CN1243830C - Novel mouse CXC chemokine receptor - Google Patents

Abstract

The present invention relates to a DNA for encoding polypeptide of all or partial amino acid sequences loaded in the serial number 17 in a sequence table or polypeptide comprising the polypeptide, polypeptide having the receptor activity of being combined with mouse PBSF/SDF-1 and cells for expressing the polypeptide and human CD4 proteins and a method for sieving AIDS pathogenesis inhibitors and HIV-1 infection inhibitors by applying the cells as the characteristics, wherein any one kind of polypeptide has the receptor activity of being combined with mouse PBSF/SDF-1. Thereby, the present invention provides a method for sieving new mouse CXC chemotactic factor receptor genes and HIV-1 infection inhibitors which are useful to medicaments for treating AIDS and action mechanisms of HIV-1 infection, etc.

Description

Mouse CXC chemokine receptor

Technical field

The present invention relates to novel mouse CXC chemokine receptor and mouse Chemokine Receptors gene.More particularly, relate to this genes encoding polypeptide, contain this expression carrier, changed the transformant of this expression vector over to, the monoclonal antibody of anti-described polypeptide.Also relate to the transformant of using the front and produce the method for described polypeptide.The screening method that also relates to chemokine agonist or antagonist, and the screening method of AIDS morbidity inhibitor or HIV-1 infection inhibitor.

Technical background

When because of bacterium or virus infection, physical property or the chemical wound, the autoimmune disorder that cause, anaphylactic diseases etc. become inducement and when causing tissue injury, the inflammatory reaction that is attended by symptoms such as rubescent, edema, heating, pain can be brought out, the gathering and the infiltration of tip blood leukocytes can be observed in the inflammation part.According to the difference of disease, also different in the leukocytic kind that inflammation part soaks into.Mainly cause the gathering and the infiltration of neutrophil leucocyte during acute inflammations such as common infectation of bacteria, the calmness of immunocomplex, wound, and tubercle bacillus affection, the infection of typhoid fever bacterium and delayed type hypersensitivity mainly cause monocytic gathering and infiltration, virus infection mainly causes lymphocytic gathering and infiltration, and eosinophilic granulocyte and basophilic granulocyte soak into (Baggioloni when following immediate hypersensitivity or parasitic infection, M. etc., immunity today, 15,127-133 (1994)).Discovered in recent years has to a certain degree optionally polypeptide chemokine to the white corpuscle of migration, and it has 4 distinctive cysteine residues.Because the family that their to be aminoacid sequences have homologys, biological activity also are relative to each other, so called after chemokine (Chemokine; Have chemical attraction and cytokine activity) (Lindley.I.J.D. etc., immunity today, 14-24 (1993)).

4 cysteine residues of chemokine are connecting into disulfide linkage between the 1st and the 3rd residue and between the 2nd and the 4th residue respectively.Whether all can on biological activity, find its feature because between the 1st and the 2nd cysteine residues, no matter comprise other amino acid, therefore respectively its subfamily is called CXC chemokine and CC chemokine, to distinguish (Baggioloni, M. etc., the immunology progress, 55,97-179 (1994)).

Up to the present the CXC chemokine of having found is PBSF/SDF-1, IL-8 (Yoshimura T. etc., institute of NAS periodical, 84,9233-9237 (1987)), NAP-2 (Walz.A. etc., biological chemistry biophysical research communication, 159,969-975 (1989)), NAP-4, GRO α (Richmondo, A etc., cellular biochemistry magazine, 36,185-198 (1988)), GRO β (Haskill, S. etc., institute of NAS periodical, 87,77732-7736 (1990)), GRO γ (Haskill, S. etc., (1990) as preceding), GCP-2 (Proost, P. etc., Journal of Immunology, 150,1000-1010 (1993), ENA-78 (Wayz, A. etc., The Journal of Experimental Medicine, 174,1355-1362 (1991)), PF-4 (Deuel, T.F. etc., institute of NAS periodical, 74,2256-2258 (1977)), people CXCR4/fusin/HUMSTSR (Feng, Y. etc., science, 272,872-877 (1996) and IP-10 (Dewald.B. etc., Immunol.Lett, 32,81-84 (1992)).

The CC chemokine is MCP-1 (Yoshimura.T. etc., Journal of Immunology, 142,1956-1962 (1989), MCP-2 (Chang, H.C. etc., international immunology, 1,388-397 (1989)), MCP-3 (Van Damme, J. etc., The Journal of Experimental Medicine 176,59-65 (1992)), MIP-1 α (Obaku, K. etc., biochemical magazine, 99,885-894 (1986)), MIP-1 β (Lipes, M.A. etc., institute of NAS periodical, 85,9704-9708 (1988)), RANTES (Schall, T. etc., Journal of Immunology, 141,1018-1025 (1988), I-309 (Miller, M.D. etc., Journal of Immunology, 143,2907-2916 (1989)) and eotaxin (Jose, P. etc., The Journal of Experimental Medicine,, 179,881-887 (1994)).

Nearly all CXC chemokine has chemotactic activity to neutrophil leucocyte but monocyte is not had chemotactic activity.In addition, nearly all CC chemokine has chemotactic activity to monocyte but neutrophil leucocyte is not had chemotactic activity.Other has report, and number of C XC and CC chemokine have chemotactic activity to other white corpuscles such as eosinophilic granulocyte, basophilic granulocyte, lymphocytes.Though find RANTES, MIP-1 α, MCP-1 and CXC chemokine IL-8 in the CC chemokine lymphocyte is had chemotactic activity, they all are not the special chemokines of lymphocyte.

Mouse PBSF/SDF-1 originally promotes the factor by mouse bone marrow cells mesenchymal cell strain PA6 excretory as the propagation of mouse B precursor cell and the CXC chemokine that identifies, and reported its aminoacid sequence (Fig. 1) (Nagasawa, T. etc., institute of NAS periodical, 91,2305-2309 (1994)).In addition, illustrate again recently to the human T lymphocyte also have strong chemotactic activity (Bleul, C. etc., The Journal of Experimental Medicine 184,1101-1110).

Acceptor to chemokine has also carried out multiple research, it is the special acceptor of IL-8 that report IL-8RA is arranged, IL-8RB is the acceptor of IL-8 and other CXC chemokine, CC CKRI is MIP-1 α and the special acceptor of RANTES, CC CKR2A is the special acceptor of MCP-1, CC CKR2B is MCP-1 and the special acceptor of MCP-3, etotaxin, MCP-3, the special acceptor of PANTES are CC CKR3 (Combadiere, C. etc., the biology magazine, 270,16491-16494 (1995), also having CC CKR5 is MIP-1 α, the special acceptor of MIP-1 β, RANTES.In addition, CXR4/Fusin/HUMSTSR is identified out as the acceptor of people CXC chemokine SDF-1 recently.

In addition, illustrate the CC CKR5 in the above-mentioned Chemokine Receptors, CC CKR2B, CC CKR3 and CXCR4/fusin/HUMSTSR and be present in the effect that protein C D4 synergy on the cytolemma has the HIV-1 acceptor, and the part of each acceptor can suppress the HIV-1 infection by these acceptors.

The infection of the HIV-1 of 2 kinds of different in kinds and Causative virus-HIV-1 of AIDS is relevant with the morbidity of AIDS.The main propagation that infects monocyte, scavenger cell, the lymphocytic close monocarpotic cellularity HIV-1 participation infection of T and the interim human body inner virus of latent infection mainly infects the lymphocytic pro t cell HIV-1 of T and reduces relevant with the morbidity of AIDS with T lymphocyte number purpose.2 kinds of acceptors are necessary for above-mentioned 2 kinds of HIV-1 cells infecteds.A kind of is the CD4 protein of one of cell membrane protein, and it is the coreceptor of above-mentioned 2 kinds of HIV-1.Another kind is the protein that is called coreceptor, has the words of acceptor with CD4 protein synergy, and it is above-mentioned 2 kinds of acceptors that HIV-1 is special separately.

The main coreceptor that confirms close monocarpotic cellularity HIV-1 recently is CC-chemokine receptor CC CKR5, the coreceptor of pro t cell HIV-1 is CXC Chemokine Receptors people CXCR4/fusin/HUMSTSR, confirm in addition, the part MIP-1 α of CC CKR5, MIP-1 β, RANTES can suppress the infection of close monocarpotic cellularity HIV-1, the part people PBSF/SDF-1 of people CXCR4/fusin/HUMSTSR can suppress the infection of pro t cell HIV-1, and this shows that above-mentioned Chemokine Receptors can become the target of HIV-1 infection inhibitor.

