CN1629317A - Molecular marker of rice blast resistance gene, its dedicated primer and application thereof - Google Patents
Molecular marker of rice blast resistance gene, its dedicated primer and application thereof Download PDFInfo
- Publication number
- CN1629317A CN1629317A CN 200310118434 CN200310118434A CN1629317A CN 1629317 A CN1629317 A CN 1629317A CN 200310118434 CN200310118434 CN 200310118434 CN 200310118434 A CN200310118434 A CN 200310118434A CN 1629317 A CN1629317 A CN 1629317A
- Authority
- CN
- China
- Prior art keywords
- seq
- seconds
- disease
- resistant
- molecule marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention provides a molecular marker of rice blast resisting gene Pi-d2 and the application, wherein the molecular marker is one of the following molecular marker family, RM22, G45STS, RM3, RM527, SP001, SP003, CAPs1, CAPs2, CAPs3, CAPs4, CAPs8, dCAPs1, dCAPs2, or nucleic acid sequence by substitution, deletion or addition of one or several bases and has molecular marker selection function. The invention also provides the primer for obtaining the molecular marker of the rice blast resisting gene Pi-d2, and the method for obtaining the molecular marker SP001 and SP003 of the rice blast resisting gene Pi-d2.
Description
Technical field
The present invention relates to molecule marker and the primer special and the application of plant disease resistance genes, particularly relate to molecule marker and primer special and the application of blast resistant gene Pi-d2.
Background technology
Rice blast is one of main disease of paddy rice, has a strong impact on output and the quality of paddy rice.The research of blast resisting and utilization thereof are the important steps of cultivating and planting disease-resistant variety.To the control of rice blast, general traditional chemical prevention and the plantation resistant variety of adopting controlled the rice blast disease on cultivating, and lacks permanently effective sterilant again yet the chemical prevention cost is too high, and easy contaminate environment; In breeding, carry out different anti-source kind shifting cultivations, cultivate the disease resistance that multiline variety and horizontal resistance kind can keep kind, but the production of hybrid seeds is given in kind shifting cultivation, work such as reserve seed for planting is made troubles; The cultivation of multiline variety, plantation work are loaded down with trivial details; The resistance of horizontal resistance kind is often not thorough again.Traditional breeding for disease resistance depends on the evaluation of resistance and the Phenotypic Selection of plant, require rich experience and the time that reaches several years even more than ten years, and be subjected to the restriction of onset condition, can not effectively follow the trail of by the enantiopathy gene, be difficult to the chain burden of elimination and the closely linked unfavorable gene of disease-resistant gene (or chromosome segment).
In addition, because the many forms with gene cluster or duplicate genes of resistant gene exist, may change less during evolution, basically still keep the original gene cluster or the form of duplicate genes, also may be owing to reasons such as reorganization or swivel bases, originally the member of gene cluster or duplicate genes intersperses among the different chromosomal region of genome, its each gene member is because of the variation or the karyomit(e) microcell difference of living in of its base sequence, respectively can be and be evolved into to the different genes of the pathogenic physiological strain generation of difference disease resistance, or be evolved into and irrelevant at all gene or the dna fragmentation of resistance, therefore, these different genes may keep gene cluster or duplicate genes original composition (as the resistance conserved sequence of mentioning at present) in varying degrees, become it and express the prerequisite that produces resistance.At present by to the analysis of the isolating resistant gene encoded protein matter structure similarities and differences, find that most resistant genes have following conserved domain respectively, that is: contain nucleotide binding site (NBS), rich leucine repeats (LRR), serine/threonine protein kitase (STK); The transmembrane receptor protein gene that contains the transmembrane receptor protein gene of the outer LRR structure of born of the same parents and contain outer LRR of born of the same parents and STK structure simultaneously.These general character according to disease-resistant gene, with the conserved sequence is the basic design primer, in plant, use the round pcr amplification and separate disease resistant gene homologous sequence, the rapid screening candidate gene, yet make and to obtain the approaching and don't dna fragmentation together of a lot of fragment lengths in this way, need these fragments are cloned one by one, checked order and locate, the workload of analyzing is bigger, and is difficult to separate and obtains disease resistant gene homologous sequence Resistance Gene Analog (RGA) fragment relevant with the target disease-resistant gene.
Molecular marker assisted selection is to differentiate by analyzing with the genotype of the closely linked molecule marker of disease-resistant gene whether target gene exists, realize the indirect selection of enantiopathy plant, owing to be not subjected to other genetic effect and Effect of Environmental, can be in generation selection early, shortening the breeding cycle, improve breeding efficiency.In addition because the complicacy and the morbific diversity of heredity of its pathogenic bacteria microspecies of rice blast and variation, being easy to of monistic disease-resistant variety lost disease resistance in several years.Therefore, identify and develop the source of more resistant gene on the one hand, can provide sufficient material resources for the blast resisting breeding; On the other hand, what identify can be used for the assisted Selection of disease-resistant gene with the chain molecule marker of disease-resistant gene, improves the efficient of breeding for disease resistance greatly.
Ground paddy is that Guangxi local variety paddy imperial 13 hybridizes a disease-resistant maintenance line of breeding with precious Shan 97, and its strong resistance, anti-spectrum are mainly one of anti-sources of present hybrid rice extensively.
The innovation and creation content
The molecule marker that the purpose of this invention is to provide blast resistant gene Pi-d2.
The molecule marker of blast resistant gene Pi-d2 is one of nucleotide sequence that amplification in rice total dna is come out with following primer: SEQ ID №: 1 and SEQ ID №: 2, SEQ ID №: 3 and SEQ ID №: 4, SEQ ID №: 5 and SEQ ID №: 6, SEQ ID №: 7 and SEQ ID №: 8, SEQ ID №: 9 and SEQ ID №: 10, SEQ ID №: 9 and SEQ ID №: 11, SEQ ID №: 12 and SEQ ID №: 13, SEQ ID №: 14 and SEQ ID №: 15, SEQ ID №: 16 and SEQ ID №: 17, SEQ ID №: 18 and SEQ ID №: 19, SEQ ID №: 20 and SEQ ID №: 21, SEQ ID №: 22 and SEQ ID №: 23, SEQ ID №: 24 and SEQ ID №: 25.
