CN1629285A - Natural killer cell for transgenic expression cell chemotactic factors - Google Patents

Abstract

The invention provides a natural killer cell for transgenic expression cell chemotactic factors, which is the chemotactic factor expressing specific functions of human body tissue organs, chemotactic factor receptor bonder or CCR10, comprising the ligand chemotactic factor of the chemotactic factor receptor CXCR4, ligand chemotactic factor of CCR6, ligand chemotactic factor of CCR7, ligand chemotactic factor of CCR10, genes and protein sequence represented by sequence 1 and homologues and modification substance. The invention also provides the application of the cell strain in preparing medicament for treating tumor, virus or bacterial infection and autoimmune diseases, and its preparing process.

Description

The natural killer cell of transgene expression cell chemotactic factor

One, technical field

The present invention relates to the natural killer cell of transgene expression cell chemotactic factor, with and its production and application.

Two, background technology

Malignant tumour is still the highest disease of China's mortality ratio so far.In case the tumour diffusion transfer, excision no matter, chemotherapy or radiotherapy all can't thoroughly be eradicated intravital tumour.Shift the final pernicious growth of tumour of diffusion, cause death.So far also there is not really can prevent and treat the way of metastases.On the one hand because above-mentioned these therapies all are subjected to the restriction of condition and dosage.The side effect that excessive radiotherapy or chemotherapy cause can't be born patient, even dead.On the other hand, many tumours are constantly sudden change in therapeutic process, causes it insensitive to medicine and ray.Discover that the tumour cell of the anti-ray of these anti-medicines is mostly to the immunotherapy sensitivity, especially natural killer (NK) cell and T lymph killer cell (cytotoxic T-cell) sensitivity to having the natural killer function can be removed by killer cell.So immunotherapy should be that chemotherapy and radiocurable good replacement therapy reach the purpose that prevents to spread and thoroughly eradicate tumour with prestige to operation.Thereby we are sought after setting up the method that a kind of effective feasible cellular immunization is treated.

On the other hand, we also are sought after a kind of to virus infection and the effective feasible cellular immunization methods of treatment of intracellular bacterial infection.Because do not have the ideal methods of treatment so far in the world for virus infection.Most of viruses, analogy simplexvirus (HERPES), cytomegalovirus (CMV), Epstein-Barr virus (EBV), virus of AIDS (HIV), or the like, though the disease that causes for healthy people all compares gentle, often cause serious harm for people and these viruses of the elderly of immunologic hypofunction, analogy CMV can cause immunologic hypofunction as aids patient, the severe infections of transplant patient is to cause dead major reason.And other is viral as sars coronavirus, virus of AIDS, and west nile virus just can be caused serious threat to everyone.The difficulty of treatment virus is that virus is symbiotic with host cell.How to remove virus infected cell specifically, and do not injure the key that normal cell is an effectively control virus.Discover that natural killer cell can be recognized and kill virus infected cell is special, be suitable for carrying out the virus immunity treatment.

In addition, intracellular bacterial infection causes very big puzzlement to treatment, such as, the tubercule bacillus main parasitic is in monocyte, and the cell of infection forms Nang Bao in lung, makes antibiotic can't enter cell performance bactericidal effect.Discover that natural killer cell can kill and wound the mycobacterium tuberculosis infection cell that wraps in the capsule bag specifically.

The rejection of allosome tissue's organ transplantation discovers that the allosome natural killer cell has the immunoreactive function of the anti-autologous tissue of elimination.Can be used for preventing being ostracised of histoorgan, and graft versus host disease (GVH disease), or alleviate the autoimmune disease symptom.

Many tumours cause the interior specific immune system of body to be beyond recognition owing to not expressing or seldom expressing MHC, cause T-lymph killer cell not play a role, thereby escape the immunity monitoring.Because natural killer cell is not subjected to histocompatibility antigen (MHC) restriction, can non-ly recognize the also cell of killing tumor cells, virus and infectation of bacteria specifically, obviously natural killer cell is the ideal treatment means.Problem is that the content of the intravital natural killer cell of people is considerably less, only accounts for 4% of blood of human body total white blood cells, and people are being devoted to find the way of energy mass production natural killer cell always for a long time.Can accomplish at present to turn out natural killer cell from human stem cell, because clinical application needs a large amount of cells, the application of this method has certain limitation.People also attempt utilizing the cell strain with natural killer cell function of allosome at present, analogy NK-92, and TALL-104 etc. treat above-mentioned disease.The advantage of these cell strains is not limited by MHC, has very strong killing ability, can obtain a large amount of cells fast by vitro culture, to satisfy the needs of large quantities of clinical applications.Have only very a spot of cell strain to enter blood circulation after yet the biggest problem of this methods of treatment is injected exactly, all the other most of cell strains all can not reach the position of morbidity, and disappear to organs such as spleen positions.The position that how to make more killer strain reach morbidity is a problem demanding prompt solution, because this not only is related to result of treatment, also is to reduce the key for the treatment of the side effect that causes.

Three, summary of the invention

Main purpose of the present invention is to overcome the cellular immunization methods of treatment of being developed at present and has only very a spot of cell strain to enter blood circulation after injection, all the other most of cell strains all can not reach the position of morbidity, and disappear to the shortcoming of organs such as spleen, and provide a kind of natural killer cell of transgene expression cell chemotactic factor, it changes the special chemokine of human tissue organ over to for the natural killer cell strain, Chemokine Receptors binding substances or CCR10, can reach this cell strain of minimizing loses, improve the effect of bioavailability in the killer cell body, make more killer strain reach the position of morbidity, promptly improve the quantity that reaches efficient part, thereby effectively improve result of treatment, reduce the side effect that treatment causes, solve the key issue of clinical application at all.

The objective of the invention is (i.e. invention mainly comprises following content) by following technical scheme realization:

One of main contents of the present invention are the natural killer cells of transgene expression cell chemotactic factor, it is characterized in that, it reduces when using in vivo and loses for expressing special chemokine, Chemokine Receptors binding substances or the CCR10 of human tissue organ, improves this cell bioavailability in vivo; Special chemokine, Chemokine Receptors binding substances or the CCR10 of described human tissue organ is that natural killer cell itself is not expressed or seldom expressed.

The natural killer cell of aforesaid transgene expression cell chemotactic factor is wherein expressed homologue and modifier that the special chemokine of human tissue organ, Chemokine Receptors binding substances or CCR10 comprise the gene shown in the sequence 1 and protein sequence and these sequences thereof.

The natural killer cell of aforesaid transgene expression cell chemotactic factor is wherein expressed special chemokine of human tissue organ and Chemokine Receptors binding substances and is comprised: the part chemokine of Chemokine Receptors CXCR4; The part chemokine of CCR6; The part chemokine of CCR7; The part chemokine of CCR10 and CCR10; Special chemokine, Chemokine Receptors binding substances or the CCR10 of human tissue organ of described institute is that natural killer cell itself is not expressed or seldom expressed.

The natural killer cell of aforesaid transgene expression cell chemotactic factor, the cell of wherein expressing chemokine is meant the human natural killer cell that comprises NK-92, TALL-104, these cell surfaces have the CD56 molecule, and have the natural killer function.

The natural killer cell of aforesaid transgene expression cell chemotactic factor, wherein the part chemokine of CXCR4 comprise SDF-1 with CXCR4 bonded protein; The part chemokine of CCR6 comprise MIP-3 α with CCR6 bonded protein; The part chemokine of CCR7 comprises SLC, and ELC is at interior and CCR7 bonded protein; The part chemokine of CCR10 comprise CCL27 and CCL28 with CCR10 bonded protein.

The natural killer cell of aforesaid transgene expression cell chemotactic factor reduces when using in vivo and loses, and improves this cell bioavailability in vivo; The natural killer cell injection back of transgene expression Chemokine Receptors of the present invention or its part arrives the quantity and the increase to some extent of comparing without the initiating cell of genetic modification of body inner blood or other diseased region.

Purpose of the present invention also can be achieved through the following technical solutions:

The application of the natural killer cell of another to the effect that aforesaid transgene expression chemokine of the present invention in preparation treatment tumour, virus and infectation of bacteria, tissue transplantation repulsion, autoimmune disease medicine; Wherein said medicine is meant that the natural killer cell strain of expressing aforesaid Chemokine Receptors or its part chemokine can be by separately or the medicine for preparing with other composition, or and other medicines, form medicine and the technology of jointly patient being used such as antibiotic, antitumor drug, radiotherapy etc.

In addition, purpose of the present invention also can further be achieved through the following technical solutions:

The present invention is the preparation method of the natural killer cell of a to the effect that aforesaid transgene expression cell chemotactic factor again, it is characterized in that, comprises the foundation of (1) seed cell; (2) enlarged culturing of cell; (3) pair cell is identified; (4) the pair cell strain suppresses fissional processing; (5) packing of pair cell product and processing.

Again, purpose of the present invention can further be achieved through the following technical solutions:

The present invention's other somatocyte beyond the natural killer cell of transgene expression cell chemotactic factor, it is characterized in that, it is for expressing the special chemokine of human tissue organ, the somatocyte of Chemokine Receptors binding substances or CCR10, when using this somatocyte in vivo, this somatocyte is lost few, bioavailability height in vivo; Chemokine wherein and Chemokine Receptors binding substances comprise the part chemokine of Chemokine Receptors CXCR4, the part chemokine of CCR6, the part chemokine of CCR7, the part chemokine of CCR10 and CCR10; The part chemokine of CXCR4 be meant comprise SDF-1 with CXCR4 bonded protein; The part chemokine of CCR6 be meant comprise MIP-3 α with CCR6 bonded protein; The part chemokine of CCR7 be meant comprise SLC and ELC with CCR7 bonded protein; The part chemokine of CCR10 be meant comprise CCL27, CCL28 with CCR10 bonded protein; Describedly comprise gene shown in the sequence 1 and protein sequence, and the homologue of these sequences and modifier; Other somatocyte beyond the described killer cell is meant in input cell mode treats used everyone somatocyte, comprises bone marrow stem cell, by the various blood leucocytes that bone marrow stem cell is divided in vitro culture, islet cells.

The present invention's other somatic application beyond the killer cell of transgene expression cell chemotactic factor, it is characterized in that, this transgenosis cell strain can be used for preparation and removes tumour, virus and infectation of bacteria, tissue transplantation is repelled, the product of autoimmune disease, medicine or contain the product mixture of above-mentioned genetically modified cell strain.

The preparation method of other human body cell of the present invention beyond the killer cell of transgene expression cell chemotactic factor is characterized in that it comprises the foundation of (1) seed cell; (2) enlarged culturing of cell; (3) pair cell is identified; (4) the pair cell strain suppresses fissional processing; (5) packing of pair cell product and processing.

The invention has the beneficial effects as follows: the present invention is by changing the special chemokine of aforesaid human tissue organ, Chemokine Receptors binding substances or CCR10 over to above-mentioned natural killer cell strain, thereby with compare without the initiating cell strain of transforming, this cell strain has reduced losing when using in vivo by the excretory chemokine, increase the natural killer cell strain that arrives efficient part and reached quantity, solved the difficult problem that existing cellular immunization therapy can not reach therapentic part effectively, increase has improved the effect of treatment to the probability of killing and wounding of target cell.

Four, description of drawings

Figure 1A produces secretion SDF-1 synoptic diagram for the natural killer cell strain of transgene expression chemokine gene of the present invention.

Figure 1B produces secretion ELC synoptic diagram for the natural killer cell strain of transgene expression chemokine gene of the present invention.

Fig. 2 relatively changes natural killer cell strain of SDF-1 gene and primitive nature killer cell growth curve synoptic diagram for the present invention.

Fig. 3 A divides for the chemokine natural killer cell that radiation exposure of the present invention stops expressing, but does not suppress the synoptic diagram that cell produces the secretion chemokine.

Fig. 3 B uses the synoptic diagram of ELISA method mensuration figure irradiation or non-irradiated transgenosis and original NK-92 cell strain secretion ELC for the present invention.

Fig. 4 A induces the directed mobile synoptic diagram of target cell CEM-M3 for the secretory product of the natural killer cell of transgene expression chemokine gene of the present invention.

Fig. 4 B induces the directed mobile synoptic diagram of target cell Hut78 for the secretory product of the natural killer cell of transgene expression chemokine gene of the present invention.

Fig. 5 compares synoptic diagram to lymphoma CEM-M3 cell killing ability in vivo for natural killer cell strain and the primitive nature killer strain that the present invention changes the SDF-1 gene.

Fig. 6 transduces the natural killer cell strain of ELC gene and primitive nature killer strain to breast cancer cell T47 kill capability synoptic diagram relatively for the present invention.

