15 minutes and with PBS down for 4 ℃.

Add NPC positive serum and specificity LMP1 antibody (S12) in cell hole after, 37 ℃ are incubated 45 minutes.The goat anti-human igg of use luciferin mark and goat anti-mouse igg detect the proteic expression of LMP1 Δ in the bhk cell as second antibody with indirect immumofluorescent method known in the art.With the bhk cell of empty plasmid transfection in contrast.The result as seen, the bhk cell of pcDNAIII-LMP1 Δ transient transfection all is rendered as the immunofluorescence positive, the control group bhk cell is then negative.

(2) in another comparative experiments, respectively with above-mentioned recombinant plasmid pcDNAIII-LMP1 Δ and recombinant plasmid pSG5-LMP1 (being so kind as to give) rotaring copolymering NIH 3 T 3 cell (Swiss mice embryonic immortalization fibroblast) that carries complete LMP1 gene by professor Kieff of Harvard University, and (be 1 * 104 cells/well) in contrast with the normal NIH3T3 cell that does not import any foreign DNA, the EagleShi nutrient solution that adds the foetal calf serum (5%, 1%, 0.5%) that contains the concentration of successively decreasing is cultivated after 24 hours the propagation level of observation of cell.The result as seen, the growth conditions of the 3T3 cell of pSG5-LMP1 transfection significantly better than the transfection of pcDNAIII-LMP1 Δ and without the 3T3 cell of any place source DNA transfection.This result shows that LMP1 Δ gene can promote cell growth and propagation (referring to Fig. 3) forcefully at intracellular expression product.

(3) cultured continuously in being added with 1640 substratum of 2% foetal calf serum of three groups of cells described in the above-mentioned experiment (2) is organized about 10 according to a conventional method after 2 weeks from each ⁷Extract DNA in the individual cell, be template with the DNA of three groups of cells respectively then, use upstream primer 5 '-GCGCCTAGHATGGAACACGACCTT-3 ' (SEQ ID NO:4), with downstream primer 5 '-GCCTTAATTAGCATAGTAGCTT-3 ' (SEQ ID NO:5), by aforementioned PCR response procedures the DNA of gained is carried out pcr amplification.

The PCR reaction product shows after 1.5% agarose gel electrophoresis separates, with the NIH3T3 cell DNA of pSG5-LMP1 transfection is the band that has a treaty 1.1kb in the amplified production that obtains of template, and is the band that has a treaty 800bp in the amplified production that obtains of template with the 3T3 cell DNA of pcDNAIII-LMP1 Δ transfection.Relatively, control group 3T3 cell is not then seen any electrophoretic band from foreign DNA.

Embodiment 4: with EBV-LMP1 specificity humoral and the cell immune response that brings out behind the recombinant plasmid pcDNAIII-LMP1 Δ immune animal

(1) with 5 the week age Balb/c (H-2 ^d) mouse is divided into 4 groups at random, animal via with 1% phenylethyl barbituric acid (0.2ml) anesthesia after, intramuscular injection (1) empty plasmid pcDNAIII (100 μ g/ animal) and (2) pcDNAIII-LMP1 Δ respectively.The come into operation dosage of recombinant DNA of three experimental group animal via intramuscular injection approach is respectively 100 μ g/ animals, 20 μ g/ animals and 100 μ g+200 unit interleukin-22 (IL-2)/animals.For the first time after the immunity, respectively at second week with the 6th week carried out booster immunization twice.Blood sampling and separating animal's spleen during the 8th week, with the specific antibody titre in the indirect immumofluorescent method detection of the routine animal serum, and with known lactic dehydrogenase enzyme process detection LMP1 specific CTL activity level.

In order to detect the antibody horizontal in the immunized animal serum, use has been infected the P815 resistant cell that acne is stayed virus (Vac-LMP1) and cultivation obtains in the selection substratum that contains G418 (Promega) of LMP1 gene as positive antigen-like material, the sheep anti-mouse igg that uses the luciferin mark is as second antibody, detect not existing and level of LMP1 specific antibody in the mice serum of dna immunization on the same group with indirect immumofluorescent method, shown in the following tabulation 1 of result.

Table 1 dna immunization mice serum specific antibody generates and titre

Dna immunization serum Antigen

Vero/Vac-LMP1 Vero resistance P815

The empty plasmid carrier---

100 μ g recombinant DNAs 1: 10-1: 10

200 μ g recombinant DNAs 1: 10-1: 10

100 μ g recombinant DNAs 1: 10-1: 10

+IL-2

On the other hand, the splenocyte of immunized animal and Vac-LMP1 are infected normal mouse splenocyte (10: 1) mix, and with gained cell mixing action effect cell.Use is cultivated in containing the substratum of G418, and the P815 cell of pcDNAIII-LMP1 Δ transfection is as target cell.Select the suitableeest target cell concentration and different effect/target ratios, detect the LMP1 specific CTL level of immunized animal with the lactic dehydrogenase enzyme process.The result as shown in Figure 4.

From result shown in Figure 4 as can be seen, after with recombinant DNA immunity of the present invention, LMP1 specific CTL activity raises along with the increase of effect/target cell ratio in the animal body.And in each immune group, a little higher than low dose group of CTL level of high dosage (200 μ g) treated animal, but do not have significant difference on the statistics.