The present invention also provides the primer of the molecule marker that obtains above-mentioned blast resistant gene Pi-d2.
The primer of molecule marker that obtains above-mentioned blast resistant gene Pi-d2 is as follows:
1) primer that obtains the molecule marker RM262 of blast resistant gene Pi-d2 is the SEQ ID № in the sequence table: 1 and SEQ ID №: 2;
2) primer that obtains the molecule marker G45STS of blast resistant gene Pi-d2 is the SEQ ID № in the sequence table: 3 and SEQ ID №: 4;
3) primer that obtains the molecule marker RM3 of blast resistant gene Pi-d2 is the SEQ ID № in the sequence table: 5 and SEQ ID №: 6;
4) primer that obtains the molecule marker RM527 of blast resistant gene Pi-d2 is the SEQ ID № in the sequence table: 7 and SEQ ID №: 8;
5) primer that obtains the molecule marker SP001 of blast resistant gene Pi-d2 is the SEQ ID № in the sequence table: 9 and SEQ ID №: 10;
6) primer that obtains the molecule marker SP003 of blast resistant gene Pi-d2 is the SEQ ID № in the sequence table: 9 and SEQ ID №: 11;
7) primer that obtains the molecule marker CAPs1 of blast resistant gene Pi-d2 is the SEQ ID № in the sequence table: 12 and SEQ ID №: 13;
8) primer that obtains the molecule marker CAPs2 of blast resistant gene Pi-d2 is the SEQ ID № in the sequence table: 14 and SEQ ID №: 15;
9) primer that obtains the molecule marker CAPs3 of blast resistant gene Pi-d2 is the SEQ ID № in the sequence table: 16 and SEQ ID №: 17;
10) primer that obtains the molecule marker CAPs4 of blast resistant gene Pi-d2 is the SEQ ID № in the sequence table: 18 and SEQ ID №: 19;
11) primer that obtains the molecule marker CAPs8 of blast resistant gene Pi-d2 is the SEQ ID № in the sequence table: 20 and SEQ ID №: 21;
12) primer that obtains the molecule marker dCAPs1 of blast resistant gene Pi-d2 is the SEQ ID № in the sequence table: 22 and SEQ ID №: 23;
13) primer that obtains the molecule marker dCAPs2 of blast resistant gene Pi-d2 is the SEQ ID № in the sequence table: 24 and SEQ ID №: 25.
Under the guiding of above-mentioned primer, utilize conventional PCR method can obtain above-mentioned molecule marker.
The present invention also utilizes the disease resistant gene homologous sequence amplification technique to obtain the molecule marker SP001 of blast resistant gene Pi-d (t) 1 and the molecule marker SP003 of Pi-d2.Described disease resistant gene homologous sequence amplification technique is to carry out the Uneven pcr amplification according to the designed special degenerated primers of disease-resistant conserved sequence in conjunction with random primer enantiopathy and susceptible material, and obtain the polymorphism amplification of DNA fragments, thereby obtain the part dna fragmentation with closely linked molecule marker of disease-resistant gene or disease-resistant gene, be used for location, clone and the molecular marker assisted selection of enantiopathy gene.
Utilize the disease resistant gene homologous sequence amplification technique to obtain the concrete grammar of the molecule marker SP001 of blast resistant gene Pi-d (t) 1, be with the SEQ ID № in the sequence table: 9 and SEQ ID №: 10 nucleotides sequence is classified primer as, carry out the Uneven pcr amplification, obtain this molecule marker.Obtaining the method for the molecule marker SP003 of blast resistant gene Pi-d2, is with the SEQ ID № in the sequence table: 9 and SEQ ID №: 11 is primer, carries out the Uneven pcr amplification, obtains this molecule marker.
Above-mentioned Uneven PCR program is as follows: 94 ℃ of pre-sex change 5 minutes; Then by 94 ℃ 30 seconds, 55 ℃ 1 minute, 72 ℃ 1 minute, 94 ℃ 15 seconds, 42 ℃ 1 minute, 72 ℃ were carried out 3 circulations in 1 minute, then by 94 ℃ 15 seconds, 57 ℃ 30 seconds, 72 ℃ 30 seconds, 94 ℃ 15 seconds, 42 ℃ 30 seconds, 72 ℃ were carried out 32 circulations in 30 seconds, extended 5 minutes at 72 ℃ again.
The molecule marker of blast resistant gene Pi-d (t) 1 of the present invention and Pi-d2 can differentiate whether target gene Pi-d (t) 1 and Pi-d2 exist, realize the indirect selection of enantiopathy plant, owing to be not subjected to other genetic effect and Effect of Environmental, can be in generation selection early, shortening the breeding cycle, improve breeding efficiency.The amplification new technology of molecule marker of the present invention and disease resistant gene homologous sequence enlarges the crop-planting scope to cultivating the especially disease-resistant rice varieties of disease-resistant plants kind, and it is significant to improve crop yield.
The present invention will be further described below in conjunction with drawings and the specific embodiments.