Fig. 7 transduces the NK-92 cell strain of SDF-1 gene and original NK-92 cell strain to the viral diffusibility that suppresses simplexvirus HSV-1 cells infected synoptic diagram relatively for the present invention.

Fig. 8 A is the distribution schematic diagram of original killer strain each organ in the mouse body.

Fig. 8 B is the distribution schematic diagram of killer strain TALL-104 each organ in the mouse body of commentaries on classics SDF-1 gene after injecting or commentaries on classics SDF-1P2G.

Fig. 9 A is commentaries on classics SDF-1 gene after the present invention relatively injects or natural killer cell strain and the primitive nature killer strain distribution schematic diagram in mouse spleen that changes SDF-1P2G.

Fig. 9 B is commentaries on classics SDF-1 gene after the present invention relatively injects or natural killer cell strain and the primitive nature killer strain distribution schematic diagram in mouse blood that changes SDF-1P2G.

Figure 10 for the present invention relatively change the natural killer cell strain of SDF-1 or SDF-1P2G gene and primitive nature killer strain in the mouse body to accumulated number synoptic diagram in the mammary cancer T47 solid tumor.

Figure 11 compares synoptic diagram to the restraining effect of lymphocytoma CEM-M3 cell growth for natural killer cell strain and the primitive nature killer strain that the present invention changes SDF-1 or SDF-1P2G gene in the mouse body.

Figure 12 compares synoptic diagram to the restraining effect of mammary cancer T47 solid tumor growth for natural killer cell strain and the primitive nature killer strain that the present invention changes the ELC gene in the mouse body.

Figure 13 changes the monocyte and the primitive nature killer strain distribution schematic diagram in mouse blood that are induced by mouse stem cells of SDF-1 gene for the present invention.

Five, detailed content of the present invention and embodiment

The definite definition of some terms of using among the present invention:

1, MHC: promptly main histocompatibility complex is that gene constitutes by kind, has diversity and polymorphism.The MHC diversity shows between individuality and the population, is divided into I type and II type; Human body MHC is also referred to as HLA; MHC plays key effect to the functions such as immunne response of animal, and such as only competence exertion effect when MHC matches of human T lymphocyte, in other words the function of T cell is subjected to the MHC constraint.

2, natural killer cell: natural killer (NK) cell, NK cell characteristic are that the surface has the CD56 molecule; Its target cell of NK cell killing is not limited by MHC, does not need antigenic stimulation yet, does not rely on antibody, belongs to natural killer, and is swift in response; The target cell of NK cell has tumour cell, virus infected cell, parasite etc.; The NK cell is playing a key role aspect opposing infection and the tumour.

3, somatocyte: the somatocyte described in the present invention is meant treat used everyone somatocyte for the input cell, comprises bone marrow stem cell, by the various blood leucocytes that bone marrow stem cell is divided in vitro culture, islet cells etc.

4, cell chemotactic factor: be the protein that a class has the directed migration of target cell in the special inductor in the body.Co-exist in about 50 kinds of chemokines in the human body, induce different target cells to move respectively.The target cell of chemokine mainly is various blood leucocytes.Chemokine is divided into according to its chemical structure and is CC, CXC, and four families of XC1 and CX3C, concrete name sees Table 1.At the be otherwise known as part chemokine of this receptor of the chemokine of a certain acceptor.The part of the Chemokine Receptors described in the present invention or part chemokine be meant can with the chemokine and the protein of this receptor specific combination.Chemokine that some human organ or tissue expression are special or Chemokine Receptors are expressed CLL27 and CCL28 such as people's skin, and people's marrow is expressed SDF-1.

5, the acceptor of cell chemotactic factor: the cell chemotactic factor effect be by its in the relation of the special acceptor on the target cell membrane between it just as key and lock.Chemokine causes moving of target cell by combining receptor activation with receptor-specific.Chemokine and acceptor have diversity, and both same acceptor can combine with more than one chemokine.The acceptor of various chemokines sees Table 1.

6, cellular immunization treatment: the cellular immunization treatment is one of immunotherapy method.This method increases patient's immunological competence by import various blood leucocytes to patient by these cells.What the cell of input was common has natural killer cell, a T lymphocyte etc.The cell that is used for immunotherapy can be patient's itself (confession), increases through vitro culture; Also can be from other people (donor); Attempt in recent years carrying out immunotherapy with tumor cell line with unique function.The cellular immunization treatment is mainly used in diseases such as tumour and virus infection.

7, the transformation period in the medicine body: medicine is reduced to the required time of a half of predose in vivo in the blood, and the transformation period, long more medicine effective concentration was held time of a specified duration more.

8, autoimmune disease: produce immune response for human body self tissue or organ, thereby cause the infringement of tissue or organ structure and function.Sacroiliitis for example, multiple hard flesh disease, diseases such as lupus erythematosus.

9, bioavailability: the quantity that medicine can reach in the blood circulation in vivo after the medication and the proportionlity of administration total amount.Bioavailability is to weigh medicine can effectively distribute with the index that plays a role in vivo.Bioavailability of the present invention is meant after the killer cell injection in vivo in the blood or other diseased region quantity that can reach and the proportionlity of injecting total amount.

The summary of technical solution of the present invention: the present invention is realized by following major technique step: (1) aforesaid Chemokine Receptors of clone and part chemokine gene (2) thereof make up the expression vector of aforesaid Chemokine Receptors and part chemokine gene thereof; (3) above-mentioned chemokine gene carrier transduction is expressed in the natural killer cell strain, and select stable expression cell strain; (4) collecting cell strain culture supernatant detects and expresses the chemokine activity; (5) produce the genetically modified natural killer cell strain of preparation; (6) genetically modified natural killer cell strain is proved that to genetically modified natural killer cell strain it is to the treatment of diseases effect in the external function mensuration (7) of doing in animal body.

Relevant detailed content of the present invention:

Existing cellular immunization treatment technology has only very a spot of cell strain to enter blood circulation after injection cell is in the body, and all the other most of cell strains all can not reach the position of morbidity, and disappear to spleen kidney and other organs.

The present invention has reached the human natural killer cell that a kind of minimizing is used for the treatment of and has lost in vivo, improve this cell purpose of bioavailability in vivo, thereby can make more killer strain reach the position of morbidity, and result of treatment is not only improved at the position that can make more killer strains reach morbidity, also is to reduce the key for the treatment of the side effect that causes.

In brief, the present invention includes a kind of natural killer cell or other human body cell of transgene expression cell chemotactic factor, it is for expressing the special chemokine of human tissue organ, Chemokine Receptors binding substances or CCR10.Special chemokine, Chemokine Receptors binding substances or the CCR10 of described human tissue organ is that natural killer cell itself is not expressed or seldom expressed.Present invention includes the method for how these killer strains being carried out genetic modification; Comprise the Chemokine Receptors that these change killer cell over to and the gene and the protein sequence of part chemokine thereof; Compare to have to reduce when using in vivo and lose, improve this cell feature of bioavailability in vivo without this transgenosis cell strain of initiating cell strain of transforming; The present invention has also comprised and has above-mentionedly expressed aforesaid chemokine, the preparation method of the killer strain of Chemokine Receptors binding substances or CCR10, measuring method through genetic modification; And several contents that contain the pharmaceutical composition or the product of these cell strains.Wherein said product is to be used for the treatment of tumour, virus infection and special infectation of bacteria, the medicine of diseases such as autoimmune disease or product composition.

The cellular immunization treatment technology.Wherein be used for genetically modified cell and mainly be meant natural killer (naturalkiller is called for short NK) cell.The feature of natural killer cell is that cell surface has specific molecule CD56, and has the function of natural killer target cell.The function of wherein said natural killer target cell is meant that identification and the process of killing and wounding target cell are not limited by MHC, does not also need antigenic stimulation, does not rely on antibody, is swift in response, and belongs to natural killer.Natural killer cell can separate from blood of human body and obtains, can obtain through the specific culture technology external from human stem cell, comprise that also the human natural killer cell strain of setting up (includes but not limited to NK-92 from people's natural killer cell tumour, the TALL-104 cell strain), as long as these cells possess the scope that the feature of above-mentioned natural killer function all belongs to the natural killer cell of indication of the present invention.

The present invention not only is fit to utilize the product or the medicine of the cellular immunization treatment of natural killer cell, also is fit to utilize the product or the medicine of the cell therapy of other various immunocytes.By utilizing genetic modification technology provided by the invention to make these cell expressing Chemokine Receptors and parts thereof, thereby improve this cell bioavailability in vivo.

Mention Chemokine Receptors or its part chemokine among the present invention, it defines widely sees " the definite definition of some terms of using among the present invention ".Concise and to the point chemokine is meant that the interior class of body has the protein of the directed migration of target cell in the special inductor.Chemokine is by combining with its receptor-specific on the target cell surface, and activated receptor, causes moving of target cell.At the be otherwise known as gamete chemokine of this receptor of the chemokine of a certain acceptor.Chemokine and acceptor have diversity, and same acceptor can combine with more than one chemokine.The acceptor of various chemokines sees Table 1.Co-exist in about 50 kinds of chemokines in the human body, induce different target cells to move respectively.The target cell of chemokine mainly is various blood leucocytes.Chemokine is divided into according to its chemical structure and is CC, CXC, four families of XC1 and CX3C.Concrete name sees Table 1.

Chemokine that the human tissue organ that the present invention refers to is special and Chemokine Receptors binding substances, all be that natural killer cell itself is not expressed or seldom expressed, mainly include but not limited to the part chemokine of Chemokine Receptors CXCR4, the part chemokine of CCR6, the part chemokine of CCR7, the part chemokine of CCR10 and CCR10.Wherein the part chemokine of CXCR4 be meant comprise SDF-1 with CXCR4 bonded protein; The part chemokine of CCR6 be meant comprise MIP-3 with CCR6 bonded protein; The part chemokine of CCR7 be meant comprise SLC and ELC with CCR7 bonded protein; The part chemokine of CCR10 be meant comprise CCL27 and CCL28 with CCR10 bonded protein.The part chemokine of wherein said Chemokine Receptors is meant the protein or the compound of those and Chemokine Receptors specific combination, comprises gene shown in the annex 1 and protein sequence, and the homologue of these sequences and modifier.

About the homologue and the modifier of above-mentioned Chemokine Receptors or its part chemokine, following various change and modifications to the patent thing should be included within the present invention.Basically is if be to strengthen treatment or prophylactic effect in order to reach to the change of above-mentioned patent thing and modification; Or stability (to the defensive ability/resistance ability of body endoproteinase) in order to improve product; Or the modification that patent protein is done in the synthetic back of pirate recordings, as change saccharification or phosphorylation composition, as long as the product that is derived by these variations remains with the principal character of this patent thing, that is expressed protein has one of Chemokine Receptors or part chemokine function, both should be included within the present invention.

This modification comprises to be passed through to replace to the amino acid of patent thing or their nucleotide sequence, and increase or brachymemma come change, but the product that changes still keeps the principal character of patent thing.Can be replaced by Isoleucine or a word used in person's names propylhomoserin such as leucine, (or between basic aminoacids, between the neutral amino acids, between the polare Aminosaeren or between the nonpolar amino acid, between the aromatic amino acid) or the like can replace mutually between the acidic amino acid.It is generally acknowledged, to have one of Chemokine Receptors or ligand function simultaneously, just should belong within the scope of the invention as long as the product after changing has 80% or above identical with the sequence of various chemokines of the present invention or its acceptor.

In addition, patent thing protein or their nucleotide sequence also can add other compound and keep the principal character of patent thing, as alkali, thereby increase its solubility on its pendant chemical groups; Or isotropic substance, as cobalt 60, iodine 125, sulphur 35 or the like, or fluorescence reaching in the effect (biological missile) that kills and wounds target cell or the body tracer action to target cell (as tumour cell), thereby heighten the effect of a treatment or are applied to in-vivo diagnostic.In addition, patent thing protein or their nucleotide sequence also can with the protein or the chimeric hybridization of their nucleotide sequence of other function, as the toxin fragment, to reach the effect that kills and wounds target cell.These all are the methods that the reservation patent owner of widespread wants feature.

Present invention includes the method for how these killer strains being carried out genetic modification.Realized by following major technique step: (1) comes out the gene fragment clone of Chemokine Receptors and chemokine; (2) make up the special Chemokine Receptors or the expression vector of its part chemokine gene; (3) the said gene carrier is put in the killer strain expresses, and select stable expression cell strain; (4) collecting cell strain culture supernatant detects the activity of expressing chemokine or acceptor; (5) produce the genetically modified killer strain of preparation; (6) genetically modified killer strain is measured in the external function of doing.