On the other hand, which functional zone of people CXCR4/fusin/HUMSTSR are that the infection of property HIV-1 is necessary to pro t cell, up to the present identify as yet.CXC Chemokine Receptors-people CXCR4/fusin/HUMSTSR has 7 acceptors of striding the film district, thinks that the three-dimensional arrangement that is made of functional zone, 4 extracellulars pair is important with combining of part or HIV-1.Make keeping as the CXCR4/fusin/HUMSTSR varient of the three-dimensional arrangement of acceptor is necessary for the functional zone of identifier CXCR4/fusin/HUMSTSR.The functional zone of identifier CXCR4/fusin/HUMSTSR are extremely useful for the exploitation of HIV-1 infection inhibitor.

In addition, needed cell intrinsic factor is identical when illustrating virus infection, illustrates to cause that the species specific mechanism of HIV-1 is very important for the animal pattern that exploitation HIV-1 infects.Although mouse is easy processing, to consume lowly, characteristic is by the good laboratory animal of sets forth in detail, and the report that infects HIV-1 is not arranged.

There are several barriers relevant in the mouse cell with the HIV-1 virus infection.Initial barrier is present in the stage that virus is attached to mouse cell.People CD4 is in conjunction with HIV-1, and mouse CD4 is not joined to HIV-1.But, can illustrate from present research, external, when the cell expressing people CD4 of the mouse cell strain that comprises the T cell strain, can cause the cytotropic absorption of HIV but can not cause to enter.This result shows, the mouse cell of expressing human CD4 is not supported entering of virus, and also there is the acceptor of the necessary and human specific of film fusion (generation when virus enters) in this hint except that CD4, and its molecule does not exist on mouse cell.

Can see that HIV-1 is because of the different infection abilities to the CD4 positive cell of strain difference to some extent.Some strain ranges close monocyte or scavenger cell strain (M-tropic) because infect monocyte, and other strain ranges pro t cell strain strain (T-tropic) because of infecting the T cell strain.

Along with the carrying out that HIV-1 infects, the close monocarpotic cellularity virus of often seeing in initial infection is replaced by pro t cell strain venereal disease poison.Report in 1996, it is necessary that 7 G protein binding acceptor-CXCR4/fusin that stride the film district enter the CD4 positive cell to pro t cell HIV-1.This result impels the inventor to detect the CXCR4 relevant with the function of receptors that enters as virus whether to have specific specificity.

Disclosure of the Invention

The inventor has separated the acceptor mouse CXC R4 as the mouse PBSF/SDF-1 of one of CXC chemokine, illustrates that it is consistent with the aminoacid sequence 90% of people CXCR4.The inventor has set up personnel selection CD4 and mouse CXC R4 cells transfected, and whether acceptor-people the CXCR4 that has detected HIV-1 is as being present in the barrier molecule that mouse cell stops HIV-1 to enter.

Therefore the purpose of this invention is to provide researchs such as mechanism of action that medicine and HIV-1 to AIDS infect useful, the novel mouse CXC chemokine receptor gene, the polypeptide of this coded by said gene, this expression carrier, the transformant that contains this expression vector, the monoclonal antibody of anti-this polypeptide, the production method of this polypeptide, and the agonist of this polypeptide or antagonist, and the screening method of HIV-1 infection inhibitor.

Specifically, present inventors have carried out studying in order to solve aforesaid problem thoroughgoing and painstakingly, and the mouse B precursor cell strain DW34 that the result strengthens from mouse PBSF/SDF-1 dependency propagation has successfully cloned novel mouse Chemokine Receptors gene.Find that also the cell of expressing mouse CXC R4 and people CD4 merges these cell infection pro t cell strains HIV-1 strain with the proteinic cell of env that expression derives from pro t cell strain HIV-1.From these results can draw such conclusion: CXCR4 be not be present in mouse cell entering of pro t cell HIV-1 had species specific barrier.Clone by the embedded virus of the pro t cell strain HIV-1 that the zone replaced of close monocarpotic cellularity HIV-1 by env zone or V3 zone in addition and do not infect this fact of cell of expressing mouse CXC R4 and people CD4, show that the V3 ring of HIV-1 envelope protein is necessary to the entering of HIV-1 that mouse CXC R4 mediates.Finished the present invention based on these discoveries.

That is to say that main aim of the present invention is:

[1] DNA of coded polypeptide, the polypeptide that this polypeptide is made up of the aminoacid sequence of record in the sequence number 17 of all or part of sequence table, or contain the polypeptide of top described polypeptide, wherein any polypeptide has and mouse PBSF/SDF-1 may the bonded receptor active;

[2] DNA of coded polypeptide, this polypeptide be in amino acid whose whole or a part of aminoacid sequences of record in the sequence number 17 of sequence table one or more aminoacid deletion, interpolation, insertion or replace at least a generation, and have with mouse PBSF/SDF-1 and combine possible receptor active;

[3] a kind of DNA, it is whole or its partial sequence of base sequence that comprises by record in the sequence number 1 of sequence table, or comprises the DNA of above-mentioned DNA, wherein any DNAs encoded polypeptides have can with mouse PBSF/SDF-1 bonded receptor active;

[4] a kind of DNA, it is all or part of DNA of the base sequence of record in the sequence number 1 of sequence table, or comprise the DNA of this DNA, one or more base deletion, interpolation, insertion or replacement have at least a kind of situation to take place among these DNA, and wherein any DNAs encoded polypeptides has with mouse PBSF/SDF-1 and combines possible receptor active;

[5] a kind of DNA, the DNA that it can be hybridized with the DNA that above-mentioned [1]～[4] are put down in writing in each under stringent condition, and can encode and have the polypeptide that combines possible receptor active with mouse PBSF/SDF-1;

[6] a kind of DNA encoded polypeptide of putting down in writing in each by above-mentioned [1]～[5], wherein any polypeptide has and mouse PBSF/SDF-1 bonded receptor active;

[7] one peptide species, it comprises all or part of aminoacid sequence by record in the sequence number 17 of sequence table, perhaps comprises the polypeptide of this polypeptide, and wherein any polypeptide has and mouse PBSF/SDF-1 bonded receptor active;

[8] one peptide species, it derives from the amino-acid residue disappearance more than 1 in all or part of aminoacid sequence of record in the sequence number 17 of sequence table, add, insert or replace in take place a kind ofly at least, wherein said polypeptide has and mouse PBSF/SDF-1 bonded receptor active;

[9] polypeptide of above-mentioned [6]～[8] in each, it derives from mouse B precursor cell strain DW34;

[10] comprise the expression vector of the DNA of above-mentioned [1]～[5] in each;

[11] change the expression vector in top [10] over to host and transformant;

[12] transformant in above-mentioned [11], wherein the host is the cells of mamma animals strain;

[13] a kind of production has the method with the polypeptide of mouse PBSF/SDF-1 bonded receptor active, it is characterized in that cultivating under the condition that the expression vector in above-mentioned [10] may express the transformant in above-mentioned [11] or [12];

[14] monoclonal antibody of the polypeptide of anti-above-mentioned [6]～[8] in each;

[15] a kind of medicinal compositions, it contains mouse PBSF/SDF-1, can be used as the inhibitor of AIDS morbidity or as the HIV-1 infection inhibitor;

[16] express above-mentioned [6]～[9] in each polypeptide and the cell of human CD 4 protein matter;

[17] a kind of method of screening AIDS morbidity inhibitor or HIV-1 infection inhibitor is characterized in that comprising following step:

(a) will express the cell of the cell of the polypeptide of each record in above-mentioned [6]～[9] or above-mentioned [16] record, human T-cell's directive property HIV-1 and as the material of screening object mix, the mixture that obtains of incubation then, and

(b) analyzing HIV-1 locatees in this cell;

[18] method of above-mentioned [17] is wherein analyzed the HIV-1 localization step and is used with the monoclonal antibody of anti-relatives T cell strain HIV-1 and carry out;

[19] screening method of AIDS morbidity inhibitor or HIV-1 infection inhibitor is characterized in that comprising following step:

(a) will express the cell of above-mentioned [6]～[9] polypeptide described in each or the cell of above-mentioned [16] record, express the cell of HIV-1 envelope protein; Mix with the material that becomes the screening object, the mixture that obtains of incubation then, and

(b) measure the cell of expression HIV-1 envelope protein matter and the confluent level of this cell;

[20] AIDS morbidity inhibitor or HIV-1 infection inhibitor, the perhaps screening method of the agonist of this PBSF/SDF-1 or antagonist is characterized in that:

(a) will express the cell of the polypeptide of putting down in writing in each above-mentioned [6]～[8] or the cell of above-mentioned [16] record, mouse or people PBSF/SDF-1 and the material that becomes the screening object mix, the mixture that obtains of incubation then, and

(b) measure this intracellular calcium ion concn, and/or it is active with combining of this mouse or people PBSF/SDF-1 to measure polypeptide expressed;

[21] [20] described method above, wherein this antagonist is the releasing agent of hemopoietic stem cell;

[22] a kind of test kit, it comprises cell of expressing above-mentioned [6]～[9] polypeptide in each or the cell that above-mentioned [16] are said, is used to detect AIDS morbidity or HIV-1 and infects;

[23] detect the method that AIDS morbidity or HIV-1 infect, it is characterized in that comprising:

(a) will express cell of record in the cell of the polypeptide of putting down in writing in each above-mentioned [6]～[9] or above-mentioned [16], and suspect the patients serum who has infected HIV-1, hemocyte or blood mix, the mixture that obtains of incubation then, and

(b) analyze the distribution of HIV-1 in this cell, or detect the confluent level of HIV-1 cells infected and this cell.