Description of drawings
Figure 1A is molecule marker RM3, the RM262 polymorphism between the susceptible pond of parent and disease-resistant pond
Figure 1B is the separation case of RM262 in the I of F2 colony
Fig. 1 C is the separation case of RM3 in the II of F2 colony
Fig. 2 A be Pi-d (t) 1 on the 2nd karyomit(e) the location and chain molecule marker
Fig. 2 B is the location of Pi-d2 on the 6th karyomit(e) and chain molecule marker
Fig. 3 A be SP001 in the I of F2 colony be divided into from Fig. 3 B be SP003 in the II of F2 colony be divided into from
Fig. 4 is the chain molecule marker with Pi-d2
Embodiment
Embodiment 1, the evaluation and the genetic analysis of paddy blast resistant gene
Use two stronger rice blast physiological strain ZB13 of rice district, China south virulence and ZB15 paddy and susceptible rice varieties Lijiang xintuanheigu (LTH), the south of the River perfume (or spice) glutinous (JNXN) and the F of hybridization acquisition over the ground
1, BC
1F
1, F
2Colony inoculates evaluation, and the result is shown in table 1A, and ground paddy all shows as disease-resistant to ZB13 and ZB15, Lijiang xintuanheigu, the south of the River fragrant glutinous all show as susceptible, the F of ground paddy and Lijiang xintuanheigu, the fragrant glutinous hybridization acquisition in the south of the River
1Plant also all shows as disease-resistant to ZB13 and ZB15, and ground paddy and Lijiang xintuanheigu, the fragrant glutinous hybridization in the south of the River, the B of colony of acquisition further backcrosses
1F
1In disease-resistant individual plant and susceptible individual plant meet 1: 1, and the disease-resistant susceptible separation of each F2 colony is than all meeting 3: 1.Simultaneously, whether relevant to the resistance of ZB13 and ZB15 in order to detect ground paddy, Yi Digu and south of the River perfume is glutinous has developed another one F for the parent
2Colony successively inoculates with ZB13 and ZB15 each individual plant of this colony, and the result is as showing shown in the 1B this F
2Colony separates ratio basically near 9: 3: 3 in the anti-sense to ZB13 and ZB15: 1, and explanatorily paddy does not influence each other basically to ZB13 and ZB15 resistance, then is relatively independent in heredity.These results show that rice varieties ground paddy is controlled by endonuclear single-gene respectively to the resistance of rice blast microspecies ZB13 and ZB15, and are complete dominant inheritance, and name respectively and be Pi-d (t) 1, Pi-d2.
Table 1A parent ground paddy (Digu), Lijiang xintuanheigu (LTH), south of the River perfume (or spice) glutinous (JNXN) and assorted
Hand over the disease-resistant susceptible situation (R=disease-resistant, S=susceptible) of offspring to rice blast pathogenic bacteria microspecies ZB13 and ZB15
| Parent and progeny population thereof | Chi-square test (ZB13) Chi-square test (ZB15) | |||||||||
| Disease-resistant, susceptible individual plant number | The expectation ratio | ??x 2 | ??P 0.05，0.01 | Disease-resistant, susceptible individual plant number | The expectation ratio | ???x 2 | ??P 0.05，0.01 | |||
| ??R | ??S | ??R∶S | ??R | ????S | ??R∶S | |||||
| ?????Digu | ????35 | ??37 | ||||||||
| ?????LTH | ??40 | ????32 | ||||||||
| ????‘Digu/LTH’F 1 | ????22 | ??18 | ||||||||
| ????‘LTH/Digu’F 1 | ????15 | ??26 | ||||||||
| ????‘(Digu/LTH)/LTH’F 1 | ????27 | ??24 | ??1∶1 | ??0.1764 | ??3.84-6.63 | ??23 | ????18 | ????1∶1 | ??0.2602 | ??3.84-6.63 |
| ????‘(LTH/Digu)/Digu’F 1 | ????16 | ??17 | ??1∶1 | ??0.0018 | ??3.84-6.63 | ??32 | ????28 | ????1∶1 | ??0.2667 | ??3.84-6.63 |
| ????‘Digu/LTH’F 2 | ????212 | ??58 | ??3∶1 | ??1.7827 | ??3.84-6.63 | ??372 | ????100 | ????3∶1 | ??3.406 | ??3.84-6.63 |
| ????‘LTH/Digu’F 2 | ????126 | ??30 | ??3∶1 | ??0.1731 | ??3.84-6.63 | ??422 | ????118 | ????3∶1 | ??2.8643 | ??3.84-6.63 |
| ?????JNXN | ??27 | ????21 | ||||||||
| ????‘Digu/JNXN’F 1 | ????12 | ??17 | ||||||||
| ????‘JNXN/Digu’F 1 | ????15 | ??23 | ||||||||
| ????‘(Digu/JNXN)/JNXN’F 1 | ????41 | ??37 | ??1∶1 | ??0.2051 | ??3.84-6.63 | ??19 | ????17 | ????1∶1 | ??0.1111 | ??3.84-6.63 |
| ????‘(JNXN/Digu)/Digu’F 1 | ????15 | ??23 | ??1∶1 | ??1.6842 | ??3.84-6.63 | ??21 | ????16 | ????1∶1 | ??1.3889 | ??3.84-6.63 |
| ????‘Digu/JNXN’F 2 | ????108 | ??45 | ??3∶1 | ??1.3617 | ??3.84-6.63 | ??84 | ????37 | ????3∶1 | ??2.0083 | ??3.84-6.63 |
| ????‘JNXN/Digu’F 2 | ????229 | ??67 | ??3∶1 | ??1.5450 | ??3.84-6.63 | ??105 | ????39 | ????3∶1 | ??0.3333 | ??3.84-6.63 |
Table 1B (paddy/south of the River perfume (or spice) glutinous) F2 colony is to rice blast pathogenic bacteria microspecies
The disease-resistant susceptible separation case of ZB13 and ZB15 (R=is disease-resistant, and S=is susceptible)
| ????F 2Plant | ??????????????????238 | Chi-square test | |||||
| ????ZB13 | ????R | ????R | ????S | ????S | The expectation ratio | ????x 2 | ??P 0.05，0.01 |
| ????ZB15 | ????R | ????S | ????R | ????S | |||
| The plant number | ????126 | ????40 | ????51 | ????21 | ??9∶3∶3∶1 | ????4.3754 | ??3.84-6.6 |
Annotate: all F2 individual plants are all successively handled with Pyricularia oryzae ZB13 and ZB15 inoculation independently
Embodiment 2, Pi-d (t) 1, Pi-d2 and other known blast resistant gene relationship analysis