The gene fragment of Chemokine Receptors and chemokine can be according to the synthetic corresponding nucleic acids primer of the paper of having delivered, and the initiating terminal of primer can add the sequence at restriction enzyme point of contact as required.Object lesson is as implementing case 1 described preparation SDF-1 and SDF-1P2G.Utilize the RT-PCR method to clone out earlier by the nucleic acid library of human body the gene fragment of selected Chemokine Receptors or chemokine with this primer.Its concrete operation method as the molecular biology ordinary method.The Chemokine Receptors that the clone comes out or the gene fragment of chemokine are received in the expression vector by the restriction enzyme point of contact, thereby are built into the expression vector of Chemokine Receptors and ligand gene thereof.Specifically can be with reference to case study on implementation 1 of the present invention.The chemokine of other that the present invention mentions or acceptor CCR10 can prepare with the similar method of SDF-1 in the case study on implementation 1, and difference only is to replace the used primer of preparation SDF-1 with different primers.The Chemokine Receptors binding substances of other that the present invention mentions, as ELC (8-77) etc., can with the similar method preparation of SDF-1P2G in the case study on implementation 1, difference only is to replace with different primers and prepares the used primer of SDF-1P2G.

Relevant wherein said expression vector.Expression vector can utilize plasmid vector, the pcDNA3.1 mammalian expression vector (Invitrogen) shown in embodiment 1, also virus vector (embodiment 13), or other general carrier.In order to screen conveniently, carrier also can be put into the impedance gene at different antibiotic, such as the gene of the anti-Neomycin that utilizes herein.Expression vector dna can be put in the natural killer cell strain by methods such as electric shocks after linearizing and express, and selects stable expression cell strain.The screening stable expression cell strain can pass through the insensitivity of the expression vector of screening cell to antibiotic, such as anti-Neomycin, or measures its excretory genetically modified Chemokine Receptors of institute and ligand activity thereof.Concrete grammar can adopt document Gong JH.et al, J.Biol.Chem.1996, and 271:10521-10527 is described.

The invention provides the active method of chemokine of expressing that detects.Can be identified by following experimental technique: measure itself and chemokine or Chemokine Receptors binding ability.Measuring method can utilize the part chemokine in conjunction with the competitive assay method.This method at first uses isotropic substance (such as iodine selected chemokine ¹²⁵) or other reagent mark in addition.Then that the tagged ligand chemokine of fixed amount and the transgenic cell of different amounts is expressed albumen is incubated with being subjected to somatic target cell together.This receptor target cell surface has the Chemokine Receptors that will detect.If expressing protein to be measured and this receptors bind, then isotope-labeled part chemokine is subjected to this proteic competition, must reduce with the receptors bind amount.Whether can identify genetically modified Chemokine Receptors or part chemokine has thus obtained expressing in the natural killer cell strain.Another method is to utilize to identify at the monoclonal antibody of selecting chemokine or Chemokine Receptors.Concrete grammar can be identified the method for antigen-antibody binding reaction with conventional integrated enzyme reaction (ELISA) method or FAX analytical procedure etc.In addition, also can by chemokine induce target cell move or target cell in function such as calcium ionic current variation identify the chemokine or the Chemokine Receptors of expression.The concrete grammar of above-mentioned experiment such as document Gong JH.et al, J.Biol.Chem.1996,271:10521-10527 is described.

Relevant of the present invention through transgenosis and the natural killer cell of express cell chemokine, reduce when using in vivo and lose, improve this cell bioavailability in vivo.The natural killer cell injection back that it is characterized in that expression Chemokine Receptors of the present invention or its part arrives the initiating cell that the quantity of body inner blood or other diseased region compares without genetic modification to be increased to some extent.Because the natural killer cell distribution situation in vivo of transduction different chemokines and acceptor gene thereof is different, utilize these characteristics can be according to the different sites of morbidity transduce different chemokines and Chemokine Receptors gene with being allowed a choice.

The present invention includes the killer strain preparation that utilizes aforementioned transduction chemokine gene and be used for the treatment of tumour, virus infection, infectation of bacteria, the pharmaceutical composition of autoimmune disease or product.Wherein said tumour can be any one tumour; Wherein said virus is meant various to human body cause illness's virus, includes but not limited to simplexvirus (HERPES), cytomegalovirus (CMV), Epstein-Barr virus (EBV), virus of AIDS (HIV), sars coronavirus (Corona virus), west nile virus or the like; Wherein bacterium mainly refers to bacterial infection in the various cells, includes but not limited to tubercule bacillus etc.; Wherein autoimmune disease comprises various because health autologous tissue is produced disease and the graft-rejection that immune response caused.Wherein said pharmaceutical composition or product are meant the pharmaceutical composition or the product of the natural killer cell strain that contains aforesaid any chemokine or Chemokine Receptors.Wherein said killer strain of expressing aforesaid chemokine or Chemokine Receptors through transgenosis can be by separately or with other composition preparing product or medicine, or and other medicines, such as antibiotic, antitumor drug, or radiotherapy etc. is formed product and the technology of jointly patient being used.

The invention provides and produce that preparation is aforementioned expresses the special chemokine of aforementioned human tissue organ, the pharmaceutical composition of the killer strain of Chemokine Receptors binding substances or CCR10 or the method for product through transgenosis.It is characterized in that utilizing the method for cell culture technology to prepare and produce.Major technique comprises the enlarged culturing of foundation (2) cell strain of (1) seed cell strain; (3) set up the standard of perfection and the method for pair cell strain; (4) special processing of pair cell strain, i.e. pair cell strain suppresses fissional processing, comprises that the radioactive rays of pair cell strain are handled; (5) packing of pair cell strain product and processing.The foundation of wherein above-mentioned (1) genetically modified seed natural killer cell strain comprises the evaluation to transgenic cell, identifies this cell is had or not any bacterium or virus infection, to determine that this cell strain can be used for clinical trial.Be given in the recipient's body in order to ensure aforesaid natural killer cell strain and can not grow into tumour, aforementioned genetically modified natural killer cell strain can be used radiation exposure, and medicine or other method suppress its merisis to reach.Radiating irradiation can be with the instrument of various dissimilar gamma rays.The enlarged culturing of aforementioned genetically modified natural killer cell strain can be with general cell culture processes.Utilize the fermentor cultivation of Tissue Culture Flask or automatic control such as (but being not limited to).

Present invention includes for aforementioned and express the special chemokine of human tissue organ through transgenosis, the pharmaceutical composition of the natural killer cell strain of Chemokine Receptors binding substances or CCR10 or the standard of perfection and the method for product: detect genetically modified natural killer cell strain cell-surface antigens feature, i.e. the CD56 positive; Detect the protein expression of transducible gene, promptly detect Chemokine Receptors or its part chemokine that secretion is transduceed.Detection method comprises ELISA as previously mentioned, combines experiment etc. with Chemokine Receptors.

Embodiment 1: the chemokine SDF-1 gene fragment of human cloning and the SDF-1P2G gene fragment of being transformed by SDF-1 also make up above-mentioned segmental expression vector.

Prepare RNA. from the human vascular endothelial tissue by the Trizol method and mRNA is transformed into the cDNA storehouse by the reverse transcription biochemical reaction.It is as follows to design one group of primer: 5 ' primer, 5 ' TTGCTAGCTCCACCATGAACGCCAAGGTC and 3 ' primer, 5 ' TACAAGCTTGCCATCTTGAACCTCTTGTTTAA.Utilize this method acquisition to comprise the cDNA of the chemokine SDF-1 of leader.The cDNA of SDF-1 is cloned in the plasmid vector analogy PCR2.1 carrier (INVITROGEN).In order to obtain the nucleotide sequence of SDF-1P2G, utilize the transgenation method, the genetic modification of SDF-1 is become sequence ND.2, that is SDF-1P2G.Then, respectively above-mentioned SDF-1 is received in the carrier of expression by the Restriction Enzyme point of contact with the SDF-1P2G gene fragment that is transformed into.That suppose usefulness here is pCR3.1 carrier (INVITROGEN), and CMV is a promotor in this carrier, and EU is an enhanser, and the neomycin insensitive gene is the screening sign.

The chemokine of other that the present invention mentions or acceptor CCR10 can prepare with the similar method of SDF-1 in the case study on implementation 1, and difference only is to replace the used primer of preparation SDF-1 with different primers.

The Chemokine Receptors binding substances of other that the present invention mentions, as ELC (8-77) etc., can with the similar method preparation of SDF-1P2G in the case study on implementation 1, difference only is to replace with different primers and prepares the used primer of SDF-1P2G.

Embodiment 2: chemokine SDF-1 and natural killer cell strain of ELC gene transfer and expression thereof.

Concrete grammar is as follows: with the chemokine gene carrier that connects, after the DNA of SDF-1-pcDNA3.1 and ELC-pcDNA3.1 plasmid vector utilizes the restriction enzyme linearizing, change in the natural killer cell strain NK92 cell with electric shocking method: prepare 1 * 10 ⁷The NK-92 cell is suspended in the solution that the AMEXA of 10 microlitre phosphoric acid buffers and 90 microlitres provides.Add 5 micrograms DNA and and cytomixis.Utilize the electricity of AMEXA to utilize electric shocking method to change in the NK-92 cell carrier DNA towards instrument.After being incubated 10 minutes, 37 degree change CO over to ₂Incubator was cultivated 4 hours.Because carrier has the gene of anti-Gentamycin, so sieve the expression of carrier with Gentamycin.Through the screening with Gentamycin (4 mg/ml) 4 weeks, most necrocytosiss have only the only a few cell survival. obtain stable expression cell strain therefrom.With the cell strain enlarged culturing of screening, freezing collection.

The cell strain of screening is cultivated the culture supernatant of collecting cell after 4 days.Identify by the ELISA method whether genetically modified cell synthesizes genetically modified chemokine SDF-1 of justacrine and ELC.Particularly, the culture supernatant of collecting is combined test with mouse-anti people SDF-1 antibody for preparing and mouse-anti people ELC antibody.Shown in Figure 1A, Figure 1B, original NK-92 cell is not secreted SDF-1 and ELC, and the genetically modified NK-92 cell clones that filter out of great majority successful expression SDF-1 or ELC albumen and be secreted in the nutrient solution, thereby can be the dose-dependent competition that combines with anti-people SDF-1 antibody or anti-people ELC antibody.

Embodiment 3: relatively change the natural killer cell strain of SDF-1 gene and the growth curve of primitive nature killer strain.

For natural killer cell NK-92 and the original NK-92 cell strain of determining transferring toward factor gene whether different, at first the NK-92 that changes the SDF-1 gene is done a comparison with the speed of growth and the form of two kinds of cell strains of original NK-92, as shown in Figure 2, be situated between under the culture condition of plain IL-2 containing lymph, the speed of growth of the NK-92 of commentaries on classics SDF-1 gene and two kinds of cell strains of original NK-92 is basic identical, approximately of division in per 24 hours is not having lymph to be situated between under the condition of plain IL-2, changes the division (utilization of all can not growing of the NK-92 of SDF-1 gene and two kinds of cell strains of original NK-92 ³The H-TdR mark test confirms that the result does not show at this), this test explanation is changeed the SDF-1 gene and is not changed the dependency of natural killer cell NK-92 to growth factors I L-2; Do not change the speed of growth of NK-92 yet.

Embodiment 4: radiation exposure is to the growth of transgenosis natural killer cell and the influence of secretion chemokine ability.

With natural killer cell strain NK-92 and original NK-92 cell gamma radiation exposure that transduction ELC gene obtains, irradiation dose is 500cGy.After cell after undosed and the irradiation cultivated 48 hours with identical initial density, add (1 * 10 of equivalent ⁵The cpm/ sample) thymosin of isotropic substance hydrogen 3 marks ( ³H-TdR).Be incubated after 2 hours, utilize liquid scintillation instrument that each cell sample is done ³The numeration of H-TdR radioactivity.Shown in Fig. 3 A, undosed cell growth division, thereby absorb ³H-TdR; And all no longer absorb through transgenosis NK-92 and the original NK-92 cell that above-mentioned dosage gamma radiation exposure is crossed ³H-TdR shows that they have stopped the growth division, uses the ELISA method to measure above-mentioned irradiation or non-irradiated transgenosis and original NK-92 cell strain secretion ELC (shown in Fig. 3 B).The result shows that original NK-92 cell is not secreted ELC; And the NK-ELC-P-22 that genetically modified NK-ELC-P-22 and process gamma radiation exposure are crossed produces secretion ELC, and secretory volume changes little.This experimental result shows that with this understanding radiation exposure can stop the growth division of natural killer cell NK-92, but little to the ability influence of this emiocytosis chemokine.

Embodiment 5: the cell conditioned medium of the natural killer cell NK-92 of transduction chemokine gene induces the chemokine target cell directed mobile.