The accompanying drawing summary

Fig. 1 shows the aminoacid sequence figure of the mouse PBSF/SDF-1 that the cDNA base sequence of mouse PBSF/SDF-1 and this base sequence are coded.

Fig. 2 represents to carry out electrophoretic figure as a result with the Northern blotting among the embodiment 2, and A is the result of the mRNA of mouse tissue, and B is the result of the mRNA of mice embryonic.

Fig. 3 is the figure that shows the result of embodiment 6.Among the figure, transverse axis is represented elapsed time, and the longitudinal axis is represented the ratio [(fluorescence intensity of 340nm)/(fluorescence intensity of 380nm)] of fluorescence intensity.The cell that uses is the Chinese hamster ovary celI of not expressing Chemokine Receptors.

Fig. 4 represents the result of embodiment 6.Among the figure, transverse axis is represented the process of time, and the longitudinal axis is represented the ratio [(fluorescence intensity of 340nm)/(fluorescence intensity of 380nm)] of fluorescence intensity.The cell that uses is the Chinese hamster ovary celI of expressing human Chemokine Receptors CC CKR2B.

Fig. 5 represents the result of embodiment 6.Among the figure, transverse axis is represented effluxion, and the longitudinal axis is represented the ratio [(fluorescence intensity of 340nm)/(fluorescence intensity of 380nm)] of fluorescence intensity.Employed cell is the Chinese hamster ovary celI of expressing mouse chemokine (PBSF/SDF-1) acceptor (mouse CXC R4).

Fig. 6 is expression embodiment 6 results' figure.Among the figure, transverse axis is represented the process of time, and the longitudinal axis is represented the ratio [(fluorescence intensity of 340nm)/(fluorescence intensity of 380nm)] of fluorescence intensity.The cell that uses is the Chinese hamster ovary celI of expressing human Chemokine Receptors CXCR4/fusin/HUMSTSR.

Fig. 7 is expression embodiment 6 results' figure.Transverse axis is represented elapsed time among the figure, and the longitudinal axis is represented the ratio [(fluorescence intensity of 340nm)/(fluorescence intensity of 380nm)] of fluorescence intensity.The cell that uses is the Chinese hamster ovary celI of expressing mouse CXC R4.

Fig. 8 is the figure of expression mouse CXC R4 by the env protein supporting film fusion of relatives T cell strain HIV-1.With the recombinant vaccinia virus infection target cell NIH3T3 of the ω subunit of semi-lactosi of expressing human CD4, T7 polysaccharase, β-(gal).Infect back mouse CXC R4, people CXCR4, these cells of people CCR5 transfection.Derive from the env protein of NL432 or SF162 and the recombinant vaccinia virus infection effector cell HeLaS3 of beta galactose alpha subunit with expression.After these cells were carried out cytogamy, the fusion product that obtains was used for β-gal and analyzes.

Fig. 9 represents that mouse CXC R4 supports the infection of relatives T cell strain HIV-1 virus.Personnel selection CD4 and each Chemokine Receptors (mouse CXC R4, people CXCR4, people CCR5, people CCR2b) transfection SW480 (A) cell, after the NL432 strain of infected by HIV-1, IIIB strain, the SF162 strain, its cytolysis thing is used for β-gal and analyzes respectively.

Figure 10 shows that mouse CXC R4 supports the infection of relatives T cell strain HIV-1 virus.Personnel selection CD4 and each Chemokine Receptors (mouse CXC R4, people CXCR4, people CCR5 and people CCR2b) infect HOS cell (B).The transfectional cell that is subjected to infects with NL432 strain, IIIB strain and the SF162 strain of HIV-1 respectively.Then, the cell lysate of every kind of cells infected that obtains carries out β-gal analysis.

Figure 11 is the figure that expression mouse CXC R4 supports relatives T cell strain HIV-1 virus infection.Personnel selection CD4 and each Chemokine Receptors (mouse CXC R4, people CXCR4, people CCR5, people CCR2b) transfection U87MG cell (C), the transfectional cell that obtains infect after the NL432 strain, III B strain, SF162 strain of HHIV-1 its cell lysate respectively and are used for β-gal and analyze.

Figure 12 is the mode chart of the chimeric provirus clone of expression structure.The env of SF162 or V3 ring are incorporated in the proviral DNA of relatives T cell strain HIV-1NL432 (E:EcoRI, Ba:BamHI, St:StuI, Nh:NheI).

Figure 13 represents that it is necessary that the V3 ring of envelope protein gp120 enters the HIV-1 by mouse CXC R4.Infect the SW480 cell of acceptor shown in expressing human CD4 and the figure with NL432 strain, SF162 strain and chimeric provirus-NL432env-162, the NL432V3-162 of HIV-1.

The optimum implementation of invention

1. DNA of the present invention

DNA of the present invention is not so long as the DNA of the acceptor (mouse CXC R4) of encoding murine novel C XC Chemokine Receptors-mouse PBSF/SDF-1 has specific restriction, particularly, and shown in following DNA.

1) DNA of coded polypeptide, this polypeptide comprises the aminoacid sequence of being put down in writing by sequence number 17 in all or part of sequence table, or comprises the polypeptide of this polypeptide, and wherein any polypeptide has and mouse PBSF/SDF-1 bonded receptor active.

2) DNA of coded polypeptide, this polypeptide be in whole or its partial amino-acid series of the aminoacid sequence of record in the sequence number 17 of sequence table one or more the amino-acid residue disappearance, add, insert or the situation of replacement has a speciogenesis at least, wherein any polypeptide has and mouse PBSF/SDF-1 bonded receptor active.

3) a kind of DNA, it is the DNA that is made of all or part of base sequence of putting down in writing in the sequence number 1 of sequence table, or contains the DNA of this DNA, wherein any DNAs encoded polypeptides has and mouse PBSF/SDF-1 bonded receptor active.

4) a kind of DNA, it is the DNA of all or part of base sequence of record in the sequence number 1 of sequence table, or contain the DNA of this DNA, wherein the situation of the base deletion more than 1, interpolation, insertion or replacement has a speciogenesis at least, and wherein the polypeptide of any dna encoding has and mouse PBSF/SDF-1 bonded receptor active.

5) a kind of DNA, it is can be with above-mentioned 1 under stringent condition)～4) DNA that DNA in each is hybridized, coding has the polypeptide that combines possible receptor active with mouse PBSF/SDF-1.

In addition, 2) " disappearance of one or more amino-acid residue, interpolation, insertion or the replacement " said in do not have specific restriction, for example refers to disappearance, interpolation, insertion or the replacement of one or more amino-acid residues.Here " several " that said refer to, as the number below 10.Have 4 again) in the degree of DNA base deletion of the present invention, interpolation, insertion or replacement be one or more bases, preferred 1～several.Here said " several " refer to, as the number below 10.In addition, if the function of polypeptide expressed or activity, so also comprise generation chemistry or biochemical change, perhaps non-natural or deutero-amino-acid residue and base basically in same level.

The separation of DNA of the present invention can be carried out like this: by the base sequence of homology is arranged between the known Chemokine Receptors of pcr amplification, screen the cDNA library of mouse etc. as probe with this amplified fragments.

The experimental technique that can use in the present invention is general experimental methods of molecular biology (DNA electrophoresis, from glue, reclaim the DNA that goes out by electrophoretic separation, link host's conversion, the cultivation of recombinant host, the preparation of plasmid DNA, the enzyme of DNA Restriction Enzyme is cut, the radiation linear marker of DNA etc.), for example adopt and resemble molecular cloning the 2nd edition (Maniatis etc., cold spring harbor laboratory, New York (1989)) those skilled in the art are well-known for method, these methods of being put down in writing.

Applied primer is to form on the basis of aminoacid sequence conservative in the Chemokine Receptors of having reported among the PCR, for example, 5 ' end of the condensing forward primer of the dna sequence dna of the aminoacid sequence of striding diaphragm area the 2nd of coding adds suitable Restriction Enzyme site, and the 5 ' end of condensing reverse primer of striding the dna sequence dna of film region amino acid sequence the 7th of coding adds suitable Restriction Enzyme site.These primers can synthesize with dna synthesizer.