The Japan that contains known disease-resistant gene is differentiated the F of system and ZYQ8 and they and ground paddy hybridization acquisition with rice blast microspecies ZB13 and ZB15
1And F
2Colony inoculates evaluation.As show shown in the 2A, the rice blast of 12 Japan differentiates that strain and narrow leaf all show as susceptible reaction to ZB13 blue or green No. 8, the F that these rice varieties and ground paddy hybridization obtain
2Colony meets 3: 1 to disease-resistant, the susceptible separation ratio of ZB13, shows blast resistant gene Pi-d (t) 1 and known Pik in the ground paddy
s, Pia, Pik, Pi-b, Pi-k
p, Pi-ta
2, Pi-ta, Pi-z, Pi-i, Pi-k
m, Pi-z
i, Pi-t, blast resistant gene differences such as Pi-11.As show shown in the 2B, BL-1, K60, Pi-4 number, K1, Fu Jin, No. 5, rattan slope, plum rains are bright etc., and 7 kinds all show susceptible reaction to ZB15, and the F that obtains with the hybridization of ground paddy
1All show disease resistance response, hybridize the F that obtains with ground paddy
2Disease-resistant, susceptible separation meet 3: 1 than all, show that the contained blast resistant gene of the contained blast resistant gene Pi-d2 of ground paddy and these 7 kinds is different.And rice varieties K59, the F of narrow leaf blue or green No. 8 and No. 1, Zhai and they and ground paddy hybridization acquisition
1ZB15 is all shown as disease resistance response, but its corresponding F
2Colony all separates and susceptible individual plant occurred, and its separation did not meet 3: 1 than both, did not meet 15: 1 yet,
Table 2A ground paddy and each rice blast differential variety filial generation F1 and F2 colony
Disease-resistant susceptible separation case (R=is disease-resistant, and S=is susceptible) to rice blast pathogenic bacteria ZB13
| Rice blast differential variety (disease-resistant gene) | Differential variety is disease-resistant/susceptible response situation | ??F 1Disease-resistant/susceptible response situation of plant | ???????????????????????F 1Disease-resistant/susceptible response situation of plant | |||||
| The plant sum | Disease-resistant strain number | Susceptible strain number | Chi-square test | |||||
| The expectation ratio | ????x 2 | ?P 0.05，0.01 | ||||||
| New No. 2 (Pik s) like to know the careless flute e of the rising sun (Pia) (Pik) BL-1 (Pi-b) K60 (Pi-k p) ????Pi.No.4(Pi-ta 2) No. 5 bright (Pi-k of (Pi-i) plum rains of K1 (Pi-ta) good fortune brocade (Pi-z) rattan slope m) No. 1 (Pi-z of Zhai i) blue or green No. 8 (Pi-11) of K59 (Pi-t) narrow leaf | ????S ????S ????S ????S ????S ????S ????S ????S ????S ????S ????S ????S ????S | ????R ????R ????R ????R ????R ????R ????R ????R ????R ????R ????R ????R ????R | ????118 ????90 ????156 ????220 ????230 ????204 ????224 ????240 ????201 ????205 ????204 ????222 ????267 | ????83 ????72 ????109 ????155 ????163 ????150 ????163 ????174 ????149 ????145 ????160 ????178 ????208 | ????35 ????18 ????47 ????65 ????67 ????54 ????61 ????66 ????52 ????60 ????44 ????44 ????59 | ????3∶1 ????3∶1 ????3∶1 ????3∶1 ????3∶1 ????3∶1 ????3∶1 ????3∶1 ????3∶1 ????3∶1 ????3∶1 ????3∶1 ????3∶1 | ????1.3672 ????1.2000 ????2.1880 ????2.1879 ????1.8783 ????0.1634 ????0.4821 ????0.6722 ????0.0415 ????1.7707 ????1.1046 ????2.9069 ????1.0499 | ?3.84-6.63 ?3.84-6.63 ?3.84-6.63 ?3.84-6.63 ?3.84-6.63 ?3.84-6.63 ?3.84-6.63 ?3.84-6.63 ?3.84-6.63 ?3.84-6.63 ?3?84-6.63 ?3.84-6.63 ?3.84-6.63 |
Table 2B ground paddy and each rice blast differential variety filial generation F
1And F
2Colony is right
The disease-resistant susceptible separation case of rice blast pathogenic bacteria ZB15 (R=is disease-resistant, and S=is susceptible)
| Rice blast differential variety (disease-resistant gene) | Differential variety is disease-resistant/susceptible response situation | ??F 1Disease-resistant/susceptible response situation of plant | ?????????????????????????????F 1Disease-resistant/susceptible response situation of plant | |||||
| The plant sum | Disease-resistant strain number | Susceptible strain number. | Chi-square test | |||||
| The expectation ratio | ????x 2 | ????P 0.05，0.01 | ||||||
| New No. 2 (Pik s) like to know the careless flute e of the rising sun (Pia) (Pik) BL-1 (Pi-b) K60 (Pi-k p) ??Pi.No.4(Pi-ta 2) No. 5 bright (Pi-k of (Pi-i) plum rains of K1 (Pi-ta) good fortune brocade (Pi-z) rattan slope m) No. 1 (Pi-z of Zhai i) blue or green No. 8 (Pi-11) of K59 (Pi-t) narrow leaf | ????S ????S ????S ????S ????S ????S ????S ????S ????S ????S ????R ????R ????R | ????R ????R ????R ????R ????R ????R ????R ????R ????R ????R ????R ????R ????R | ????93 ????117 ????196 ????198 ????215 ????205 ????231 ????195 ????228 ????250 ????231 ????218 ????265 | ????73 ????85 ????141 ????141 ????153 ????150 ????155 ????158 ????157 ????157 ????229 ????192 ????227 | ????20 ????32 ????55 ????57 ????62 ????55 ????76 ????37 ????71 ????53 ????2 ????26 ????38 | ????3∶1 ????3∶1 ????3∶1 ????3∶1 ????3∶1 ????3∶1 ????3∶1 ????3∶1 ????3∶1 ????3∶1 ????-- ????-- ????-- | ????0.6057 ????0.3447 ????0.9800 ????1.3878 ????1.4900 ????0.2748 ????1.8185 ????0.8654 ????4.2632 ????1.7280 ????-- ????-- ????-- | ????3.84-6.63 ????3.84-6.63 ????3.84-6.63 ????3.84-6.63 ????3.84-6.63 ????3.84-6.63 ????3.84-6.63 ????3.84-6.63 ????3.84-6.63 ????3.84-6.63 ????-- ????-- ????-- |
Show K59, may also contain blast resistant gene among No. 1, narrow leaf blue or green No. 8 and the Zhai ZB15, but different with Pi-d2 in the ground paddy, nor equipotential.