For to changeing the SDF-1 gene, change the SDF-1P2G gene, change the ELC gene and change the ELC fragment gene, that is the chemokine that the natural killer cell NK-92 of ELC (8-77) gene production is expressed is made further characterized, collect 48 hours culture supernatant of above-mentioned genetically modified NK-92 cell strain respectively, whether there to be SDF-1 and ELC chemokine activity in this supernatant liquor in order measuring, to have done chemokine and induced target cell to move experiment.Concrete grammar is that four kinds of genetically modified NK-92 cell culture supernatants with above-mentioned collection are added to respectively in the following hole of the Tissue Culture Plate that has membrana perforata (0.5 micron in aperture), target cell CEM-M3 (cell expressing SDF-1 receptor CXCR 4) and HuT78 (cell has ELC acceptor CCR7) are added to respectively in the hole. after 37 degree are incubated 3 hours, how many tumour target cells observation has wear film from last hole to move on to down the hole. and shown in Fig. 4 A, what original NK-92 cell conditioned medium can not inducing tumor cell moves.The NK-92 supernatant that changes the SDF-1 gene is because oozy chemokine SDF-1 and specially induce moving of its target cell CEM-M3.Because this cell is not secreted ELC, so HuT78 is not had effect; Shown in Fig. 4 B, the cell conditioned medium of NK-92 that changes ELC is because oozy chemokine ELC and specially induce moving of its target cell Hut78.Different with above-mentioned situation is, change the SDF-1P2G gene and change the chemokine analogue that the NK-92 cell strain production of ELC fragment gene ELC (8-77) expresses not have the function that inducing cell moves fully, but they can suppress the activity of SDF-1 or ELC.SDF-1P2G and ELC fragment that this evidence is expressed combine same acceptor with chemokine SDF-1 and ELC respectively.

Embodiment 6: the natural killer cell strain of commentaries on classics SDF-1 gene and commentaries on classics SDF-1P2G and primitive nature killer strain are to the comparison of lymphoma CEM-M3 cell killing ability.

For the NK-92 cell strain and the original NK-92 cell strain that will change SDF-1 gene and commentaries on classics SDF-1P2G gene compared lymphoma CEM-M3 cell killing ability, we have done the test of in vitro tests tumor-killing.Concrete grammar is, at first with tumour target cell CEM-M3 with isotropic substance chromium 51 ( ⁵¹Cr) carried out mark.With remaining ⁵¹After Cr cleans, the target cell of same quantity and the genetically modified of different quantities or primary NK-92 cell (that is different E: T ratio, insulation together as shown in Figure 5).After four hours, difference collecting cell supernatant liquor, and utilize Gamma ray numeration instrument to measure ⁵¹The Cr burst size.And calculate the target cell kill rate by following formula.The result as shown in Figure 5.

" test sample ⁵¹The burst size of Cr (CPM)-spontaneous ⁵¹The burst size of Cr (CPM)--------------------------------------------------------------------------------------X100

Always ⁵¹The burst size of Cr (CPM)-spontaneous ⁵¹The burst size of Cr (CPM) "

The explanation of this test-results, in in vitro tests, the NK-92 cell strain and the original NK-92 cell strain that change SDF-1 gene and commentaries on classics SDF-1P2G gene compare tumour cell CEM-M3 cell killing ability, and the NK-92 cell strain that changes the SDF-1 gene is higher slightly than original NK-92 cell strain lethality.And the NK-92 cell strain and the original NK-92 cell strain that change the SDF-1P2G gene are not just significantly distinguished the lethality of tumour cell CEM-M3.

Embodiment 7: relatively change the natural killer cell strain of ELC gene and ELC fragment gene and primitive nature killer strain to mammary cancer T47D cell killing ability.

For ELC gene and the transduction ELC fragment gene of will transduceing, that is the NK-92 cell strain of ELC (8-77) gene and original NK-92 cell strain compared mammary cancer T47D cell killing ability, does the external fragmentation test of tumour.Concrete grammar is as described in the embodiment 4, and the result as shown in Figure 6.The explanation of this test-results, in in vitro tests, the NK-92 cell strain that changes the ELC gene is higher slightly than original NK-92 cell strain lethality, and changes the ELC fragment, and promptly the NK-92 cell strain of ELC (8-77) gene and original NK-92 cell strain are to the not significantly difference of lethality of mammary cancer T47D cell.

Embodiment 8: the NK-92 cell strain of transduction SDF-1 gene and original NK-92 cell strain are to the comparison of the viral diffusibility of inhibition simplexvirus HSV-1 cells infected.

The implementation case has been observed the NK-92 cell strain of transduction SDF-1 gene and original NK-92 cell strain suppresses its viral diffusibility to the Colo-205 cell of simplexvirus HSV-1 infection variation.People's Colo-205 (ATCC) cell strain was infected (10MOI) 1 hour with simplexvirus HSV-1.With nutrient solution cell is cleaned after 3 times, the Colo-205 cell that infects is incubated 1 hour.With the NK-92 cell strain and the original NK-92 cell strain action effect cell (E) of transduction SDF-1 gene, the Colo-205 cell that HSV-1 infects is as target cell

(T), with E: T=5: the centrifugal back insulation 4 or 18 hours of putting together of 1 ratio.Measure HSV-1 virus diffusibility afterwards: after cell was cleaned, the individual layer BSC-1 (ATCC) that milliliter is added to 35 centimetres of culture dish with 500 cell/2 was incubated above the cell.Cell conditioned medium inhaled after 12 hours and goes, and with the nutrient solution that contains 0.8% agar with the cell bedding.With the cell formaldehyde fixed, Viola crystallina dyeing counts to virus plaque after three days.The result as shown in Figure 7.The relative titre of HSV-1 is 136 in the target cell of the infection that does not deal with; The NK-92 cell strain of transduction SDF-1 gene and original NK-92 cell strain and the common insulation of target cell infection inhibition in 4 hours HSV-1 titre reach 40%, 18 hour and reach 100%.The NK-92 cell strain and the original NK-92 cell strain of presentation of results transduction SDF-1 gene all suppress simplexvirus HSV-1 virus diffusibility significantly, but the not obviously difference of inhibition effect that they infect HSV-1 each other.

Embodiment 9: the comparison that the natural killer cell of transduction SDF-1 gene and primitive nature killer strain injection back distribute in the mouse body.How to distribute for understanding is expelled to intravital natural killer cell strain, do following test: at first genetically modified and primary natural killer cell strain TALL-104 is used respectively 0.25mCi Na2 ( ⁵¹Cr) O ₄Incubated overnight is with the pair cell isotropic substance ⁵¹Cr is mark in addition, and the cell of mark is caused death with the gamma radiation exposure.Prepare three groups of white mouse in Tianjin, 4 every group, give every mouse from abdominal injection 2.5 * 10 ⁷The genetically modified TALL-104 cell of individual above-mentioned mark and original TALL-104 cell.Inject after back 2 hours or 24 hours two mouse in every group are killed, collect various major organs respectively, and same a kind of organ of two mouse is mixed.Measure isotropic substance in the various organs with the gamma register ⁵¹The quantity of Cr is organized with cpm/ gram and to be expressed (shown in Fig. 8 A, Fig. 8 B).The result shows that the original TALL-104 cell of injection and the TALL-104 cell of transduction SDF-1 gene mainly are distributed in spleen, liver and kidney.But comparatively speaking, the TALL-104 cell of transduction SDF-1 gene is more much bigger than the distribution of original NK-92 cell in blood.

The distribution of NK-92 cell in blood that SDF-1 gene or SDF-1P2G gene are changeed in another test demonstration (shown in Figure 9) injection obviously increased than original NK-92 cell, and the about 2-3 of the amplitude of raising doubly.Opposite with blood, change the quantity of the NK-92 of SDF-1 or SDF-1P2G gene at the spleen accumulative and just obviously lack than primary NK-92.This test explanation transduction SDF-1 or SDF-1P2G gene in natural killer cell NK-92 have reduced it significantly the losing of spleen and other organ, and have obviously improved its quantity in blood.As from intravenous injection ⁵¹The NK-92 cell of Cr mark, it reduces rapidly in quantity of blood expressed within 2 hours, and the overwhelming majority gathers lung.In time afterwards, ⁵¹The NK-92 cell of Cr-mark is transferred to liver gradually, kidney, and spleen, marrow, seldom amount comes back in the blood.And the NK-92 cell of transduction SDF-1 gene or SDF-1P2G gene, though its content at blood also reduces gradually within back 2 hours of injection, the degree that reduces is just much smaller than original NK-92.Content after two hours in blood just has more about 2-3 times (result does not show) than original NK-92.

Embodiment 10: the natural killer cell strain of the ELC gene of relatively transduceing and primitive nature killer strain in the mouse body to the accumulated number in the mammary cancer T47D solid tumor.

Human body mammary cancer T47D cell is prepared into 2 * 10 with phosphoric acid buffer ⁶/ microlitre suspension, wherein 0.5 milliliter to be inoculated into female SCID mouse subcutaneous.To change the natural killer cell NK-92 cell of ELC gene and original NK-92 cell respectively according to the described isotropic substance of using of Fig. 8 ⁵¹Cr is mark in addition.After x-ray irradiation (500cGy), above-mentioned cell is prepared into 1 * 10 respectively ⁸/ ml cells suspension.When the T47D tumour has grown up to about diameter and is 1 centimetre, give every mouse from abdominal injection 2.5 * 10 ⁷The transduction ELC gene NK-92 cell of individual above-mentioned mark and original NK-92 cell.Inject after back 2 hours 24 or 48 hours two mouse in every group are killed, peel off and collect noumenal tumour, and every group sample is merged.Measure isotropic substance in the tumor tissues with the gamma register ⁵¹The quantity of Cr is organized with cpm/ gram and to be expressed.And with without the reading of the T47D tumour of injection as the 1 natural killer cell amount that relatively accumulates in each tumour.The result shows that (Figure 10) injects the distribution of NK-92 cell in the T47D tumour of changeing the ELC gene and obviously increase than original NK-92 cell, and the amplitude of raising reached about 3 times of original NK-92 after 48 hours.

Embodiment 11: the natural killer cell strain and the primitive nature killer strain that change SDF-1 or SDF-1P2G gene compare the restraining effect of lymphocytoma cem cell growth in the mouse body.

Human lymphocyte knurl CEM is prepared into 1 * 10 with phosphoric acid buffer ⁶/ microlitre suspension, wherein 0.5 milliliter by the tail intravenous inoculation in female SCID mouse body.As the cellular immunization treatment, the NK-92 cell and the original NK-92 cell that change SDF-1 or SDF-1P2G gene shine (500cGy) to end its merisis through x-ray.Various NK-92 cell strains are prepared into 1 * 10 ⁸/ ml cells suspension, according to different dosage half an hour behind above-mentioned tumor cell injection, from tail vein injection in the mouse body. the survival rate of the mouse of record is as shown in figure 11.Untreated mouse is dead in 40 days behind tumor inoculation greatly. and primitive nature killer cell NK-92 treatment has delayed about 1 times of the death time of animal, that is in 70 days. and with the further obviously postponement of death time than original NK-92 of the mouse of the NK-92 cell therapy of the NK-92 of transduction SDF-1 gene or transduction SDF-1P2G gene.Still have two mouse survivals up to off-test in 90 days.This test explanation transduction SDF-1 or its albuminoid gene have obviously improved the inhibition that natural killer cell strain NK-92 grows in vivo to human lymphocyte knurl CEM-M3.

Embodiment 12: the natural killer cell strain and the primitive nature killer strain that change the ELC gene compare the restraining effect of mammary cancer T47 solid tumor growth in the mouse body.

It is two groups that female SCID mouse is divided into, 10 every group.People's breast cancer cell T47D is prepared into cell suspending liquid, gives all mouse in subcutaneous vaccination (5 * 10 ⁵/ only).After two weeks, T47D is at the subcutaneous solid tumor that grows up to.At this moment, will use isotropic substance ⁵¹To the transduce natural killer cell NK-92 (circle) or the original NK-92 (triangle) of chemokine ELC gene of Cr is expelled to respectively in two groups of mouse bodies from the abdominal cavity.Every 2 days duplicate injection natural killer cells once, treated for two weeks altogether.A termination in month is tested after stopping treatment.Tumour is peeled off and weighed.As shown in Figure 12, the NK-92 cell that changes the ELC gene to the inhibition effect of tumor growth apparently higher than original NK-92.The result shows that the NK-92 cell of injection commentaries on classics ELC gene is to suppressing obviously to improve at the T47D of subcutaneous growth tumor growth.