CDNA clones applied mouse mRNA, and available commercially available mRNA purifying obtains with test kit purifying from mouse B precursor cell strain DW34 cells such as (professor Xi Chuan by the Kyoto University provide).

In addition, the dna fragmentation of using the cDNA derive from mouse CXC R4 can carry out the clone of mouse gene group DNA.

The base sequence of the base sequence of gained cDNA and genomic dna is carried out the nucleic acid homology retrieval, as reference GenBank/EMBL/DDBJ dna sequence data storehouse, the deducibility gained cDNA Chemokine Receptors of whether encoding thus.The base sequence of gained cDNA is represented in the sequence number 1 of sequence table.In addition, because the 120th～the 1196th base sequence is the longest open reading frame in the sequence number 1 of sequence table, therefore use DNA SIS (Hitachi), BLAST (Altschul.F. etc. at databases such as GenBank, EMBL, DDBJ, the molecular biology magazine, 215,403-410) supervisor, the aminoacid sequence (sequence number 17 of sequence table) of inferring on the basis of the base sequence of this open reading frame is carried out homology search, can further detect the polypeptide of dna encoding of the present invention.

The result infers that the polypeptide with aminoacid sequence that sequence number 17 is put down in writing in the sequence table is to comprise distinctive 7 the tripolymer G protein coupled receptors of striding the film district of Chemokine Receptors.In addition, the CXCR4/fusin/HUMSTSR of reference as a result that compares with the aminoacid sequence of known CXC Chemokine Receptors is the most similar (homology 90%).

In addition, have the receptor active of chemokine (mouse PBSF/SDF-1) and the activity that intracellular calcium concentration rises because express the cell of DNA of the present invention, so can understand the mouse transforming factor acceptor that dna encoding of the present invention is novel, the protein called after mouse CXC R4 that this DNA is coded.

So-called " chemokine " refer to as previously mentioned in the inducement material of white corpuscle to inflammatory reaction local display chemotactic activity, and the white corpuscle of migration is had selectivity to a certain degree and has the family of the polypeptide of distinctive 4 cysteine residues.There are dependency in their aminoacid sequence and biological activity.4 cysteine residues of chemokine respectively between the 1st and the 3rd residue and between the 2nd and the 4th residue with disulfide-bonded.Contain between the 1st and the 2nd cysteine residues 1 other amino acid whosely do not contain other amino acid whose chemokine " CC chemokine " to be different from for " CXC chemokine ".The known chemokine of CC in the ordinary course of things chemotactic monocyte is the chemotactic neutrophil leucocyte not, CXC chemokine chemotactic neutrophil leucocyte and chemotactic monocyte not.

" Chemokine Receptors " is meant and above-mentioned chemokine specificity bonded cell membrane protein family.Chemokine Receptors has aminoacid sequence and structural dependency.Chemokine Receptors all have the Visual purple family characteristic 7 membrane spaning domains and with tripolymer G binding domains of proteins.Chemokine Receptors can be divided into 2 subgroups according to specificity to part.With the CXC chemokine specificity bonded in the above-mentioned chemokine be " CXC Chemokine Receptors ", with CC chemokine specificity bonded for " CC-chemokine receptor " to show difference.Generally speaking, in the time of Chemokine Receptors and part bonded separately, the effect of rising intracellular calcium concentration is arranged.Illustrate Chemokine Receptors recently and not only have activity, and have and be present in the synergistic activity of the molecule that is called CD4 on the cytolemma as the HIV-1 acceptor as Chemokine Receptors.

In this specification sheets, can measure receptor active, such as following mensuration at mouse PBSF/SDF-1.

With ¹²⁵The I mark is for example used the reagent of BOLTON-HUNTER, or with the part PBSF/SDF-1 polypeptide of enzyme labelling mouse CXC R4 such as alkaline phosphatase.The PBSF/SDF-1 peptide of mark joined to express have in the cell suspension of receptor active polypeptide, cultivate at a certain temperature.After cleaning, determine with the amount of cell bonded PBSF/SDF-1 peptide, therefore to measure receptor active by measuring labelled amount.Here applied cell has, mouse B precursor cell strain DW34 for example, human fetal kidney cell line 293 cells, perhaps derive from Chinese hamster ovary, carried out expressing Chinese hamster ovary celI that mouse CXC R4 handles etc.

In addition, it is active that polypeptide of the present invention preferably has the intracellular calcium concentration that can raise when combining with part.The activity of saying is such as can followingly measuring.

Clean the cell of the above-mentioned determination of activity object polypeptide of expression with damping fluid after, (for example, (20mM Hepes comprises 125mM NaCl, 5mM KCl, 1mM MgCl to HBSS among the pH7.4 to be suspended to suitable damping fluid ₂, 0.5mM glucose and 0.1%BSA) etc.) in.Add the fluorescent reagent that influenced by intracellular calcium concentration again and cultivate, obtain labeled cell.Clean the cell of mark with damping fluid after, be suspended in the suitable damping fluid, the variation of fluorescence intensity can be measured activity when becoming the chemokine of part by adding.

When for example using fluorescent reagent fura-PE3AM (fluorescence experiments chamber, Texas), be 340nm and 380nm in excitation wavelength, wavelength of fluorescence is 510nm, and reaction is to measure under 0.5 second the condition.Ask the ratio of " fluorescence intensity of excitation wavelength 340nm " and " fluorescence intensity of excitation wavelength 380nm " then.Make because of the adding of chemokine when intracellular calcium concentration rises in the cell of determination object, can see that the ratio of this fluorescence intensity rises.Can confirm the specificity of acceptor by adding different types of chemokine in addition to part.

In addition, confirm the existence of the mRNA of mouse CXC R4, use common special mRNA detection method and carry out.For example, use sense-rna or cDNA and make probe, the method by Northern engram analysis or in situ hybridization can detect mRNA.Perhaps, change mRNA into cDNA with reversed transcriptive enzyme after, carry out PCR by suitable combination of primers and can detect mRNA.

2. polypeptide of the present invention

Polypeptide of the present invention comprises, and is for example as follows:

1) by DNA encoded polypeptide of the present invention, has the polypeptide that combines possible receptor active with mouse PBSF/SDF-1.

2) peptide species, it is the polypeptide that is made of all or part of aminoacid sequence in the sequence number 17 of sequence table, or comprises the polypeptide of this polypeptide, wherein any polypeptide has and mouse PBSF/SDF-1 bonded receptor active.

3) peptide species, it is in all or part of aminoacid sequence of aminoacid sequence of sequence number 17 of sequence table, one or more amino-acid residue disappearance, interpolation, insertion or replacement have at least a speciogenesis, wherein said polypeptide to have and mouse PBSF/SDF-1 bonded receptor active.

4) above-mentioned 1)～3) polypeptide in each, it derives from mouse B precursor cell strain DW34.

In embodiment 3) in, the degree of the disappearance of amino-acid residue, interpolation, insertion or replacement is one or more in the polypeptide of the present invention, so long as have and mouse PBSF/SDF-1 bonded receptor active, the number of sudden change is unrestricted.For example, 1～several sudden changes.Here " several " that said refer to, for example the number below 10.In addition, if the function of polypeptide or activity basically in same level, so also comprise chemistry or biochemical change take place or non-spontaneous generation or deutero-amino-acid residue.

In addition, polypeptide of the present invention is preferably from mouse B precursor cell strain DW34's.

The existence of polypeptide of the present invention can be used the detection method of conventional specific protein and be confirmed.For example, use the special antibody of mouse CXC R4.Immunosedimentation by routine or Western blotting, FACS analyze, and confirm thus.

3. expression vector of the present invention and transformant

Expression vector of the present invention for example can obtain by DNA of the present invention being inserted well-known carriers such as pEFBOS, pCAGGStkNeo, pMX.

In addition, transformant of the present invention can obtain by expression vector of the present invention is imported desired host.There is no particular limitation as the host, but preferred cells of mamma animals strain.The cells of mamma animals strain as the strain of mouse B precursor cell, human fetal kidney cell line, derive from the cell strain of Chinese hamster ovary etc., preferably derives from the cell strain of hamster ovary.Expression vector is imported host's method, as using well-known methods such as calcium phosphate method, deae dextran method, electroporation.

In addition, under the condition that above-mentioned expression vector may be expressed, cultivate above-mentioned transformant, can produce the polypeptide that has with mouse PBSF/SDF-1 bonded receptor active thus.Like this chromatography that the polypeptide of producing can be by routine or use antibody of the present invention and carry out method such as affinity chromatography and carry out purifying at an easy rate.

4. monoclonal antibody of the present invention

Monoclonal antibody of the present invention is at the antibody of mouse CXC R4 polypeptide of the present invention with at the antibody of the fused protein of this polypeptide and people CXCR4/fusin/HUMSTSR.

Such monoclonal antibody can be prepared as follows.