Embodiment 3, with the evaluation of disease-resistant gene linkage molecule mark
With ground paddy and Lijiang xintuanheigu is the parent, has developed two F
2Colony is respectively F
2I of colony and F
2The II of colony uses ZB13, and ZB15 is respectively to F
2I of colony and F
2The II of colony inoculates processing, identify disease-resistant and susceptible individual plant, and disease-resistant individual plant and susceptible individual plant resisted, feel and hiving off, 6 individual plants of difference picked at random from disease-resistant and disease plant, get the equivalent blade, and, form disease-resistant and susceptible DNA pond with the blade of disease-resistant and susceptible individual plant mixed extraction DNA respectively, the disease-resistant and susceptible DNA pond of ZB13 is named respectively be BR13 and BS13; Similarly the disease-resistant and susceptible DNA pond of ZB15 is named respectively and be BR15 and BS15.Successively parent ground paddy and Lijiang xintuanheigu are carried out dna polymorphism screen with being distributed in 12 chromosomal 127 RFLP marks of paddy rice and 322 SSR marks more fifty-fifty, find wherein to have 72 RFLP marks and 119 SSR marks can disclose the polymorphism of two parent DNA, and then analyze with the susceptible DNA pond of these 191 molecule marker enantiopathies, discovery is positioned at the 2nd chromosomal RFLP mark G1314A and SSR mark RM262 can disclose polymorphism (shown in Figure 1A) between DNA pond BR13 and BS13 significantly, show that ground paddy is positioned on the 2nd karyomit(e) probably to the blast resistant gene Pi-d (t) 1 of ZB13, and it is chain with molecule marker G1314A and RM262, among Figure 1A, 1,2,3,4,5,6 represent ground paddy, Lijiang xintuanheigu respectively, BR15, BS15, BR13, BS13; M1, M2 represent dna molecular Marker DL2000 and λ DNA/HindIII respectively; And be positioned at the 6th chromosomal SSR mark RM3 and be positioned at SSR mark RM209 on the 11st karyomit(e), RM21 can show the polymorphism between DNA pond BR15 and BS15 significantly, shows that ground paddy is positioned near the 6th chromosomal molecule marker RM3 to the disease-resistant gene Pi-d2 of ZB15 or near the 11st karyomit(e) molecule marker RM209, the RM21 probably.Can disclose polymorphism between BR13 and BS13 owing to be positioned at molecule marker G1314A on the 2nd karyomit(e) and RM262, then with these two molecule markers to F
2Disease-resistant and the susceptible individual plant of the I of colony is analyzed, and finds this two molecule markers and F
2Disease-resistant susceptible separation among the I of colony is obviously relevant, and RM262 is at F
2Separation case among the I of colony shows that blast resistant gene Pi-d (t) 1 is positioned on the 2nd karyomit(e) really and chain with molecule marker G1314A and RM262 shown in Figure 1B, R is disease-resistant individual plant among the figure; S is susceptible individual plant; In addition, with disclosing molecule marker RM3, the RM209 of polymorphism between BR15 and BS15 and RM21 to F
2The disease-resistant susceptible individual plant of the II of colony is analyzed, and shown in Fig. 1 C, shows F
2The disease-resistant susceptible separation of the II of colony is obviously relevant with RM3, and irrelevant with RM209 and RM21, shows that this gene Pi-d2 is positioned on the 6th karyomit(e), and chain with molecule marker RM3, and R represents disease-resistant individual plant among Fig. 1 C; S represents susceptible individual plant; M represents DNA Marker (DL2000).Further with on the 2nd karyomit(e) with contiguous other molecule marker of molecule marker G1314A and RM262 and the 6th karyomit(e) on the contiguous molecule marker of molecule marker RM3 respectively to F
2I of colony and F
2The II of colony carries out linkage analysis, and the data based MAPMAKER3.0 mapping that analysis is obtained, made up the genetic linkage map of blast resistant gene respectively, shown in Fig. 2 A and Fig. 2 B, wherein gene Pi-d (t) 1 is between the molecule marker G1314A and G45 on the 2nd karyomit(e), and genetic distance is respectively 1.2cM and 10.6cM.And gene Pi-d2 is between the molecule marker RM3 and RM527 on the 6th karyomit(e), and genetic distance is respectively 3.4cM and 3.2cM.
The RGA mark of embodiment 4, exploitation blast resistant gene
The special degenerated primers designed according to disease-resistant conserved sequence carries out the Uneven pcr amplification in conjunction with random primer to two parents ground paddy, Lijiang xintuanheigu DNA and disease-resistant susceptible pond DNA, and analyzes polymorphism.The conserved structure of the disease-resistant gene that the main basis of specificity degenerated primer is cloned in Arabidopis thaliana, flax, tobacco and paddy rice at present such as nucleotide binding site NBS structure, Kinase-1a (MGGVGKTT) and Domain2 (GLPLAL) design (X3:5 '-GGNATGGGNGGNNINGGNAA (A/G) ACNAC-3 ', X3antisense:5 '-GTNGT (C/T) TTNCCNANNCCNCCCATNCC-3 ', Z7:5 '-NAC (T/C) TTNAGNGCNAGNGGNAGNCC-3 ', Z7antisense:5 '-GGNCTNCCNGTNGCNGTNAA (G/A) GTN-3 ').About 100 random primers that contain 10 Nucleotide are synthetic by the living worker in Shanghai.Uneven PCR program is as follows: 94 ℃ of pre-sex change 5 minutes; Then by 94 ℃ 30 seconds, 55 ℃ 1 minute, 72 ℃ 1 minute, 94 ℃ 15 seconds, 42 ℃ 1 minute, 72 ℃ were carried out 3 circulations in 1 minute, then by 94 ℃ 15 seconds, 57 ℃ 30 seconds, 72 ℃ 30 seconds, 94 ℃ 15 seconds, 42 ℃ 30 seconds, 72 ℃ were carried out 32 circulations in 30 seconds, extended 5 minutes at 72 ℃ again.Found that special primer X3 can disclose polymorphism between parents and DNA pond BR13 and BS13 in conjunction with random primer 0S13, and this polymorphism mark named be SP001, and X3 can disclose polymorphism between parents and DNA pond BR15 and BS15 in conjunction with random primer OA12, this polymorphism mark named be SP003, further analyze find mark SP001 and SP003 respectively in I of F2 colony and the II of F2 colony with disease-resistant susceptible be divided into from, shown in Fig. 3 A and Fig. 3 B.Among Fig. 3 A, M represents DNA Marker (DL-2000), and R represents disease-resistant individual plant, 1 expression ground paddy, and 2 expression BR13,3 expression Lijiang xintuanheigus, 4 expression BS13, * is difference band SP001; Among Fig. 3 B, M represents DNA Marker (DL-2000), and R represents disease-resistant individual plant, and S represents susceptible individual plant, and * * is difference band SP003.Also two molecule markers are positioned on the molecular genetic linkage figure at blast resistant gene Pi-d (t) 1 and Pi-d2 place by linkage mapping simultaneously.