Embodiment 13: the comparison that other stem cell-derived cell of transduction SDF-1 gene distributes in the mouse body.Compare archeocyte what difference is arranged for other stem cell-derived cell of understanding transduction SDF-1 gene distributes in vivo, special is that example is confirmed with mouse marrow stem cell deutero-monocyte.Do following test: the bone marrow stem cell of mouse is taken out by mouse femur marrow, be placed in the nutrient solution that contains somatomedins such as M-CSF and cultivated 20 days.At this moment, bone marrow stem cell has been divided into monocyte, and cell is bred in a large number.On the other hand, the gene of SDF-1 is cloned into carrier according to aforementioned ground method, in the mouse retrovirus stem cell carrier (retroviral murine stem cell vector) that analogy is used herein.The monocyte that the differentiation of stem cells collected becomes is cleaned, and with the virus vector mixed culture that contains the SDF-1 gene fragment, with carrier transduction in cell.Then, pair cell is mark in addition, and analogy uses the position plain herein ³⁵S in addition mark (adds isotropic substance respectively with genetically modified and primary monocyte in the nutrient solution of no S ³⁵S, pair cell was cultivated 2 days).To genetically modified monocyte and the monoblast of mouse from the above-mentioned mark of abdominal injection.Inject after 24 hours the mouse in every group is killed, collect various major organs respectively.Measure isotropic substance in the various organs with the gamma register ³⁵' shown in Figure 13 result, the monocyte of the monoblast of injection and transduction SDF-1 gene mainly is distributed in spleen, liver and kidney to the quantity of S.But comparatively speaking, the monocyte of transduction SDF-1 gene is more much bigger than the distribution of monoblast in blood.After 24 hours in blood the monocytic content of transduction SDF-1 gene just have more about 2 times than monoblast.

Caption:

Figure 1A, Figure 1B are that secretion SDF-1 or the strain of ELC natural killer cell are produced in the natural killer cell strain of transferring toward factor gene.The NK-92 process changes SDF-1-pcDNA3.1 or ELC-pcDNA3.1 gene over to, and obtains stable expression cell strain NK-SDF-P-12 (Figure 1A) and NK-ELC-P-22 (Figure 1B) through the screening in antibiotic Gentamycin 4-5 week.Itself and not genetically modified original N-92 cell were cultivated 4 days at 37 degree, and collected culture supernatant is done the integrated enzyme reaction test with mouse-anti people SDF-1 antibody for preparing or mouse-anti people ELC antibody (Santa CruzBiotech.) respectively.It shown in the figure relative quantity of contained chemokine SDF-1 (Figure 1A) and ELC (Figure 1B) in the supernatant.Original NK-92 cell strain does not produce any SDF-1 and ELC, with its reading as 1.NK-SDF-P-12 secretes SDF-1 (triangular form), and genetically modified NK-92 cell strain NK-ELC-P-22 secretion ELC (round), its output height is to represent with respect to the ratio of control group (square).

Fig. 2 is for relatively changeing the natural killer cell strain of SDF-1 gene and the growth curve of primitive nature killer cell.To change the stable expression cell strain NK-SDF-P-12 that the SDF-1 gene obtains, and, also have original NK-92 cell, cultivated 72 hours with identical initial concentration with the NK-SDF-1P2G-A-10 that SDF-1 analogue SDF-1P2G transgenosis obtains.During tucking in, cultivation contains plain-2 (IL-2, the 100U/ milliliters) of lymph Jie.Cell counted in each 12 hours.Show transgenosis cell strain NK-SDF-P-12 among the figure, NK-SDF-1P2G-A-10 is identical with the NK-92 speed of growth, and approximately per 24 hours increasing degrees doubly.Transgenosis does not change the NK-92 speed of growth.Fig. 3 A, Fig. 3 B are that radiation exposure stops the division of transgenosis natural killer cell, do not produce the secretion chemokine but do not suppress cell.With cell strain NK-ELC-P-and original NK-92 cell gamma radiation exposure that transgenosis obtains, irradiation dose is 500cGy.After cell after undosed and the irradiation cultivated 48 hours with identical initial density, add (1 * 10 of equivalent ⁵The cpm/ sample) thymosin of isotropic substance hydrogen 3 marks ( ³H-TdR).Be incubated after 2 hours, utilize liquid scintillation instrument that each cell sample is done ³H-TdR radioactivity numeration (n=4).Fig. 3 A shows, undosed cell growth division, thereby absorb ³H-TdR; And all no longer absorb through NK-ELC-P-22 and the original NK-92 cell that above-mentioned dosage gamma radiation exposure is crossed ³H-TdR shows that they have stopped the growth division.Fig. 3 B shows is to above-mentioned irradiation or NK-ELC-P-22 that does not penetrate according to society and the measurement result of original NK-92 cell strain excretory ELC.

Fig. 4 A, Fig. 4 B induce target cell CEM-M3 and Hut78 orientation for the secretory product of the natural killer cell of transduction chemokine gene and move.With various transferring toward factor gene NK-92 cell strain and original NK-92 cell cultures shown in the figure 48 hours, the collecting cell supernatant.Utilizing 24 holes to wear the film brassboard does and induces target cell to move experiment.Above-mentioned cell conditioned medium is added to respectively wears film brassboard (Transwell plate, Bacton ﹠amp; Dicson) following hole is with 5 * 10 ⁵REH cell of the individual CXCR4 of having acceptor (Fig. 4 A) and the HUT78 cell (Fig. 4 B) that has a CCR7 acceptor are added to the last hole (n=2) of brassboard respectively.Compute moves to down the target cell in the hole after being incubated 3 hours.Shown in Fig. 4 A, original NK-92 cell is not secreted the SDF-1 activity, thereby does not induce the CXCR4 target cell to move.The NK-92 cell of transduction SDF-1 gene, i.e. NK-SDF-P-12 cell (transgenosis A) secretion SDF-1, thereby induce its receptor CXCR 4 target cell to move.With NK-SDF-1P2G-A-10 (transgenosis B) the excretory SDF-1P2G that SDF-1 analogue SDF-1P2G transgenosis obtains, itself does not have the chemokine activity, but can suppress the activity of the SDF-1 of transgenosis A emiocytosis.This explanation SDF-1P2G is the part that does not have active CXCR4 acceptor.Shown in Fig. 4 B, have only the NK-92 cell of transduction ELC gene, i.e. NK-ELC-P-22 cell (transgenosis C) secretion ELC, thereby can induce CCR7 target cell HUT78 to move.And NK-92 (transgenosis D) the excretory protein of transduction ELC analogue ELC (8-77) gene itself does not have the ELC activity, but can with the CCR7 receptors bind, be not have active CCR7 part.Original NK-92 cell and remaining transgenic cell are not secreted ELC, do not induce the CCR7 target cell to move.

Fig. 5 is the comparison to lymphoma CEM-M3 cell killing ability of the natural killer cell strain of changeing the SDF-1 gene and primitive nature killer strain.At first with tumour target cell CEM-M3 with isotropic substance chromium 51 ( ⁵¹Cr) carried out mark.With remaining ⁵¹After Cr cleans, the target cell (T) of same quantity and the genetically modified or primary NK-92 cell (E) of different quantities, promptly with different E: the T ratio is incubated together.After four hours, difference collecting cell supernatant liquor, and utilize Gamma ray numeration instrument to measure ⁵¹The Cr burst size.And calculate the target cell kill rate by following formula.

Test sample ⁵¹The burst size of Cr (CPM)-spontaneous ⁵¹The burst size of Cr (CPM)

------------------------------------------------X100

Always ⁵¹The burst size of Cr (CPM)-spontaneous ⁵¹The burst size of Cr (CPM)

Every group of data shown in the figure from left to right are E: T=9 according to this: 1; 3: 1; 1: 1; 0.3: 1.Wherein E represents original NK-92 respectively, the NK-92 (NK-SDF-P-12) of transduction SDF-1 gene and the NK-92 cell of transduction SDF-1P2G.Various NK cell strains to the lethality of tumour CEM-M3 cell all with E: the T ratio is directly proportional.At E: during T=9, approximately the CEM-M3 cell of 50-70% is all killed within 4 hours by the NK cell.Wherein NK-SDF-P-12 is slightly stronger to the lethality of tumour than original NK-92 cell.Fig. 6 is the comparison to breast cancer cell T47D kill capability of the natural killer cell strain of changeing the ELC gene and primitive nature killer strain.Experimental technique is the same substantially with the method for Fig. 5.At first with breast cancer cell T47 with isotropic substance chromium 51 ( ⁵¹Cr) carried out mark.Target cell and the genetically modified of different quantities or primary NK-92 cell (that is different E: T ratio) insulation (n=3) together with same quantity.After four hours, difference collecting cell supernatant liquor, and utilize Gamma ray numeration instrument to measure ⁵¹The Cr burst size.And calculate the target cell kill rate.Every group of data shown in the figure from left to right are E: T=9 according to this: 1; 3: 1; 1: 1; 0.3: 1.Wherein E represents original NK-92 (circle row), the NK-92 (square) of transduction ELC gene and the NK-92 cell (trilateral) of transduction ELC (8-77) respectively.Various NK cell strains to the lethality of tumour T47 cell all with E: the T ratio is directly proportional.At E: during T=9, approximately the T47D cell (T) of 50-70% is all killed within 4 hours by the NK cell.The NK-92 of transduction ELC gene and transduction ELC (8-77) gene is slightly stronger to the lethality of tumour than original NK-92 cell.

Fig. 7 for the natural killer cell strain of changeing the SDF-1 gene and primitive nature killer strain to the HSV-1 virus infection and the not comparison of the mouse cell killing ability of infection.This figure has shown that the NK-92 cell strain of transduction SDF-1 gene and the Colo-205 cell that original NK-92 cell strain infects simplexvirus HSV-1 suppress the situation of its viral diffusibility.People's Colo-205 (ATCC) cell strain is infected as target cell (T) with simplexvirus HSV-1.With NK-92 cell strain and the original NK-92 cell strain action effect cell (E) of transduction SDF-1 gene, with E: T=5: 1 ratio is measured the viral diffusibility of HSV-1 together after the target cell that infects is incubated 4 or 18 hours.Shown in Figure 7 is the relative titre of HSV-1.The relative titre of HSV-1 is 136 in the target cell of the infection that does not deal with; The NK-92 cell strain (oblique line pattern) of transduction SDF-1 gene all can obviously suppress viral diffusibility with original NK-92 cell strain (dot pattern) and the common insulation of target cell infection: 4 hours inhibition HSV-1 titres are about 40%, 18 hour and reach 100%.The not obviously difference of inhibition effect that they infect HSV-1 each other.

Fig. 8 A, Fig. 8 B are the commentaries on classics SDF-1 gene after the relatively injection or change the killer strain TALL104 of SDF-1P2G and the distribution of primitive nature killer strain each organ in the mouse body.The TALL-104 cell and the original TALL-104 cell isotropic substance of transduction SDF-1 gene ⁵¹Cr is mark in addition.Cell is caused death with the gamma radiation exposure.Give every white mouse in Tianjin from abdominal injection 2.5 * 10 ⁷The transgenosis TALL-104 cell of individual above-mentioned mark and original TALL-104 cell.Inject after back 2 hours or 24 hours and collect various major organs respectively, and same a kind of organ of every group of (n=2) mouse is mixed.Measure isotropic substance in the various organs with the gamma register ⁵¹The quantity of Cr (cpm/ restrains tissue).The post of light colour represents to inject the result who measured in back 2 hours among the figure; Dark post is represented the result after 24 hours.The result shows that the original TALL-104 cell of injection and the TALL-104 cell of transduction SDF-1 gene mainly are distributed in spleen, liver and kidney.But comparatively speaking, the TALL-104 cell of transduction SDF-1 gene is more much bigger than the distribution of original TALL-104 cell in blood.

Fig. 9 A, Fig. 9 B are commentaries on classics SDF-1 gene after the relatively injection or natural killer and the distribution of primitive nature killer strain in mouse spleen and blood of changeing SDF-1P2G.With the NK-92 of transduction SDF-gene and the NK-92 cell of transduction SDF-1P2G, and original NK-92 cell is respectively according to the described isotropic substance of using of Fig. 8 ⁵¹Cr is mark in addition.Cell is caused death with the gamma radiation exposure.Inject after back 2 hours or 24 hours and collect blood and spleen respectively, and same a kind of organ of every group of (n=2) mouse is mixed.Measure isotropic substance in the various organs with the gamma register ⁵¹The quantity of Cr (cpm/ restrains tissue).The circle NK-92 cell of SDF-1 gene of representing to transduce among the figure; Triangle represents to change the NK-92 cell of SDF-1P2G, the original NK-92 cell of square expression.The result shows that injecting the distribution of NK-92 cell in blood of changeing SDF-1 gene or SDF-1P2G gene obviously increases about 2-3 doubly than original NK-92 cell; And reduce significantly than original NK-92 cell at the NK-92 cell of spleen accumulation commentaries on classics SDF-1 gene or SDF-1P2G gene.