Be applied on the basis of a part of aminoacid sequence of polypeptide of the present invention, synthesize peptide as immunogen by common peptide synthesizer synthetic, perhaps use to express the mouse CXC R4 that bacterium that the carrier of mouse CXC R4 transforms, yeast, zooblast, insect cell etc. are produced, with the form of cell or with the protein of the protein chemistry method purifying gained of routine as immunogen.With animals such as these immunogen immune mouse, rat, hamster, rabbits, from spleen or lymphoglandula, take out cell, merge with the myeloma cell, method (nature according to koehler and Milstein etc., 256, the method of the Ueda of 495-497 (1975) or its improvement etc. (institute of American National medical college periodical, 79,4386-4390 (1982) makes hybridoma.The gained hybridoma can the manufacture order clonal antibody.

More particularly, for example can obtain the monoclonal antibody of mouse CXC R4 by following steps.

(a) with mouse CXC R4 protein immune mouse;

(b) win the spleen separating spleen cell of immune mouse;

(c) merging under the condition that promotor (as, polyoxyethylene glycol) exists, the method according to records such as above-mentioned koehler merges isolating splenocyte and myeloma cell;

(d) the selection culture medium culturing gained hybridoma that can not grow with non-fusion myeloma cell;

(e) use ELISA method and immune electrotransfer method to select the hybridoma of desired production antibody, carry out clone cell by limiting dilution assay; With

(f) monoclonal antibody of the anti-mouse CXC R4 of recovery.

In addition, the monoclonal antibody at the fused protein of mouse CXC R4 and people CXCR4/fusin/HUMSTSR is also contained among the present invention.

Such monoclonal antibody can obtain like this: obtain the fused protein of mouse CXC R4 and people CXCR4/fusin/HUMSTSR, make immunogen with this protein and its peptide, obtain by above-mentioned method.

5. medicinal compositions of the present invention and cell

Medicinal compositions of the present invention contains mouse PBSF/SDF-1, can be as AIDS morbidity inhibitor or HIV-1 infection inhibitor.

Medicinal compositions of the present invention can oral or non-dosage forms for oral administration.That is to say and to use common method of application, as Orally administered modes such as available tablet, wafer, granule, powders, or aqua, emulsion, suspension agent, liposome etc. be used for intramuscularly or hypodermic mode, perhaps also can be used as suppository and be used for rectum.These formulations can be made by the conventional carrier of effective constituent of the present invention and medicinal permission, vehicle, wedding agent, stablizer, buffer reagent, dissolving auxiliary, isotonic agent etc. are cooperated.

Amount of application, application times be difference with patient's symptom, medical history, age, body weight, method of application and to some extent, when for example becoming human oral, usually every day 5-500mg, preferably in the scope of 10-100mg, suitably adjust.Can 1 time or divide and use for several times.

In addition, cell of the present invention is the cell of expressing the invention described above polypeptide, or this polypeptide and the two cell of all expressing of human CD 4 protein matter.

Above-mentioned cell can followingly obtain.That is, the carrier of the polypeptide of encoding murine CXCR4 has been integrated in acquisition.The carrier that can use crowds such as pEFBOS, pCAGGS, pMX to know.The carrier that to integrate aforementioned polypeptides then imports in the cell of expressing usefulness, thereby obtains cell of the present invention.Can exemplify the cell strain that derives from Chinese hamster ovary, Chinese hamster ovary celI, human colon's JEG-3, SW480 cell, the strain of human osteoblast cell's sarcoma cell, HOS cell, the strain of people spongioblast, U87MG cell etc. as the expression cell.In addition, can exemplify the introduction method of the method for calcium phosphate method and application Lipofectin (GibcoBRL company), Lipofectamine (GibcoBRL company) as carrier.

So because have been found that mouse CXC R4 is that the coreceptor cell of the present invention of HIV-1 can be used for AIDS morbidity inhibitor and HIV-1 infection inhibitor, the agonist of PBSF/SDF-1 and screening and the AIDS morbidity or the HIV-1 INFECTION IN DETECTION of antagonist.

6. screening method of the present invention

Screening method of the present invention has AIDS morbidity inhibitor, HIV-1 infection inhibitor and the agonist of mouse or people PBSF/SDF-1 and the screening method of antagonist.Specific as follows:

1) screening method of AIDS inhibitor or HIV-1 infection inhibitor is characterized in that it comprises such step:

(a) with the cell of the present invention of above-mentioned record, relatives T cell strain HIV-1 and the material that becomes the screening object mix, then the mixture that obtains of incubation; And

(b) analyze the location of HIV-1 in cell.

2) screening method of AIDS morbidity inhibitor or HIV-1 infection inhibitor is characterized in that it comprises:

(a) with the cell of the present invention of above-mentioned record, the material of expressing the cell of HIV-1 envelope protein matter and becoming the screening object mixes, then the mixture that obtains of incubation; And

(b) measure the cell of expression HIV-1 envelope protein matter and the amalgamation of this cell.

3) AIDS morbidity inhibitor or HIV-1 infection inhibitor, the perhaps screening method of the agonist of this PBSF/SDF-1 or antagonist is characterized in that:

(a) with the cell of the present invention of above-mentioned record, mouse or people's PBSF/SDF-1 and the material that becomes the screening object mix, then the mixture that obtains of incubation; And

(b) measure this intracellular calcium ion concn, and/or it is active with combining of this mouse or people PBSF/SDF-1 to measure polypeptide expressed.

In addition, can exemplify HIV-1IIIB strain (the farmland on a plateau professor by Kumamoto University provides) and HIV-1NL432 strain (upright professor provides by the foot of Tokushima university) as relatives T cell HIV-1.

Embodiment 1)

More preferably use at the monoclonal antibody of relatives T cell strain HIV-1 and analyze the zonal step of HIV-1.

The analytical procedure of using the monoclonal antibody of saying does not have specific restriction, can use common any known method.

In addition, also can use enzyme process as described below as the method for analyzing the HIV-1 distribution.

That is " cell of the present invention ", used in this method imported enzyme (for example: beta-galactosidase enzymes, Luci, CAT etc.) for advantageous applications in the downstream of HIV-1 genetic expression promoter L TR.The cell of expressing human CD4 protein and co-receptor (for example SW480, U87MG, HOS etc.).When HIV-1 infects above-mentioned cell, a kind of virus protein of cell expressing-tat protein, it can activate LTR.Therefore can determine infective dose by measuring the enzymic activity that is comprised in the cytolysis thing.

Embodiment 2)

The cell of expressing HIV-1 envelope protein matter can exemplify the cell that has imported HIV-1 envelope protein plasmagene to HeLaS3, has imported then more preferably using of beta-galactosidase enzymes subunit (any among α or the ω) gene again.In addition, " cell of the present invention " is, imported among for example preferred NIH3T3 human CD 4 protein matter and co-receptor, again imported as the beta-galactosidase enzymes subunit (among α or the ω any, with import the cell of expressing the HIV-1 envelope protein in different) cell of gene.When the cell of expressing HIV-1 envelope protein matter carried out cytogamy with cell of the present invention, the α subunit of beta galactosidase enzyme and ω subunit were united, and become activated beta-galactosidase enzymes.Therefore after two cytomixis being cultivated,, can measure the cytogamy amount by measuring contained galactosidase activity in the cytolysis thing.

Embodiment 3)

(a) result who cultivates in the step, when finding that the rising intracellular calcium concentration is active, the possibility of the promising agonist of object material.It is active and when can see object material and receptors bind to can't see the rising intracellular calcium concentration, the possibility of the promising antagonist of object material.In addition, the rising intracellular calcium concentration of mouse PBSF/SDF-1 the active and/or time with receptors bind active affected, when promptly suppressing active, the possibility of the promising antagonist of object material.In addition, this releasing agent is example with the hemopoietic stem cell.

7. detection kit and detection method

The test kit that is used to detect AIDS morbidity or HIV-1 infection of the present invention is a feature to comprise cell of the present invention.

Use the test kit of being said and to detect AIDS morbidity or HIV-1 infection easily.Test kit of the present invention is to utilize detection method of the present invention shown below and detect.

In addition, the method that detection AIDS of the present invention morbidity or HIV-1 infect is characterized in that it comprises

(a) with above-mentioned cell of the present invention with suspect that serum, hemocyte or the blood infected HIV-1 patient mix, then the mixture that obtains of incubation and

(b) analyze the distribution of HIV-1 in this cell, perhaps measure the level of HIV-1 cells infected and this cytogamy.

Here can exemplify the method used in AIDS morbidity inhibitor or the HIV-1 infection inhibitor as analyzing the method that HIV-1 distributes.In addition, but exemplary application in the method for AIDS morbidity inhibitor or HIV-1 infection inhibitor as the method for measuring HIV-1 cells infected and this cytogamy.Moreover (b) in " HIV-1 cells infected " is the hemocyte that has infected the patient of HIV-1 for doubting of HIV-1 infection.