Embodiment 5, the chain molecule marker more closely of exploitation disease-resistant gene
Utilize ground paddy and Lijiang xintuanheigu to make up the F of expansion for the parent
2Colony, and with this F
2Colony plants in the greenhouse, and in its one core phase of three leaves, ZB15 carries out spray inoculation with the rice blast physiological strain, and keeps 100% humidity and 25-28 ℃ culture environment, inoculates after 10 days F
2Individual plant resists susceptible evaluation.Obtain the susceptible especially significantly F of about 4000 strains
2Individual plant is to these F
2The blade of individual plant mixes by 5 strains builds pond extraction DNA, obtains about 800 susceptible DNA ponds, is used for Fine Mapping.With the molecule marker that is used among the embodiment 3 the Pi-d2 positioning analysis, and the sequences Design primer (being shown in Table 3) that provides according to CIDC's cara gene (http://btn.genomics.org.cn) and international genome plan (http://rgp.dna.affrc.go.jp), 800 susceptible DNA ponds are analyzed, be located between molecule marker CAPs1 and CAPs8, wherein molecule marker CAPs1 and CAPs8 and target gene have 1 and 3 exchanges respectively, and molecule marker CAPs2, dCAPs1, dCAPs2 then with target gene be divided into from, as shown in Figure 4.
Main primer and sequence that table 3 is used
| Molecule marker | Upstream 5 ' end | Downstream 3 ' end | Restriction enzyme |
| ??RM262 | ????CATTCCGTCTCGGCTCAACT | ????CAGAGCAAGGTGGCTTGC | |
| ??G45STS | ????TGGGATCAAAGTTGGCTATG | ????CGGAAACAGGGAAGCCTTTG | |
| ??RM3 | ????ACACTGTAGCGGCCACTG | ????CCTCCACTGCTCCACATCTT | |
| ??RM527 | ????GGCTCGATCTAGAAAATCCG | ????TTGCACAGGTTGCGATAGAG | |
| ??SP001 | ????X3：5’-GGNATGGGNGGNNTNGGNAA(A/G)ACNAC-3’ | ????OA12?5’-TCGGCGATAG-3’ | |
| ??SP003 | ????X3：5’-GGNATGGGNGGNNTNGGNAA(A/G)ACNAC-3’ | ????OS13?5’-GCACACCAAC-3’ | |
| ??CAPs1RF | ????5’TTCTAGAATACGTCCCATCAG?3’ | ????5’TCCAACAGAGGTTGCATCGT?3’ | ????HpaII |
| ??CAPs2RF | ????5’CTCCTCCACCGTCTTATCCA?3’ | ????5’AGGTGGAGAGAGAAGGATG?3’ | ????AluI |
| ??CAPs3RF | ????5’CCACTCGAGGAGTACACATC?3’ | ????5’TCTGAAGTAGAGGAGGAGG?3’ | ????HaeIII |
| ??CAPs4RF | ????5’ATGAATAGGAAGATGGGGTGAA?3’ | ????5’GTGAAGATGGGGACTGAGG?3’ | ????TagI |
| ??CAPs8RF | ????5’CCAACTGGCACGCTAACAAC?3’ | ????5’CCGAACCAAGAATGTACTCC?3’ | ????AluI |
| ??dCAPs1RF | ????5’ACTGCTCTTGTGTTGCTGTGT?3’ | ????5’ATGATAGCCAAAGTTGCGAG?3’ | ????Cac8I |
| ??dCAPs2RF | ????5’CCTTGGTAGTGATGGATTGA?3’ | ????5’TTGCAAACGAGCCGATGG?3’ | ????BalI |
Sequence table
<160>25
<210>1
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>1
cattccgtct?cggctcaact??????????????????????????????????????????????????20
<210>2
<211>18
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>2
cagagcaagg?tggcttgc????????????????????????????????????????????????????18
<210>3
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>3
tgggatcaaa?gttggctatg??????????????????????????????????????????????????20
<210>4
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>4
cggaaacagg?gaagcctt?tg?????????????????????????????????????????????????20
<210>5
<211>18
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>5
acactgtagc?ggccactg????????????????????????????????????????????????????18
<210>6
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>6
cctccactgc?tccacatctt??????????????????????????????????????????????????20
<210>7
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>7
ggctcgatct?agaaaatccg??????????????????????????????????????????????????20
<210>8
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>8
ttgcacaggt?tgcgatagag??????????????????????????????????????????????????20
<210>9
<211>26
<212>DNA
＜213〉artificial sequence
<220>
<221>misc-feature
<222>(3，9，12，13，15，18，24)
＜223〉n=a or g or c or t
<220>
<221>misc-feature
<222>(21)
＜223〉n=a or g
<400>9
ggnatgggng?gnntnggnaa?nacnac???????????????????????????????????????????26
<211>10
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>10
tcggcgatag?????????????????????????????????????????????????????????????10
<210>11
<211>10
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>11
gcacaccaac?????????????????????????????????????????????????????????????10