Figure 10 is natural killer cell strain and primitive nature killer strain accumulated number in the mammary cancer T47D solid tumor in the mouse body of relatively transduce SDF-1 or transduction SDF-1P2G gene.It is subcutaneous that 0.5 milliliter of human body mammary cancer T47 cell suspending liquid is inoculated into female SCID mouse.When the T47D tumour has grown up to about diameter and has been 1 centimetre, will be lethal through radiation exposure ⁵¹The NK-92 cell of the transduction ELC gene of Cr mark and original NK-92 cell give every SCID mouse from abdominal injection 2.5 * 10 respectively then ⁷The transgenosis NK-92 cell of individual above-mentioned mark and original NK-92 cell.Inject the noumenal tumour of peeling off mouse after back 2 hours 24 or 48 hours, and every group of sample merged.Measure isotropic substance in the tumor tissues with the gamma register ⁵¹The quantity of Cr is organized with cpm/ gram and to be expressed.And with without the reading of the T47 tumour of injection as the 1 natural killer cell amount that relatively accumulates in each tumour.Circle is represented the NK-ELC-P-8 cell among the figure; Triangle represents to change the NK-92 cell of ELC (8-77), the original NK-92 cell of square expression.The result shows that injecting the distribution of NK-92 cell in the T47D tumour of changeing ELC gene or ELC (8-77) gene obviously increases than original NK-92 cell, and the amplitude of raising reached about 3 times of original NK-92 after 48 hours.

Figure 11 for the present invention transduce the natural killer cell strain of SDF-1 gene or SDF-1P2G gene and primitive nature killer strain in the mouse body to the restraining effect of lymphocytoma cem cell growth relatively.Human lymphocyte knurl CEM is prepared into 1 * 10 with phosphoric acid buffer ⁶/ microlitre suspension, wherein 0.5 milliliter by the tail intravenous inoculation in female SCID mouse body.The NK-92 cell and the original NK-92 cell of transduction SDF-1 or SDF-1P2G gene also are prepared into 1 * 10 respectively through gamma radiation exposure (500cGy) ⁸/ ml cells suspension, according to different dosage half an hour behind above-mentioned tumor cell injection, from tail vein injection in the mouse body. be the survival rate of mouse shown in the figure.Untreated mouse is dead in 40 days behind tumor inoculation greatly. primitive nature killer cell NK-92 treatment has delayed about 1 times of the death time of animal, that is in 70 days. and with the NK-92 that changes the SDF-1 gene or with the mouse of the genetically modified NK-92 cell therapy of SDF-1P2G than death time of original NK-92 further obviously postponement still have two mouse to survive after .90 days.SDF-1 is changeed in this test explanation or its albuminoid gene has obviously improved natural killer cell strain NK-92 to human lymphocyte knurl CEM restraining effect in vivo.

Figure 12 for the present invention transduce the natural killer cell strain of ELC gene and primitive nature killer strain in the mouse body to the growth inhibiting comparison of mammary cancer T47D solid tumor.It is two groups that female SCID mouse is divided into, 10 every group.People's breast cancer cell T47D is prepared into cell suspending liquid, gives all mouse in subcutaneous vaccination (5 * 10 ⁵/ only).After two weeks, T47D is at the subcutaneous solid tumor that grows up to.At this moment, will use isotropic substance ⁵¹To the transduce natural killer cell NK-92 (circle) or the original NK-92 (triangle) of chemokine ELC gene of Cr is expelled to respectively in two groups of mouse bodies from the abdominal cavity.Every 2 days duplicate injection natural killer cells once, treated for two weeks altogether.A termination in month is tested after stopping treatment.Tumour is peeled off and weighed.As shown in FIG., the NK-92 cell of commentaries on classics ELC gene is higher than original NK-92 to the inhibition effect of tumor growth.

Figure 13 injects the comparison that the back distributes for the stem cell-derived monocyte and the initiating cell of transduction SDF-1 gene in the mouse body.Get 2 mouse inbred liness, separate its femur, and marrow is washed out.The medullary cell of mouse is placed in the nutrient solution that contains 20% L-929 cell strain supernatant liquor (containing somatomedins such as M-CSF) cultivated 20 days.At this moment, bone marrow stem cell has been divided into monocyte, and cell quantity is bred to millions of.On the other hand, the gene of SDF-1 is cloned in the mouse retrovirus stem cell carrier (retroviral murine stem cell vector) according to aforementioned ground method.The stem cell-derived monocyte collected is cleaned, and with the virus vector mixed culture that contains the SDF-1 gene fragment, with carrier transduction in cell.Then, genetically modified and primary monocyte are added isotropic substance respectively in the nutrient solution of no sulphur ³⁵S, pair cell was cultivated 2 days, and is plain with the position with pair cell ³⁵S is mark in addition.Prepare two groups of mouse inbred liness, 2 every group, give every mouse from abdominal injection 2.5 * 10 ⁶The genetically modified monocyte and the monoblast of individual above-mentioned mark.Inject and after 24 hours mouse is killed, collect various major organs respectively, and same a kind of organ of two mouse is mixed.Measure isotropic substance in the various organs with the gamma register ³⁵The quantity of S is with the situation of cpm/ gram tissue expression cell distribution.Its bend representative is without genetically modified cell, and the cell of SDF-1 is changeed in the black representative.

Table 1 Chemokine Receptors and part chemokine thereof ^*

The part chemokine of Chemokine Receptors: be meant albumen or compound with this receptor specific combination.

Chemokine Receptors	The part chemokine (rebaptism) of Chemokine Receptors	The part chemokine of Chemokine Receptors (custom name)
			?CCR1	?CCL3，CCL5	?MIP-1α，MIP-1β
?CCR2	?CCL2，CCL7，CCL13	?MCP-1，MCP-3
			?CCR3	?CCL7，CCL8，CCL11， ?CCL24，CCL26	?Eotaxin，Eotaxin-2，Eotaxin-3
?CCR4	?CCL17，CCL22	?MDC
			?CCR5	?CCL3，CCL4，CCL5，CCL8， ?CCL14	?RANTES，MIP-1β
?CCR6	?CCL25	?MIP-3β，TECK
			?CCR7	?CCL19，CCL21	?ELC，SLC
?CCR8	?CCL1，CCL4，CCL17	?I-309
			?CCR10	?CCL28，CCL27	?MEC，CTARCK
?CXCR1	?CXCL8	?IL-8
			?CXCR2		?GROα/β，
?CXCR3	?CXCL-9，CXCL-10，CXCL11	?IP-10，Mig，ITAC
			?CXCR4	?CXCL12	?SDF-1
?CXCR5	?CXCL13	?BCA-1
			?XCR1	?XCL1，XCL2	?Lymphotactin

* the definition of Chemokine Receptors and part chemokine thereof is seen before and is stated term and definitely define.Chemokine Receptors and part chemokine thereof that the just nature that this tabular goes out exists do not comprise generalized part chemokine, i.e. the protein of all and Chemokine Receptors specific combination.In addition, what this tabular went out is all Chemokine Receptors and part chemokine thereof, comprises the special Chemokine Receptors and the part chemokine thereof of indication of the present invention.

Sequence 1: for the present invention change over to the Chemokine Receptors of natural killer cell and part chemotactic thereof because of The gene and the protein sequence of son

The sequence of annex 1 patent thing (illustration is not limited thereto)

＜110〉Gong Xiaodi

＜120〉natural killer cell of express cell chemokine

<160>20

<210>1

<211>67

<212>PRT

＜213〉people (human)

<220>

<221>Mutagen

＜222〉N-end

＜223〉be used to the to transduce part SDF-1P2G of Chemokine Receptors CXCR4 of killer cell, sequence (PD 1)

<400>1

Lys?Gly?Val?Ser?Leu?Ser?Tyr?Arg?Cys?Pro?Cys?Arg?Phe?Phe?Glu?Ser

1?5?10?15

His?Val?Ala?Arg?Ala?Asn?Val?Lys?His?Leu?Lys?Ile?Leu?Asn?Thr?Pro

20?25?30

Asn?Cys?Ala?Leu?Gln?Ile?Val?Ala?Arg?Leu?Lys?Asn?Asn?Asn?Arg?Gln

35?40?45

Val?Cys?Ile?Asp?Pro?Lys?Leu?Lys?Try?Ile?Gln?Glu?Tyr?Leu?Glu?Lys

50?55?60

Ala?Leu?Asn

65

<210>2

<211>67

<212>PRT

＜213〉people (human)

<220>

<221>Peptide

<222>

＜223〉be used to the to transduce part SDF-1 of Chemokine Receptors CXCR4 of killer cell, sequence (PD 2)

<400>2

Lys?Pro?Val?Ser?Leu?Ser?Tyr?Arg?Cys?Pro?Cys?Arg?Phe?Phe?Glu?Ser

1?5?10?15

His?Val?Ala?Arg?Ala?Asn?Val?Lys?His?Leu?Lys?Ile?Leu?Asn?Thr?Pro

20?25?30

Asn?Cys?Ala?Leu?Gln?Ile?Val?Ala?Arg?Leu?Lys?Asn?Asn?Asn?Arg?Gln

35?40?45

Val?Cys?Ile?Asp?Pro?Lys?Leu?Lys?Trp?Ile?Gln?Glu?Tyr?Leu?Glu?Lys

55?60?65

Ala?Leu?Asn

67

<210>3

<211>77

<212>PRT

＜213〉people (human)

<220>

<221>Peptide

<222>

＜223〉be used to the to transduce part MIP-3 β (or claiming ELC) of Chemokine Receptors CCR7 of killer cell, sequence (PD 3)

<400>3

Gly?Thr?Asn?Asp?Ala?Glu?Asp?Cys?Cys?Leu?Ser?Val?Thr?Gln?Lys?Pro

1?5?10?15

Ile?Pro?Gly?Tyr?Ile?Val?Arg?Asn?Phe?His?Tyr?Leu?Leu?Ile?Lys?Asp

20?25?30

Gly?Cys?Arg?Val?Pro?Ala?Val?Val?Phe?Thr?Thr?Leu?Arg?Gly?Arg?Gln

35?40?45

Leu?Cys?Ala?Pro?Pro?Asp?Gln?Pro?Trp?Val?Glu?Arg?Ile?Ile?Gln?Arg

50?55?60

Leu?Gln?Arg?Thr?Ser?Ala?Lys?Met?Lys?Arg?Arg?Ser?Ser

65?70?75?77

<210>4

<211>70

<212>PRT

＜213〉people (human)

<220>

<221>Mutagen

＜222〉N-end

＜223〉be used to the to transduce part MIP-3 β (8-77) of Chemokine Receptors CCR7 of killer cell, sequence (PD 4)

<400>4

Cys?Cys?Leu?Ser?Val?Thr?Gln?Lys?Pro?Ile?Pro?Gly?Tyr?Ile?Val?Arg

1?5?10?15

Asn?Phe?His?Tyr?Leu?Leu?Ile?Lys?Asp?Gly?Cys?Arg?Val?Pro?Ala?Val

20?25?30

Val?Phe?Thr?Thr?Leu?Arg?Gly?Arg?Gln?Leu?Cys?Ala?Pro?Pro?Asp?Gln

35?40?45

Pro?Trp?Val?Glu?Arg?Ile?Ile?Gln?Arg?Leu?Gln?Arg?Thr?Ser?Ala?Lys

50?55?60

Met?Lys?Arg?Arg?Ser?Ser

65?70

<210>5

<211>79

<212>PRT

＜213〉people (human)

<220>

<221>Domain

＜222〉N-end

＜223〉be used to the to transduce part SLC (1-79) or the 6CKine (1-79) of Chemokine Receptors CCR7 of killer cell, sequence (PD 5)

<400>5

Ser?Asp?Gly?Gly?Ala?Gln?Asp?Cys?Cys?Leu?Lys?Tyr?Ser?Gln?Arg?Lys

1?5?10?15

Ile?Pro?Ala?Lys?Val?Val?Arg?Ser?Tyr?Arg?Lys?Gln?Glu?Pro?Ser?Leu

20?25?30

Gly?Cys?Ser?Ile?Pro?Ala?Ile?Leu?Phe?Leu?Pro?Arg?Lys?Arg?Ser?Gln

35?40?45

Ala?Glu?Leu?Cys?Ala?Asp?Pro?Lys?Glu?Leu?Trp?Val?Gln?Gln?Leu?Met

50?55?60

Gln?His?Leu?Asp?Lys?Thr?Pro?Ser?Pro?Gln?lys?Pro?Ala?Gln?Gly

<210>6

<211>111

<212>PRT

＜213〉people (human)

<220>

<221>Peptide

<222>

＜223〉be used to the to transduce part chemokine SLC or the 6CKine of Chemokine Receptors CCR7 of killer cell, sequence (PD 6)