8. practicality of the present invention

Common and the mouse PBSF/SDF-1 of mouse CXC R4 of the present invention and people CXCR4/fusin/HUMSTSR reacts.Because have only an amino acid variant in 71 amino acid of mouse and people PBSF/SDF-1, so expectation mouse CXC R4 also combines with people PBSF/SDF-1.Because people PBSF/SDF-1 can suppress the infection by the pro t cell strain HIV-1 of CXCR4/fusin/HUMSTSR mediation, so with the proteinic antibody of anti-mouse CXC R4 of the present invention, and functional zone, the extracellular mutual alternative of mouse CXC R4 and anti-people CXCR4/fusin/HUMSTSR and the antibody of the chimeric protein with T cell strain directive property HIV-1 combining site that obtains can be used as the infection inhibitor of HIV-1, promptly use as the medicine of AIDS.

In addition, replace the agonist that the screening method of agonist, the antagonist of the chimeric protein that obtains obtains, the infection inhibitor that antagonist can be used as HIV-1 mutually by the functional zone, extracellular of using screening mouse CXC R4 protein provided by the present invention and mouse CXC R4 and people CXCR4/fusin/HUMSTSR, promptly use as the medicine of AIDS.

The present invention will be described in more detail by the following examples, but the present invention is not limited by embodiment at all.

The clone of embodiment 1 mouse CXC R4cDNA

(1) primer is synthetic

On the basis of known Chemokine Receptors aminoacid sequence, with dna synthesizer (Cyclone Plus, Nippon Millipore) synthetic and the 2nd corresponding concentrated forward primer-C2F2-2 of dna sequence dna (sequence number 5 in the sequence table) that strides the diaphragm area aminoacid sequence of coding is with the 7th corresponding concentrated reverse primer CAR1 of dna sequence dna (sequence number 6 in the sequence table) that strides the film region amino acid sequence of coding.

(2) from mouse B precursor cell strain DW34 purified mRNA

The strain of mouse B precursor cell is suspended in RPMI 1640 substratum, cultivate a week after, (Nissui) clean with Dulbecco PBS (-), with mRNA purification kit (Pharmacia) purified mRNA.

(3) the segmental clone of the cDNA of mouse CXC R4

With Ready-To-Go T-Primed First-Strand kit (Pharmacia) from the mRNA synthesizing single-stranded cDNA of 200ng by mouse B precursor cell strain DW34 purifying.CDNA makes template with this strand, use primer C2F2-2 and C4R1, thermotolerance Taq archaeal dna polymerase carry out the PCR reaction (94 ℃ 0.5 minute, 55 ℃ 0.5 minute, 72 ℃ of following 30 circulations of 1 minute condition).With the low separating obtained reaction solution of melting point agarose gel electrophoresis, cut out the DNA band of purpose size (about 690bp), with Wizard PCR Preps dna purification system (Promega) purifying DNA fragment.(Takara) is inserted into the gained dna fragmentation in the pT7Blue carrier with dna ligation kit.Measure the base sequence of the DNA that inserts with PRISM Ready Reaction sequence test kit (Applied Biosystems) and dna sequencing instrument (Applied Biosystems).The cDNA sequence of gained mouse CXC R4 is shown in sequence number in the sequence table 2.The primer shown in sequence number 7 and the sequence number 8 in the composition sequence table on the basis of the as above mouse CXC R4cDNA sequence of gained, use Marathon cDNA amplification kit (Clontech), make template with the as above cDNA of the DW34 cell of gained and obtain to contain 5 ' terminal cDNA clone.The cDNA sequence of gained mouse CXC R4 is shown in sequence number in the sequence table 3.

The expression of embodiment 2 mouse CXC R4 in each tissue

(1) making of probe

In order to detect the expression of mouse CXC R4 in each tissue of mouse, at first following making probe.On the basis of mouse CXC R4 gene base sequence, synthetic with the 2nd stride the corresponding forward dna sequence dna of diaphragm area part (sequence number 15 in the sequence table) and with the 7th stride the corresponding reverse DNA sequence of film district part (sequence number 16 in the sequence table) as primer, be used for PCR then.CDNA with the base sequence that obtains in the foregoing description 1 (3) makes template, uses the Taq polysaccharase, 94 ℃ 1 minute, 55 ℃ 1 minute, carry out 30 round-robin PCR reactions under 72 ℃ of conditions of 2 minutes.Separate the PCR reaction product with agarose gel electrophoresis, cut out the DNA band of purpose size (690bp), come purify DNA with Wizard PCR Preps dna purification system.With Prime-ItII random primer labelling (Stratagene) ³²The dna fragmentation 50ng of P mark gained is as probe.

(2) the Northern engram analysis of mouse tissue and mice embryonic

Form the mRNA of the 7th day, the 11st day, the 15th day, the 17th day the mice embryonic in back with the mRNA of the various mouse tissues of electrophoretic separation and embryo, the probe of using gained in the film that shifted and above-mentioned (1) is hybridized.Film immersed contain among 2 * SSC of 0.05%SDS, after the room temperature washing in 15 minutes 2 times, immerse again and contain among 0.1 * SSC of 0.1%SDS, washed 2 times in 20 minutes for 50 ℃.Detect the radioactive rays of film by radioautograph.The result is shown in the A (mouse tissue) and B (mice embryonic) of Fig. 2.Can understand from the intensity of band, in thymic lymphoma knot, spleen, obtain strong signal, obtain weak signal at brain, small intestine, stomach, kidney.In mice embryonic, all obtain strong signal in addition.

The clone of the genomic dna of embodiment 3 mouse CXC R4

(A) making of probe

On the basis of the cDNA base sequence of the CXCR4 of gained, synthetic suitable forward and reverse primer is used for PCR then in the foregoing description 1 (3).The cDNA that obtains from the foregoing description 1 (3) obtains double-stranded DNA, is template with this double-stranded DNA, carries out the PCR reaction with the Taq polysaccharase, carries out reaction product isolated with agarose electrophoresis, cuts out the DNA band of purpose size (about 690bp), purifying DNA fragment.With Prime-ItII random primer labelling test kit (Stratagene) with ³²The dna fragmentation 50ng of P mark gained is as probe.

(B) clone of mouse genomic library

At first, with the 129/svJ mouse liver genomic library ehec infection that is incorporated among the phage vector λ FIXII, be such: after being inoculated into plate formation plaque, transfer to (DuPont) on the nylon membrane as screening first.Nylon membrane is immersed in prehybridization solution (5 * SSPE (0.9M NaCl, 0.05M sodium phosphate pH7.7,0.005M Na ₂EDTA), 50% methane amide, 5 * Denhardt ' s liquid, 50 μ g/ml salmon sperm DNAs, 0.1%SDS) carry out prehybridization after, be immersed in the hybridization solution (5 * SSPE, 50% methane amide, 1 * Denhardt ' s liquid, 10% dextran sulfuric acid disodium, 50 μ g/ml salmon sperm DNAs, 0.1%SDS) 42 ℃ of hybridization 15 hours with the probe of gained in above-mentioned (A).Behind the purification membrane, detect radioactivity, screening produces the positive colony of signal, and progressively the second time and screening are for the third time carried out in dilution, filter out 2 signal clones.

Phage DNA with various Restriction Enzyme enzyme cutting clones separates with agarose gel electrophoresis, and that the pattern of band is identical is same clone, repeats same hybridization, can obtain as far as possible little These positive bands, carries out enzyme with Restriction Enzyme and cuts.The positive dna fragmentation of selecting is inserted in the pBluescripts KSII carrier, measures base sequence by dideoxy method.The dna sequence dna of gained mouse CXC R4 gene is shown in sequence number in the sequence table 4.In addition from sequence table in base sequence shown in the sequence number 3 and the sequence table base sequence shown in the sequence number 4 find to comprise the base sequence of the longest open reading frame, this base sequence is shown in sequence number in the sequence table 1.So the base sequence shown in the sequence number in the sequence table 1 is carried out the retrieval of nucleic acid homology with GenBank/EMBL/DDBJ dna sequence data storehouse.Result for retrieval shows that institute's DCRP is the DNA of encoding novel mouse Chemokine Receptors, with it called after mouse CXC R4.

The homology analysis of embodiment 4 mouse CXC R4 aminoacid sequences

The aminoacid sequence of inferring on the basis of mouse CXC R4 base sequence (sequence number 17 in the sequence table) is inferred as the tripolymer G protein coupled mode acceptor that contains distinctive 7 membrane spaning domains of Chemokine Receptors.With its aminoacid sequence compare with the sequence of known CXC Chemokine Receptors (make database with GenBank, EMBL, DDBJ, analyze) with BLAST.Result's the most similar to people CXCR4/Fusin/HUMSTSR (homology 90%), with monkey CXCR4, the homology of ox CXCR4 is respectively 89%, 86%, be respectively 49%, 47% and 45% with the homology of rat IL-8RB, rabbit IL-8RA, rabbit IL-8RB.