<210>12
<211>21
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>12
ttctagaata?cgtcccatca?g????????????????????????????????????????????????21
<210>13
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>13
tccaacagag?gttgcatcgt??????????????????????????????????????????????????20
<210>14
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>14
ctcctccacc?gtcttatcca??????????????????????????????????????????????????20
<210>15
<211>19
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>15
aggtggagag?agaaggatg???????????????????????????????????????????????????19
<210>16
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>16
ccactcgagg?agtacacatc??????????????????????????????????????????????????20
<210>17
<211>19
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>17
tctgaagtag?aggaggagg???????????????????????????????????????????????????19
<210>18
<211>22
<212>DNA
＜213〉artificial sequence
<400>18
atgaatagga?agatggggtg?aa???????????????????????????????????????????????22
<210>19
<211>19
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>19
gtgaagatgg?ggactgagg???????????????????????????????????????????????????19
<210>20
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>20
ccaactggca?cgctaacaac??????????????????????????????????????????????????20
<210>21
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>21
ccgaaccaag?aatgtactcc??????????????????????????????????????????????????20
<210>22
<211>21
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>22
actgctcttg?tgttgctgtg?t????????????????????????????????????????????????21
<210>23
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>23
atgatagcca?aagttgcgag??????????????????????????????????????????????????20
<210>24
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>24
ccttggtagt?gatggattga??????????????????????????????????????????????????20
<210>25
<211>18
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>25
ttgcaaacga?gccgatgg????????????????????????????????????????????????????18
Claims (7)
1, the molecule marker of blast resistant gene Pi-d2 is one of nucleotide sequence that amplification in rice total dna is come out with following primer: SEQ ID №: 1 and SEQ ID №: 2, SEQ ID №: 3 and SEQ ID №: 4, SEQ ID №: 5 and SEQ ID №: 6, SEQ ID №: 7 and SEQ ID №: 8, SEQ ID №: 9 and SEQ ID №: 10, SEQ ID №: 9 and SEQ ID №: 11, SEQ ID №: 12 and SEQ ID №: 13, SEQ ID №: 14 and SEQ ID №: 15, SEQ ID №: 16 and SEQ ID №: 17, SEQ ID №: 18 and SEQ ID №: 19, SEQ ID №: 20 and SEQ ID №: 21, SEQ ID №: 22 and SEQ ID №: 23, SEQ ID №: 24 and SEQ ID №: 25.
2, molecule marker according to claim 1 is characterized in that: described paddy rice is ground paddy.
3, the primer that obtains the molecule marker of blast resistant gene Pi-d2 is the SEQ ID № in the sequence table: 1 and SEQID №: 2, SEQ ID №: 3 and SEQ ID №: 4, SEQ ID №: 5 and SEQ ID №: 6, SEQ ID №: 7 and SEQ ID №: 8, SEQ ID №: 9 and SEQ ID №: 10, SEQ ID №: 9 and SEQ ID №: 11, SEQ ID №: 12 and SEQ ID №: 13, SEQ ID №: 14 and SEQ ID №: 15, SEQ ID №: 16 and SEQ ID №: 17, SEQ ID №: 18 and SEQ ID №: 19, SEQ ID №: 20 and SEQ ID №: 21, SEQ ID №: 22 and SEQ ID №: 23, SEQ ID №: 24 and SEQ ID №: 25.
4, the method for the molecule marker SP001 of a kind of acquisition blast resistant gene Pi-d (t) 1 is with the SEQ ID № in the sequence table: 9 and SEQ ID №: 10 nucleotides sequence is classified primer as, carries out that the Uneven pcr amplification obtains.
5, method according to claim 4 is characterized in that: described Uneven PCR program Uneven PCR program is as follows: 94 ℃ of pre-sex change 5 minutes; Then by 94 ℃ 30 seconds, 55 ℃ 1 minute, 72 ℃ 1 minute, 94 ℃ 15 seconds, 42 ℃ 1 minute, 72 ℃ were carried out 3 circulations in 1 minute, then by 94 ℃ 15 seconds, 57 ℃ 30 seconds, 72 ℃ 30 seconds, 94 ℃ 15 seconds, 42 ℃ 30 seconds, 72 ℃ were carried out 32 circulations in 30 seconds, extended 5 minutes at 72 ℃ again.
6, a kind of method that obtains the molecule marker SP003 of blast resistant gene Pi-d2 is with the SEQID № in the sequence table: 9 and SEQ ID №: 11 is primer, carries out the Uneven pcr amplification and obtains described molecule marker.