<400>6

Ser?Asp?Gly?Gly?Ala?Gln?Asp?Cys?Cys?Leu?Lys?Tyr?Ser?Gln?Arg?Lys

1?5?10?15

Ile?Pro?Ala?Lys?Val?Val?Arg?Ser?Tyr?Arg?Lys?Gln?Glu?Pro?Ser?Leu

20?25?30

Gly?Cys?Ser?Ile?Pro?Ala?Ile?Leu?Phe?Leu?Pro?Arg?Lys?Arg?Ser?Gln

35?40?45

Ala?Glu?Leu?Cys?Ala?Asp?Pro?Lys?Glu?Leu?Trp?Val?Gln?Gln?Leu?Met

50?55?60

Gln?His?Leu?Asp?Lys?Thr?Pro?Ser?Pro?Gln?lys?Pro?Ala?Gln?Gly?Cys

65?70?75?80

Arg?Lys?Asp?Arg?Gly?Ala?Ser?Lys?Thr?Gly?Lys?Lys?Gly?Lys?Gly?Ser

85?90?95

Lys?Gly?Cys?Lys?Arg?Thr?Glu?Arg?Ser?Gln?Thr?Pro?Lys?Gly?Pro

100?105?111

<210>7

<211>88

<212>PRT

＜213〉people (human)

<220>

<221>Peptide

<222>

＜223〉be used to the to transduce part CCL27 or the CTARCK of Chemokine Receptors CCR10 of killer cell, sequence (PD 7)

<400>7

Phe?Leu?Leu?Pro?Pro?Ser?Thr?Ala?Cys?Cys?Thr?Gln?Leu?Tyr?Arg?Lys

5?10?15

Pro?Leu?Ser?Asp?Lys?Leu?Leu?Arg?Lys?Val?Ieu?Gln?Val?Glu?Leu?Gln

20?25?30

Glu?Ala?Asp?Gly?Asp?Cys?His?Leu?Gln?Ala?Phe?Val?Leu?His?Leu?Ala

354?40?45

Gln?Arg?Ser?Ile?Cys?Ile?His?Pro?Gln?Asn?Pro?Ser?Leu?Ser?Gln?Trp

50?55?60

Phe?Glu?His?Gln?Glu?Arg?Lys?Leu?His?Gly?Thr?Leu?Pro?Lys?Leu?Asn

65?70?75?80

Phe?Gly?Met?Leu?Arg?Lys?Met?Gly

85?88

<2l0>8：

<211>105

<212>PRT

＜213〉people (human)

<220>

<221>Peptide

<222>

＜223〉be used to the to transduce part CCL28 or the MEK of Chemokine Receptors CCR10 of killer cell, sequence (PD 8)

<400>8

Ile?Leu?Pro?Ile?Ala?Ser?Ser?Cys?Cys?Thr?Glu?Val?Ser?His?His?Ile

1?5?15

Ser?Arg?Arg?Leu?Leu?Glu?Arg?Val?Asn?Met?Cys?Arg?Ile?Gln?Arg?Ala

20?25?30

Asp?Gly?Asp?Cys?Glu?Leu?Ala?Ala?Val?Ile?Leu?His?Val?Lys?Arg?Arg

35?40?45

Arg?Ile?Cys?Val?Ser?Pro?His?Asn?His?Thr?Val?Lys?Gln?Trp?Met?Lys

50?55?60

Val?Gln?Ala?Ala?Lys?Lys?Asn?Gly?Lys?Gly?Asn?Val?Cys?His?Arg?Lys

65?70?75?80

lys?His?His?Gly?Lys?Arg?Asn?Ser?Asn?Arg?Ala?His?Gln?Gly?Lys?His

85?90?95

Glu?Thr?Tyr?Gly?His?Lys?Thr?Pro?Tyr

100?105

<210>9

<211>127

<212>PRT

＜213〉people (human)

<220>

<221>Peptide

<222>

＜223〉be used to the to transduce part CCL25 or the TECK of Chemokine Receptors CCR6 of killer cell, sequence (PD 9)

<400>9

Gln?Gly?Val?Phe?Glu?Asp?Cys?Cys?Leu?Ala?Tyr?His?Tyr?Pro?Ile?Gly

5?10?15

Trp?Ala?Val?Leu?Arg?Arg?Ala?Trp?Thr?Tyr?Arg?Ile?Gln?Glu?Val?Ser

20?25?30

Gly?Ser?Cys?Asn?Leu?Pro?Ala?Ala?Ile?Phe?Tyr?Leu?Pro?Lys?Arg?His

35?40?45

Arg?Lys?Val?Cys?Gly?Asn?Pro?Lys?Ser?Arg?Glu?Val?Gln?Arg?Ala?Met

50?55?60

Lys?Leu?Leu?Asp?Ala?Arg?Asn?Lys?Val?Phe?Ala?Lys?Leu?His?His?Asn

65?70?75?80

Thr?Gln?Thr?Phe?Gln?Ala?Gly?Pro?His?Ala?Val?Lys?Lys?Leu?Ser?Ser

85?90?95

Gly?Asn?Ser?Lys?Leu?Ser?Ser?Ser?Lys?Phe?Ser?Asn?Pro?Ile?Ser?Ser

100?105?110

Ser?Lys?Arg?Asn?Val?Ser?Leu?Leu?Ile?Ser?Ala?Asn?Ser?Gly?Leu

115?120?125?127

<210>10

<211>385

<212>PRT

＜213〉people (human)

<220>

<221>Peptide

<222>

＜223〉be used to the to transduce Chemokine Receptors CCR10 of killer cell, sequence (PD 10)

《400》10

Met?Ala?Ala?Thr?Ala?Ser?Pro?Gln?Pro?Leu?Ala?Thr?Glu?Asp?Ala?Asp

1?5?10?15

Ala?Glu?Asn?Ser?Ser?Phe?Tyr?Tyr?Tyr?Asp?Tyr?Leu?Asp?Glu?Val?Ala

20?25?30

Phe?Met?Leu?Cys?Arg?Lys?Asp?Ala?Val?Val?Ser?Phe?Gly?Lys?Val?Phe

35?40?45

Leu?Pro?Val?Phe?Tyr?Ser?Leu?Ile?Phe?Val?Leu?Gly?Leu?Ser?Gly?Asn

50?55?60

Leu?Leu?Leu?Leu?Met?Val?Leu?Leu?Arg?Tyr?Val?Pro?Arg?Arg?Arg?Met

65?70?75?80

Val?Glu?Ile?Tyr?Leu?Leu?Asn?Leu?Ala?Ile?Ser?Asn?Leu?Leu?Phe?Leu

85?90?95

Val?Thr?Leu?Pro?Phe?Trp?Gly?Ile?Ser?Val?Ala?Trp?His?Trp?Val?Phe

100?105?110

Gly?Ser?Phe?Leu?Cys?Lys?Met?Val?Ser?Thr?Leu?Tyr?Thr?Ile?Asn?Phe

115?120?125

Tyr?Ser?Gly?Ile?Phe?Phe?Ile?Ser?Cys?Met?Ser?Leu?Asp?Lys?Tyr?Leu

130?135?140

Gln?Ile?Val?His?Ala?Gln?Pro?Tyr?His?Arg?Leu?Arg?Thr?Arg?Ala?Lys

145?150?155?160

Asn?Leu?Leu?Leu?Ala?Thr?Ile?Val?Trp?Ala?Val?Ser?Leu?Ala?Val?Ser

165?170?175

Ile?Pro?Glu?Met?Val?Phe?Val?Gln?Thr?His?Glu?Asn?Pro?Lys?Gly?Val

180?185?190

Trp?Asn?Cys?His?Ala?Glu?Phe?Gly?Gly?His?Gly?Thr?Ile?Trp?Lys?Leu

195?200?205

Phe?Leu?Arg?Phe?Gln?Gln?Asn?Leu?Leu?Gly?Phe?Leu?Leu?Pro?Leu

210?215?220

Leu?Ala?Met?Ile?Phe?Phe?Tyr?Ser?Arg?Ile?Gly?Cys?Val?Leu?Val?Arg

225?230?235?240

Leu?Arg?Pro?Ala?Gly?Gln?Gly?Arg?Ala?Leu?Lys?Ile?Ala?Ala?Ala?Leu

245?250?255

Val?Val?Ala?Phe?Phe?Val?Leu?Trp?Phe?Pro?Tyr?Asn?Leu?Thr?Leu?Phe

260?265?270

Leu?His?Thr?Leu?Leu?Asp?Leu?Gln?Val?Phe?Gly?Asn?Cys?Glu?Val?Ser

275?280?285

Gln?His?Leu?Asp?Tyr?Ala?Leu?Gln?Val?Thr?Glu?Ser?Ile?Ala?Phe?Leu

290?295?300

His?Cys?Cys?Phe?Ser?Pro?Ile?Leu?Tyr?Ala?Phe?Ser?Ser?His?Arg?Phe

305?310?315?320

Arg?Gln?Tyr?Leu?lys?Ala?Phe?Leu?Ala?Ala?Val?Leu?Gly?Trp?His?Leu

325?330?335

Ala?Pro?Gly?Thr?Ala?Gln?Ala?Ser?Leu?Ser?Ser?Cys?Ser?Glu?Ser?Ser

340?345?350

Ile?Leu?Thr?Ala?Leu?Glu?Glu?Met?Thr?Gly?Met?Asn?Asp?Leu?Gly?Glu

355?360?365

Arg?Gln?Ser?Phe?Asn?Tyr?Pro?Asn?Lys?Glu?Asp?Val?Gly?Asn?Lys?Ser

370?375?380

Ala

385

<210>11

<211>264

<212>CDS

＜213〉people (human)

<220>

<221>mutagen

＜222〉5 ' ends

＜223〉be used to the to transduce Chemokine Receptors CXCR4 part that has leader sequence of killer cell, SDF-1P2G, the gene nucleic acid sequence-1 of sequence (ND.1)

<400>_11

atgaacgcca?aggtcgtggt?cgtgctggtc?ctcgtgctga?ccgcgctctg?cctcagcgac?60

gggaagggcg?tcagcctgag?ctacagatgc?ccatgccgat?tcttcgaaag?ccatgttgcc?120

agagccaacg?tcaagcatct?caaaattctc?aacactccaa?actgtgccct?tcagattgta?180

gcccggctga?agaacaacaa?cagacaagtg?tgcattgacc?cgaagctaaa?gtggattcag?240

gagtacctgg?agaaagcttt?aaac????????????????????????????????????????264

<210>12

<211>264

<212>CDS

＜213〉people (human)

<220>

<221>mat-peptide

<222>

＜223〉be used to the to transduce Chemokine Receptors CXCR4 part that has leader sequence of killer cell, SDF-1, the gene nucleic acid sequence-2 of sequence (ND.2)

<400>12

atgaacgcca??aggtcgtggt??cgtgctggtc?ctcgtgctga?ccgcgctctg?cctcagcgac?60

gggaag cccg?tcagcctgag?ctacagatgc?ccatgccgat?tcttcgaaag?ccatgttgcc?120

agagccaacg??tcaagcatct??caaaattctc?aacactccaa?actgtgccct?tcagattgta?180

gcccggctga??agaacaacaa??cagacaagtg?tgcattgacc?cgaagctaaa?gtggattcag?240

gagtacctgg??agaaagcttt??aaac????????????????????????????????????????264

<210>13

<211>297

<212>CDS

＜213〉people (human)

<220>

<221>mat-peptide

<222>

＜223〉be used to the to transduce Chemokine Receptors CCR7 part that has leader sequence of killer cell, MIP-3 β or ELC, the gene nucleic acid sequence-1 of sequence (ND.3)

<400>13

atggccctgc?tactggccct?cagcctgctg?gttctctgga?cttccccagc?cccaactctg?60

agtggcacca?atgatgctga?agactgctgc?ctgtctgtga?cccagaaacc?catccctggg?120

tacatcgtga?ggaacttcca?ctaccttctc?atcaaggatg?gctgcagggt?gcctgctgta?180

gtgttcacca?cactgagggg?ccgccagctc?tgtgcacccc?cagaccagcc?ctgggtagaa?240

cgcatcatcc?agagactgca?gaggacctca?gccaagatga?agcgccgcag?cagttaa????297

<210>14

<211>276

<212>CDS

＜213〉people (human)

<220>

<221>mutation

＜222〉5 ' ends

＜223〉be used to the to transduce Chemokine Receptors CCR7 part that has leader sequence of killer cell, MIP-3 β (8-77) or ELC (8-77), sequence (ND.3) gene nucleic acid sequence-2