The expression of embodiment 5 mouse CXC R4 and people CXCR4/Fusin/HUMSTSR

(1) expression vector of making mouse CXC R4, people CCCKR2B and people CXCR4/Fusin/HUMSTSR

For the gene of cloning the human chemokine receptor CC CKR2B that has reported and the gene of CXCR4/Fusin/HUMSTSR, the cDNA that uses person monocytic cell's strain THP-1 carries out following PCR reaction.CDNA 500ng with the THP-1 cell makes template, with the people CXCR4/Fusin/HUMSTSR that increases of the primer shown in sequence number in the sequence table 11 and 12, primer shown in the sequence number 9 and 10 CC CKR2B that is used to increase in the sequence table, the amount of every kind of primer is used 500ng respectively.With Taq polysaccharase (precious wine is made) as the enzyme that reacts.Be reflected at 94 ℃ carried out 1 circulation in 3 minutes after, under 94 ℃ 1 minute, 55 ℃ 2 minutes, 72 ℃ conditions of 3 minutes, carry out 35 circulations, again 37 ℃ of reactions 3 minutes.The gene fragment of the people CXCR4/Fusin/HUMSTSR that obtains in this reaction and CC CKR2B is incorporated into the TA clone position of pCRII (Invitrogen) respectively.With plasmid difference called after pCRII CXCR4 and the pCRII CC CKR2B that so obtains.Then, use respectively after the pCRII CXCR4 and pCRII CC CKR2B plasmid of NotI and XboI (be precious wine and make company) digestion gained, be incorporated into the NotI/XboI position of pCAGGStkNeo.With plasmid difference called after pCAN CXCR4 and the pCANCC CKR2B that so obtains.

In order to clone the gene of mouse CXC R4, carry out PCR as template with the strand cDNA of the mouse B precursor cell strain DW34 shown in the sequence number 3 in the resulting sequence table in the foregoing description 1 (3).Make template with 100ng cDNA, with the primer shown in the sequence number 13 and 14 in the sequence table.The enzyme that reacts is with ExTaq (precious wine is made).Be reflected at 94 ℃ carried out 1 circulation in 3 minutes after, 94 ℃ 1 minute, carry out 20 circulations under 55 ℃ of 1 minute, 72 ℃ conditions of 2 minutes, again 72 ℃ of reactions of carrying out 5 minutes.Mouse CXC R4 gene fragment with NotI and XhoI (precious wine is made) digestion gained afterwards, is incorporated into the NotI/XboI position of pCAGGStkNeo.With the plasmid called after pCANmPBSFR that so obtains.

(2) mouse CXC R4, people CXCR4/Fusin/HUMSTSR, the expression of people CC CKR2B in Chinese hamster ovary celI

The microbial culture of diameter 10cm with Pi Shi plate (rock city nitre society) in, 37 ℃, 10%CO ₂Under the condition that exists Chinese hamster ovary celI was cultivated 1 day.Respectively in the above with 30 μ g

The DNA of the expression vector of 3 kinds of Chemokine Receptors that obtain (1) (pCANmPBSPR, pCANCXCR4 and pCANCC CKR2B) is dissolved in the 25 μ l distilled water, adds the 250mM calcium chloride (nacalaitesque) of 500 μ l then.(50mM BES (SIGMA), behind 280mM sodium-chlor (nacalaitesque) and the 1.5mM Sodium phosphate dibasic (nacalaitesque), room temperature left standstill 25 minutes 2 * BBS solution of adding 500 μ l in the mixed solution of DNA and calcium chloride.The dna solution of so preparation is splashed in the plate of cultivating Chinese hamster ovary celI 37 ℃, 3%CO ₂Cultivated 20 hours under the condition that exists, in the DNA transfered cell.Wash the cell that has imported DNA with 3ml PBS (+), wash after 2 times, add α-MEM (GIBCO) that 10ml contains 10%FCS, 37 ℃, 5%CO ₂Cultivated 1 day under the condition that exists.

Then cell suspension is guided in the substratum that has added 2mg/ml GENETICIN (with the pure pharmaceutical worker's industry of light society) in α-MEM (GIBCO) substratum that contains 10%FCS, with 5 * 10 ³Individual/plate is assigned to the cell cultures of diameter 10cm with in the Ping Shi culture dish (rock city nitre).At 37 ℃ of 10%CO ₂Continue under the condition that exists to cultivate, the cell of anti-GENETICIN is used for as expressing mouse CXC R4, the mensuration of the intracellular calcium concentration of the Chinese hamster ovary celI of people CXCR4/Fusin/HUMSTSR and CC CKR2B.Shown in the following examples 6, because CC CKR2B has the activity that intracellular calcium concentration is risen because of adding sepcific ligands MCP-1, so can confirm receptor expression, in addition, same conversion and cultivation have been carried out because used the cell strain identical, so think that mouse CXC R4 and people CXCR4/Fusin/HUMSTSR similarly express with CC CKR2B.

Embodiment 6 (biological activity of mouse CXC R4)

Behind the expression mouse CXC R4 that obtains in the clean the foregoing description 5 (2) of Dulbecco PBS (-) and the Chinese hamster ovary celI of human chemokine receptor (CXCR4/Fusin/HUMSTSR and CC CKR2B), with 5 * 10 ⁶Individual/ml is suspended to the HBSS damping fluid, and (20mM Hepes contains 125mM NaCl among the pH7.4,5mM KCl, 1mM MgCl ₂, 0.5mM glucose and 0.1%BSA) in, reach the Fura-PE3AM (fluorescence experiments chamber, Texas) of 2.5 μ M by adding concentration, 37 ℃ of incubations 30 minutes.After cleaning with the HBSS damping fluid, with the express cell of every kind of Chemokine Receptors again with 5 * 10 ⁸Individual/ml is suspended in the same buffer.In each 500 μ l of suspension of gained chemokine receptor expression cell, add chemokine (mouse PBSF/SDF-1 or people MCP-1), when reaching 100nM respectively, measure the variation of fluorescence intensity, with spectrophotofluorometer (LS50B, PERKIN ELMER), in excitation wavelength is 340nm and 380nm, and wavelength of fluorescence is 510nm, reacts under 0.5 second the condition and measures.Its result is the ratio through 340nm and 380nm fluorescence intensity in time, shown in Fig. 3-6.

The ratio that can see fluorescence intensity in the express cell of mouse CXC R4 and people CXCR4/Fusin/HUMSTSR under mouse PBSF/SDF-1 stimulates rises, and does not find that in the express cell of CC-chemokine receptor CC CKR2B the ratio of fluorescence intensity raises.In addition, when stimulating, find that the ratio of fluorescence intensity in the CC CKR2B express cell rises with the positive colony MCP-1 peptide of acceptor.Therefore, can clear and definite mouse PBSF/SDF-1 has activity to the special rising intracellular calcium concentration of the express cell Chinese hamster ovary celI of mouse CXC R4 of the present invention and people CXCR4/Fusin/HUMSTSR.In addition, in mouse CXC R4 express cell, find the desensitization that the ratio that increases fluorescence intensity continuously along with mouse PBSF/SDF-1 does not change as shown in Figure 7.Desensitization is not found when adding negative control people MCP-1.This result confirms that acceptor of the present invention is the acceptor of mouse PBSF/SDF-1.

Embodiment 7

Materials and methods

Clone: mouse NIH 3T3 cell, derive from the SW480 cell of people's small intestine epithelium, derive from the U87MG of human neuroglia cell, in containing the DMEM of 10%FCS, cultivate.People's HeLaS3 cell is cultivated in RPMI 1640 substratum that contain 10%FCS.The HOS cell that derives from the human osteoblast cell is cultivated in the Eagle MEM that contains 1% non-essential amino acid (Gibco) and 10%FCS.

Virus: the NL432 strain of HIV-1 is provided by the upright professor of foot (Tokushima university).The IIIB strain is provided by farmland on a plateau professor (Kumamoto University).The SF162 strain is provided by J.A.Levy professor (California University of San Francisco).Embedded virus clone, NL432env-162 and the NL432V3-162 of HIV-1 by and slope (Shionogi) provide.Gene recombination vaccinia virus Vac.Env (NL432env), Vac.Env162 (SF162env), Vac T4 (CD4) are provided by salt pan professor (Tokyo University).L0-T7 (T7 polysaccharase) is provided by M.Kohara (standing clinical grinding).