7, method according to claim 6 is characterized in that: described Uneven PCR program Uneven PCR program is as follows: 94 ℃ of pre-sex change 5 minutes; Then by 94 ℃ 30 seconds, 55 ℃ 1 minute, 72 ℃ 1 minute, 94 ℃ 15 seconds, 42 ℃ 1 minute, 72 ℃ were carried out 3 circulations in 1 minute, then by 94 ℃ 15 seconds, 57 ℃ 30 seconds, 72 ℃ 30 seconds, 94 ℃ 15 seconds, 42 ℃ 30 seconds, 72 ℃ were carried out 32 circulations in 30 seconds, extended 5 minutes at 72 ℃ again.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2003101184343A CN1306041C (en) | 2003-12-16 | 2003-12-16 | Molecular marker of rice blast resistance gene, its dedicated primer and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2003101184343A CN1306041C (en) | 2003-12-16 | 2003-12-16 | Molecular marker of rice blast resistance gene, its dedicated primer and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1629317A true CN1629317A (en) | 2005-06-22 |
| CN1306041C CN1306041C (en) | 2007-03-21 |
Family
ID=34843791
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2003101184343A Expired - Fee Related CN1306041C (en) | 2003-12-16 | 2003-12-16 | Molecular marker of rice blast resistance gene, its dedicated primer and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1306041C (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102146381A (en) * | 2011-01-18 | 2011-08-10 | 浙江师范大学 | Molecular marker for assisted breeding of Xanthomonas oryzae resistance gene Xa7 and application thereof |
| CN102154470A (en) * | 2011-01-17 | 2011-08-17 | 南京农业大学 | Molecular marker method for anti-rice blast gene Pi-hk1 (t) of paddy |
| CN103409417A (en) * | 2013-08-14 | 2013-11-27 | 浙江大学 | Rice blast resistance gene Pi-d2 functional molecular marker, exclusive primer sequence thereof, and application thereof |
| CN106755475A (en) * | 2017-01-17 | 2017-05-31 | 中国水稻研究所 | A kind of method of early 39 rice blast resistance genes in identification super early rice |
| CN107988337A (en) * | 2017-11-06 | 2018-05-04 | 云南省农业科学院生物技术与种质资源研究所 | A kind of labeling method and its application of rice blast resistant rice identification method and gene |
| CN109134633A (en) * | 2018-09-25 | 2019-01-04 | 四川农业大学 | Blast resisting albumen and gene, the nucleic acid of separation and its application |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2708613B1 (en) * | 1993-07-29 | 1996-04-05 | Nat Inst Agrobiologica | Nucleic acids markers for the rice rust resistance genes and rice rust resistance genes isolated by means of these markers. |
| US6333151B2 (en) * | 1993-07-29 | 2001-12-25 | Research Development Corporation Of Japan | Nucleic acid markers for rice blast resistance genes and rice blast resistance genes isolated by the use of these markers |
| JP2000125885A (en) * | 1998-08-21 | 2000-05-09 | Japan Science & Technology Corp | Gene resistant to rice blast and associated gene |
| JP3153889B2 (en) * | 1998-12-21 | 2001-04-09 | 農林水産省北海道農業試験場長 | Molecular markers that can indirectly identify rice blast resistance |
-
2003
- 2003-12-16 CN CNB2003101184343A patent/CN1306041C/en not_active Expired - Fee Related
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154470A (en) * | 2011-01-17 | 2011-08-17 | 南京农业大学 | Molecular marker method for anti-rice blast gene Pi-hk1 (t) of paddy |
| CN102154470B (en) * | 2011-01-17 | 2013-04-10 | 南京农业大学 | Molecular marker method for anti-rice blast gene Pi-hk1 (t) of paddy |
| CN102146381A (en) * | 2011-01-18 | 2011-08-10 | 浙江师范大学 | Molecular marker for assisted breeding of Xanthomonas oryzae resistance gene Xa7 and application thereof |
| CN102146381B (en) * | 2011-01-18 | 2012-08-15 | 浙江师范大学 | Molecular marker for assisted breeding of Xanthomonas oryzae resistance gene Xa7 and application thereof |
| CN103409417A (en) * | 2013-08-14 | 2013-11-27 | 浙江大学 | Rice blast resistance gene Pi-d2 functional molecular marker, exclusive primer sequence thereof, and application thereof |
| CN103409417B (en) * | 2013-08-14 | 2015-05-06 | 浙江大学 | Rice blast resistance gene Pi-d2 functional molecular marker, exclusive primer sequence thereof, and application thereof |
| CN106755475A (en) * | 2017-01-17 | 2017-05-31 | 中国水稻研究所 | A kind of method of early 39 rice blast resistance genes in identification super early rice |
| CN107988337A (en) * | 2017-11-06 | 2018-05-04 | 云南省农业科学院生物技术与种质资源研究所 | A kind of labeling method and its application of rice blast resistant rice identification method and gene |
| CN107988337B (en) * | 2017-11-06 | 2021-04-13 | 云南省农业科学院生物技术与种质资源研究所 | Identification method of rice blast resistance rice, gene marking method and application thereof |
| CN109134633A (en) * | 2018-09-25 | 2019-01-04 | 四川农业大学 | Blast resisting albumen and gene, the nucleic acid of separation and its application |
| CN109134633B (en) * | 2018-09-25 | 2020-10-09 | 四川农业大学 | Rice blast resistant protein and gene, isolated nucleic acid and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1306041C (en) | 2007-03-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100350043C (en) | Corn individual PV-IMGT 32 (NK 603) and composition and method for detecting it | |
| CN1816276A (en) | Method of producing double low restorer lines of brassica napus having a good agronomic value | |
| CN1206358C (en) | DNA sequence of a gene of hydroxy-phenyl pyruvate dioxygenase and production of plants containing a gene of hydroxy-phenyl pyruvate dioxygenase and which are tolerant to certain herbicides | |
| CN1201012C (en) | Alteration of flowering time in plants | |
| CN101037694A (en) | Gene for controlling paddy tillering and usage | |
| CN1844393A (en) | Resistance gene Pi37 against rice blast and use thereof | |
| CN1814787A (en) | Ramie micro-satellite DNA Label | |
| CN1831127A (en) | Key gene for controlling chlorophyll metabolism and method for establishing plant green residence character therewith | |
| CN1306041C (en) | Molecular marker of rice blast resistance gene, its dedicated primer and application thereof | |
| CN1844377A (en) | 9-cis epoxy carotinoid dioxygenase in Stylosanthes guianensis and genes encoding same and use thereof | |
| CN1247229A (en) | Paddy rice group of preventing rice blast | |
| CN101062944A (en) | Vegetable disease-resistant protein and its coding gene and application | |
| CN1840542A (en) | Rice tillering related protein, genes encoding same, and use thereof | |
| CN1297661C (en) | A rice blast resistance gene, its encoded protein and use thereof | |
| CN1944677A (en) | SCAR marking method for identifying Chinese cabbage variety and detecting seed purity | |
| CN1908171A (en) | Amylose content control gene DU1 of rice endosperm and application thereof | |
| CN101041852A (en) | Method for building-up SSR finger-print code of wheat breed | |
| CN1814760A (en) | Rice antiviral related gene OsDR8 | |
| CN100351380C (en) | APDHI sequence of DNA unwindase gene of kender and its clone and applciation thereof | |
| CN1262654C (en) | Corn height related gene and coding protein and uses | |
| CN1291020C (en) | Wheat TaGI1 gene and its cloning and use | |
| CN1709908A (en) | Tomato RNA virus host factor and its coding gene and use thereof | |
| CN1869232A (en) | Paddy rice hybrid fertility gene and its application | |
| CN101050232A (en) | Pi15 resistance gene of rice blast, and application | |
| CN1284855C (en) | Betaine aldehyde dehydrogenase gene and its encoded protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20070321 Termination date: 20141216 |
|
| EXPY | Termination of patent right or utility model |