<400>14

atggccctgc?tactggccct?cagcctgctg?gttctctgga?cttccccagc?cccaactctg?60

agttgctgcc?tgtctgtgac?ccagaaaccc?atccctgggt?acatcgtgag?gaacttccac?120

taccttctca?tcaaggatgg?ctgcagggtg?cctgctgtag?tgttcaccac?actgaggggc?180

cgccagctct?gtgcaccccc?agaccagccc?tgggtagaac?gcatcatcca?gagactgcag?240

aggacctcag?ccaagatgaa?gcgccgcagc?agttaa???????????????????????????276

<210>15

<211>306

<212>CDS

＜213〉people (human)

<220>mutagen

<221>

＜222〉5 ' ends

＜223〉be used to the to transduce Chemokine Receptors CCR7 part that has leader sequence of killer cell, 6CKine (1-79) or SLC (1-79), the gene nucleic acid sequence-3 of sequence (ND.5)

<400>15

atggctcagt?cactggctct?gagcctcctt?atcctggttc?tggcctttgg?catccccagg?60

acccaaggca?gtgatggagg?ggctcaggac?tgttgcctca?agtacagcca?aaggaagatt?120

cccgccaagg?ttgtccgcag?ctaccggaag?caggaaccaa?gcttaggctg?ctccatccca?180

gctatcctgt?tcttgccccg?caagcgctct?caggcagagc?tatgtgcaga?cccaaaggag?240

ctctgggtgc?agcagctgat?gcagcatctg?gacaagacac?catccccaca?gaaaccagcc?300

cagggc

<210>16

<211>405

<212>CDS

＜213〉people (human)

<220>

<221>mat-peptide

<222>

＜223〉killer cell that is used to transduce has part-CCL21 or the SLC of the Chemokine Receptors CCR7 of leader sequence, the gene nucleic acid sequence-4 of sequence (ND 6)

<400>16

atggctcagt?cactggctct?gagcctcctt?atcctggttc?tggcctttgg?catccccagg?60

acccaaggca?gtgatggagg?ggctcaggac?tgttgcctca?agtacagcca?aaggaagatt?120

cccgccaagg?ttgtccgcag?ctaccggaag?caggaaccaa?gcttaggctg?ctccatccca?180

gctatcctgt?tcttgccccg?caagcgctct?caggcagagc?tatgtgcaga?cccaaaggag?240

ctctgggtgc?agcagctgat?gcagcatctg?gacaagacac?catccccaca?gaaaccagcc?300

cagggctgca?ggaaggacag?gggggcctcc?aagactggca?agaaaggaaa?gggctccaaa?360

ggctgcaaga?ggactgagcg?gtcacagacc?cctaaagggc?catag?????????????????405

<210>17

<211>335

<212>CDS

＜213〉people (human)

<220>

<221>mat-peptide

<222>

＜223〉killer cell that is used to transduce has the part of the Chemokine Receptors CCR10 of leader sequence, CCL27 or CTARCK, the gene nucleic acid sequence-1 of sequence (ND 7)

<400>17

Atgaaggggc?ccccaacctt?ctgcagcctc?ctgctgctgt?cattgctcct?gagcccagac?60

cctacagcagc?attcctactg?ccacccagca?ctgcctgctg?tactcagctc?taccgaaag?120

ccactctcag?acaagctact?gaggaaggtc?atccaggtgg?aactgcagga?ggctgacggg?180

gactgtcacc?tccaggcttt?cgtgcttcac?ctggctcaac?gcagcatctg?catccacccc?240

cagaacccca?gcctgtcaca?gtggtttgag?caccaagaga?gaaagctcca?tgggactctg?300

cccaagctga?attttgggat?gctaaggaaa?atgggc???????????????????????????335

<210>18

<211>381

<212>CDS

＜213〉people (human)

<220>

<221>mat-peptide

<222>

＜223〉killer cell that is used to transduce has the part of the Chemokine Receptors CCR10 of leader sequence, CCL28 or MEK, the gene nucleic acid sequence-2 of sequence (ND 8)

<400>18

Atgcagcaga?gaggactcgc?catcgtggcc?ttggctgtct?gtgcggccct?acatgcctca?60

gaagccatac?ttcccattgc?ctccagctgt?tgcacggagg?tttcacatca?tatttccaga?120

aggctcctgg?aaagagtgaa?tatgtgtcgc?atccagagag?ctgatgggga?ttgtgacttg?180

gctgctgtca?tccttcatgt?caagcgcaga?agaatctgtg?tcagcccgca?caaccatact?240

gttaagcagt?ggatgaaagt?gcaagctgcc?aagaaaaatg?gtaaaggaaa?tgtttgccac?300

aggaagaaac?accatggcaa?gaggaacagt?aacagggcac?atcaggggaa?acacgaaaca?360

tacggccata?aaactcctta?t???????????????????????????????????????????381

<210>19

<211>450

<212>CDS

＜213〉people (human)

<220>

<221>mat-peptide

<222>

＜223〉killer cell that is used to transduce has the part of the Chemokine Receptors CCR6 of leader sequence, CCL25 or TECK, the gene nucleic acid sequence-1 of sequence (ND 9)

<400>19

atgaacctgt?ggctcctggc?ctgcctggtg?gccggcttcc?tgggagcctg?ggcccccgct?60

gtccacaccc?aaggtgtctt?tgaggactgc?tgcctggcct?accactaccc?cattgggtgg?120

gctgtgctcc?ggcgcgcctg?gacttaccgg?atccaggagg?tgagcgggag?ctgcaatctg?180

cctgctgcga?tattctacct?ccccaagaga?cacaggaagg?tgtgtgggaa?ccccaaaagc?240

agggaggtgc?agagagccat?gaagctcctg?gatgctcgaa?ataaggtttt?tgcaaagctc?300

caccacaaca?cgcagacctt?ccaagcaggc?cctcatgctg?taaagaagtt?gagttctgga?360

aactccaagt?tatcatcgtc?caagtttagc?aatcccatca?gcagcagtaa?gaggaatgtc?420

tccctcctga?tatcagctaa?ttcaggactg??????????????????????????????????450

<210>20

<211>1155

<212>CDS

＜213〉people (human)

<220>

<221>peptide

<222>

＜223〉be used to the to transduce Chemokine Receptors CCR10 of killer cell, the gene nucleic acid sequence of sequence (ND 10)

<400>20

atggccgcca?ctgcctctcc?gcagccactc?gccactgagg?atgccgatgc?tgagaatagc??60

agcttctatt?actatgacta?cctggatgaa?gtggccttca?tgctctgcag?gaaggatgca??120

gtggtgtcct?ttggcaaagt?cttcctccca?gtcttctata?gcctgatttt?tgtgttgggc??180

ctcagcggga?acctccttct?tctcatggtc?ttgctccgtt?acgtgcctcg?caggcggatg??240

gttgagatct?atctgctgaa?tctggccatc?tccaaccttc?tgtttctggt?gacactgccc??300

ttctggggca?tctccgtggc?ctggcattgg?gtcttcggga?gtttcttgtg?caagatggtg??360

agcactcttt?atactattaa?cttttacagt?ggcatctttt?tcattagctg?catgagcctg??420

gacaagtacc?tggagatcgt?tcatgctcag?ccctaccaca?ggctgaggac?ccgggccaag??480

aacctgctcc?ttgctaccat?agtatgggct?gtgtccctgg?ccgtctccat?ccctgatatg??540

gtctttgtac?agacacatga?aaatcccaag?ggtgtgtgga?actgccacgc?agatttcggc??600

gggcatggga?ccatttggaa?gctcttcctc?cgcttccagc?agaacctcct?agggtttctc??660

cttccactcc?ttgccatgat?cttcttctac?tcccgtattg?gttgtgtctt?ggtgaggctg??720

aggcccgcag?gccagggccg?ggctttaaaa?atagctgcag?ccttggtggt?ggccttcttc??780

gtgctatggt?tcccatacaa?tctcaccttg?tttctgcata?cgctgttgga?cctgcaagta??840

ttcgggaact?gtgaggtcag?ccagcatcta?gactacgcac?tccaggtaac?agagagcatc??900

gccttccttc?actgctgctt?ttcccccatc?ctgtatgcct?tctccagtca?ccgcttccgc??960

cagtacctga?aggctttcct?ggctgccgtg?cttggatggc?acctggcacc?tggcactgcc??1020

caggcctcat?tatccagctg?ttctgagagc?agcatactta?ctgcccttga?ggaaatgact??1080

ggcatgaatg?accttggaga?gaggcagtct?gagaactacc?ctaacaagga?ggatgtgggg??1140

aataaatcag?cctga???????????????????????????????????????????????????1155

The above, it only is preferred embodiment of the present invention, be not that the present invention is done any pro forma restriction, every foundation technical spirit of the present invention all still belongs in the scope of technical solution of the present invention any simple modification, equivalent variations and modification that above embodiment did.

Claims (10)

1, the natural killer cell of transgene expression cell chemotactic factor, it is characterized in that, it reduces when using in vivo and loses for expressing special chemokine, Chemokine Receptors binding substances or the CCR10 of human tissue organ, improves this cell bioavailability in vivo.

2, the natural killer cell of transgene expression cell chemotactic factor according to claim 1, it is characterized in that described expression special chemokine, Chemokine Receptors binding substances or the CCR10 of human tissue organ comprises the homologue and the modifier of the gene shown in the sequence 1 and protein sequence and these sequences thereof.

3, the natural killer cell of transgene expression cell chemotactic factor according to claim 1, it is characterized in that special chemokine, the Chemokine Receptors binding substances of described expression human tissue organ comprises: the part chemokine of the part chemokine of Chemokine Receptors CXCR4, the part chemokine of CCR6, CCR7, the part chemokine of CCR10; Special chemokine, Chemokine Receptors binding substances or the CCR10 of described human tissue organ is that natural killer cell itself is not expressed or seldom expressed.

4, the natural killer cell of transgene expression cell chemotactic factor according to claim 1, it is characterized in that, the cell of described expression chemokine comprises: the human natural killer cell of NK-92, TALL-104, these cell surfaces have the CD56 molecule, and have the natural killer function.

5, the natural killer cell of transgene expression cell chemotactic factor according to claim 1 is characterized in that, the part chemokine of described CXCR4 comprise SDF-1 with CXCR4 bonded protein; The part chemokine of CCR6 comprise MIP-3 α with CCR6 bonded protein; The part chemokine of CCR7 comprise SLC and ELC with CCR7 bonded protein; The part chemokine of CCR10 comprise CCL27 and CCL28 with CCR10 bonded protein.

6, a kind of as claimed in claim 1 through transgenosis and the preparation method of the natural killer cell of express cell chemokine is characterized in that it comprises the foundation of (1) seed cell; (2) enlarged culturing of cell; (3) pair cell is identified; (4) the pair cell strain suppresses fissional processing; (5) packing of pair cell product and processing.

7, the application in the natural killer cell of the described transgene expression cell chemotactic factor of claim 1 preparation treatment tumour, virus and infectation of bacteria, tissue transplantation repulsion, the autoimmune disease medicine.

8, through transgenosis and the natural killer cell of express cell chemokine beyond other somatocyte, it is characterized in that, it is for expressing the special chemokine of human tissue organ, the somatocyte of Chemokine Receptors binding substances or CCR10, when using this somatocyte in vivo, this somatocyte is lost few, bioavailability height in vivo; Chemokine wherein and Chemokine Receptors binding substances comprise the part chemokine of Chemokine Receptors CXCR4, the part chemokine of CCR6, the part chemokine of CCR7, the part chemokine of CCR10 and CCR10; The part chemokine of CXCR4 be meant comprise SDF-1 with CXCR4 bonded protein; The part chemokine of CCR6 be meant comprise MIP-3 α with CCR6 bonded protein; The part chemokine of CCR7 be meant comprise SLC and ELC with CCR7 bonded protein; The part chemokine of CCR10 be meant comprise CCL27, CCL28 with CCR10 bonded protein; Describedly comprise gene shown in the sequence 1 and protein sequence, and the homologue of these sequences and modifier; Other somatocyte beyond the described killer cell is meant in input cell mode treats used everyone somatocyte, comprises bone marrow stem cell, by the various blood leucocytes that bone marrow stem cell is divided in vitro culture, islet cells.

9, claim 8 described through transgenosis and the killer cell of express cell chemokine beyond other somatic application, it is characterized in that, this transgenosis cell strain can be used for preparation and removes tumour, virus and infectation of bacteria, tissue transplantation is repelled, the product of autoimmune disease, medicine or contain the product mixture of above-mentioned genetically modified cell strain.

10, a kind of claim 8 is described through transgenosis and the preparation method of other human body cell beyond the killer cell of express cell chemokine is characterized in that it comprises the foundation of (1) seed cell; (2) enlarged culturing of cell; (3) pair cell is identified; (4) the pair cell strain suppresses fissional processing; (5) packing of pair cell product and processing.

Images