Sequence table

(1) general information

(I) applicant: Virology Inst., Chinese Academy of Preventive Medical Science

(II) denomination of invention: the Epstein-Barr virus LMP1 encoding sequence of modification, its preparation and application

(III) sequence: 5

(IV) mailing address

(A) contact person: Zhou Ling

(B) street: see the New Year in No. 100, street, Xuanwu District

(C) city: Beijing

(D) country: the People's Republic of China (PRC)

(E) postcode: 10052

(V) computer-reader form:

(A) amboceptor type: 3.5 cun floppy disks

(B) computer: IBM PC

(C) operating system: WIN98

(D) software: WORD2000

(VI) telecommunication information:

Phone: 86-10-63578308

(2) information of SEQ ID NO.1:

(i) sequence signature:

(A) length: 23bp

(B) type: nucleic acid

TTAACTGGCACAACACACTCCCTTAGCCACA

(2) information of SEQ ID NO.4:

(i) sequence signature:

(A) length: 24bp

(B) type: nucleic acid

(C) connect type: strand

(D) topological framework: linear

(ii) molecule type: genomic dna

(iii) sequence description: SEQ ID NO.4

GCGCCTAGHATGGAACACGACCTT

(2) information of SEQ ID NO.5:

(i) sequence signature:

(A) length: 22bp

(B) type: nucleic acid

(C) connect type: strand

(D) topological framework: linear

(ii) molecule type: genomic dna

(iii) sequence description: SEQ ID NO.5

GCCTTAATTAGCATAGTAGCTT

(C) connect type: strand

(D) topological framework: linear

(ii) molecule type: genomic dna

(iii) sequence description: SEQ ID NO.1

GGGGCTAGATGGAACGCGACCTT

(2) information of SEQ ID NO.2:

(i) sequence signature:

(A) length: 23bp

(B) type: nucleic acid

(C) connect type: strand

(D) topological framework: linear

(ii) molecule type: genomic dna

(iii) sequence description: SEQ ID NO.2

GCCTTAAGTTAGTCATGTAGCTT

(2) information of SEQ ID NO.3:

(i) sequence signature:

(A) length: 964bp

(B) type: nucleic acid

(C) connect type: strand

(D) topological framework: linear

(ii) molecule type: genomic dna

(iii) sequence description: SEQ ID NO.3

CTGCCTTGCTCCTGACACACTGCCCTGAGGATGGAACACGACC

TTGAGAGGGGCCCACCGGGCCCGCGACGGCCCCCTCGAGGAC

CCCCCCTCTCCTCTTCCCTAGGCCTTGCTCTCCTTCTCCTCCTCT

TGGCGCTACTGTTTTGGCTGTACATCGTTATGAGTGACTGGACT

GGAGGAGCCCTCCTTGTCCTCTATTCCTTTGCTCTCATGCTTATA

ATTATAATTTTGATCATCTTTATCTTCAGAAGAGACCTTCTCTGTC

CACTTGGAGCCCTTTGTATACTCCTACTGATGAGTAAGTATTACA

CCCTTTGCCCCACACCCCCTTTCCCTTACTCTTCCTTCTCTAACG

CACTTTCTCCTCTTTCCCCAGTCACCCTCCTGCTCATCGCTCTCT

GGAATTTGCACGGACAGGCATTGTTCCTTGGAATTGTGCTGTTC

ATCTTCGGGTGCTTACTTGGTAAGATCTAACATTCCCTAGGAATT

ATTTACCACACCCCACTTTTCCAACCCTAACACTCTTTTTTCAAC

GCAGTCTTAGGTATCTGGATCTACTTATTGGAGATGCTCTGGCGA

CTTGGTGCCACCATCTGGCAGCTTTTGGCCTTCTTCCTAGCCTTC

TTCCTAGACCTCATCCTGCTCATTATTGCTCTCTATCTACAACAA

AACTGGTGGACTCTATTGGTTGATCTCCTTTGGCTCCTCCTGTTT

CTGGCGATTTTAATCTGGATGTATTATACCATGGCGGCGGTGATCC

ACACCTTCCTACGCTGCTTTTGGGTTCTTCTGGTTCCGGTGGAG

ATGATGACGACCCCCACGGCCCAGTTCAGCTAAGCTACTATGAC

TAACCTTTCTTTACTTCTAGGCATTACCATGTCATAGGCTTGCCT

GACTGACTCTCCCTCCATTTACTGGGAATGCCTTAGCTAATCACC

Claims (3)

1, Epstein-Barr virus latent membrane protein 1 gene deutero-recombinant DNA is characterised in that to have deleted the requisite part of 3 ' terminal cell transformation function and kept in Epstein-Barr virus latent membrane protein 1 gene of this recombinant DNA to have immunogen activity and the active CTL epi-position of specific killing part.

2, according to the recombinant DNA of claim 1, wherein said Epstein-Barr virus latent membrane protein 1 gene has the nucleotide sequence shown in the SEQ ID NO:3.

3, claim 1 or 2 recombinant DNAs that limit are used for the treatment of the medicine of EBV relative disease or the application in the vaccine in preparation.

Images