The transfection of cell: with every hole 5 * 10 ⁴The cell density of individual cell spends the night the NIH3T3 cell cultures in 24 orifice plates, is incorporated into the Chemokine Receptors gene of pBluescript with Lipofectamine (Gibco) transfection.Transfection began the back 4th hour, used the PBS washed cell, 37 ℃ of overnight incubation, was used for convergence analysis behind the interpolation nutrient solution.In the 6cm plate with 5 * 10 ⁵The cell density of cell spends the night SW 480 cells and HOS cell cultures.By the calcium phosphate method of improvement, with the plasmid mixture transfection SW480 cell of carrier T4-Neo 7.5 μ g, LTR (EcoRV)-β-Gal-Neo 2.5 μ g that put in order acceptor gene 5 μ g, expression CD4 into pEF-BOS.Use the same method 15 μ g are incorporated into the acceptor gene transfection of pEF-BOS in the HOS cell of constant expressing human CD4 and LTR-Gal.At 3%CO ₂Cell cultures is spent the night in 35 ℃ under the condition that exists, after cleaning with PBS (-), reclaim with the PBS that contains 0.5mM EDTA, be inoculated into afterwards on 12 orifice plates, 37 ℃ of overnight incubation are used for infection analysis.

Cytogamy is analyzed: carry out quantitatively for pair cell merges, we have used and have utilized beta-galactosidase enzymes (the modified form cytogamy analytical method (will field etc. are during contribution is prepared) of the α-Hu Bu effect of β-gal).

By α-subunit and env protein imported effect cell HeLaS3 cell (24 orifice plates, 1 * 10 of gene recombination vaccinia virus with β-gal ⁵Cells/well).

Vaccinia virus by gene recombination is with ω-subunit of people CD4, β-gal, and the T7DNA polysaccharase imports target cell NIH3T3 cell (24 orifice plates, 5 * 10 ⁴Cells/well), with Lipofectamine with Chemokine Receptors transfection target cell.After the transfection the 16th hour, containing 0.5mM CaCl ₂PBS in washing effect cell and target cell, for the non-specific cell that suppresses to be caused by vaccinia virus merges, handle with the antibody 2D5 of anti-vaccinia virus.The effector cell is suspended to contains 3mM CaCl ₂Hanks damping fluid (pH7.6) in, be taped against on the target cell in 24 orifice plates, centrifugal 5 minutes of 1000rpm merges beginning afterwards.

Centrifugal back is at 5%CO ₂Exist down, 37 ℃ with cell cultures 12 hours.When cytogamy took place, the α subunit of the β-gal that is comprised in the tenuigenin of fused cell and ω-subunit associating became activatory β-gal enzyme by the α-Hu Bu effect.So after removing nutrient solution, every hole adds substrate dichlorophenol sulfonphthalein-b-D-semi-lactosi pyranoside (Boehringer Mannheim), the 2 mercapto ethanol of 45mM, the 1mMMgCl of the β-gal that comprises 8mM of 200 μ l ₂, 100mM Hepes pH8.0,0.5%NP40, DNAase I0.1mg/ml solution, 37 ℃ of reactions are after 30 minutes, every hole adds the 2%SDS of 200 μ l with termination reaction.Measure absorbancy carries out quantitatively with the activity of β-gal in to reaction solution at wavelength 590nm place.

Infection analysis: the people SW480 of culture expression people CD4 and acceptor or HOS cell in 12 orifice plates.(activity of reversed transcriptive enzyme (RT) is: SF162:2 * 10 to add the nutrient solution that contains HIV-1 virus in each hole ⁶RT/mL; NL432env162, NL432V3-162, IIIB:5 * 10 ⁶RT/mL; NL432:3 * 10 ⁶RT/mL), 5%CO ₂Under the condition that exists, 37 ℃ cultivate after 2 hours, the nutrient solution of 2.5ml is added in every hole.Infect the reporter gene lysis buffer (Promega) that every hole on the 4th, back adds 400 μ l ,-80 ℃ of freeze thawing.The sample that will melt moves in the Eppendorf pipe, and 4 ℃ of 12000rpm measure the β-gal activity that comprises in the supernatant after centrifugal 5 minutes with luminous β-gal detection kit (Clontech).

The result

At first, the first step, whether support the film of the HIV-1 of env mediation to merge in order to detect mouse CXC R4, we use the above-mentioned β-gal activatory analytical system that can cause and test by the fusion of the target cell (NIH3T3 cell) of the expression proteinic effector cell of env (HeLaS3 cell) and expressing human CD4 and acceptor.In this analytical procedure, the varicella vaccine of effector cell HeLaS3 cell infection gene recombination is with the α-subunit of expression β-Gal and the env protein of HIV-1, and the varicella vaccine of target cell NIH3T3 cell infection gene recombination is to express ω-subunit, T7 polysaccharase and the people CD4 of β-Gal.The plasmid transfection NIH3T3 cell that will comprise people CXCR4, people CCR5 or mouse CXC R4 behind the infective virus again.After the overnight incubation, with effector cell and target cell mixed culture.The α subunit of the β-Gal that comprises in the tenuigenin of fused cell when cytogamy takes place and the associating of ω subunit, β-Gal activation.As shown in Figure 8, express to derive from the proteinic HeLaS3 cell of env of pro t cell HIV-1NL432 and the NIH3T3 cytogamy of expressing human CXCR4 and people CD4, but do not merge with the NIH3T3 cell of expressing human CCR5 and people CD4.

Expressing the same cell with expression mouse CXC R4 and people CD4 of the proteinic HeLaS3 cell of env that derives from NL432 curiously merges.Expression derives from the proteinic HeLaS3 cell of env of close monocyte HIV-1SF162 and the NIH3T3 cytogamy of expressing human CCR5 and people CD4, but does not merge with the NIH3T3 cell of expressing human or mouse CXC R4 and people CD4.

Second we inquired into the cell of expressing mouse CXC R4 whether can be by virus infection.Because the duplicating efficiency of HIV-I is low in the mouse cell NIH3T3 cell of expressing human CXCR4 and CD4, so use the SW480 cell that derives from people's intestinal epithelial cell.Derive from osteoblastic HOS cell and derive from the target cell of 3 kinds of human cell lines of U87MG cell of neurogliocyte as virus infection.Make these cells of reporter gene (lacz) transfection of promotor in order to the LTR of HIV-1.Cell infection just express the transcriptional activators Tat albumen that derives from HIV-1 when viral, this albumen acts on the expression that LTR induces LacZ.Again with behind people CD4 and these cells of Chemokine Receptors transfection, cell infection pro t cell strain virus strain (NL432, IIIB) or infect close monocyte virus strain (SF162).As shown in Figure 9, NL432 and IIIB had equally both infected the SW480 that expresses mouse CXC R4 and people CD4, infected the SW480 of expressing human CXCR4 and people CD4 again.This result is consistent with the result of above-mentioned convergence analysis.But these viruses do not infect these cells as expressing human CCR2b and CCR5 but not during CXCR4.

On the other hand, SF162 infects the SW480 of expressing human CCR5 and people CD4, does not express mouse CXC R4 and the cell of people CD4 and the cell of expressing human CXCR4 and people CD4 but do not infect.In addition, when HOS cell and U87MG cell replacement SW480 cell, obtain same result (Figure 10 and Figure 11).That is to say that this has hinted that mouse CXC R4 supports pro t cell strain HIV-1 to enter target cell, and does not influence the expression that proviral DNA synthesizes, is incorporated into genomic dna, virus in people's cell.

, the HIV-1 of reference CXCR4 mediation enters by the monoclonal antibody of the proteic V3 ring of anti-env and suppresses.So, identical with people CXCR4 whether for the function that confirms mouse CXC R4, whether the V3 ring that we have inquired into (the pro t cell virus strain) env albumen (gp120) enters also necessary to the HIV-1 of mouse CXC R4 mediation.We allow the SW480 cell infection NL432 of expressing human CD4 and Chemokine Receptors and embedded virus clone-NL432env-162 or the NL432V3162 of SF162 for this reason.As shown in figure 12, NL432env-162 be the env district of pro t cell virus strain NL432 by the institute alternate provirus of close monocyte HIV-1SF162, NL432V3-162 is that the V3 ring of env of NL432 is by the institute alternate provirus of SF162.NL432 infects the SW480 that expresses mouse CXC R4 and people CD4, and NL432env-162 and NL432V3-162 do not infect these cells (Figure 13).

On the other hand, NL432env-162 and NL432V3-162 infect the SW480 cell (Figure 13) of expressing human CCR5 and people CD4, it is identical with the situation of people CXCR4 that these results show, the V3 of the env of NL432 ring is necessary to entering of virus under the situation of mouse CXC R4.

Discuss

Can prove the cytolemma fusion of the env mediation of mouse CXC R4 support pro t cell strain HIV-1 and the infection of pro t cell strain HIV-1 from above research.These results suggest mouse CXCs R4 is not species specific barrier to the infection of HIV-1.Illustrate mouse lymphocyte or non-lymphocyte strains such as the NIH3T3 of expressing human CD4 and T cell clone 3DT in the present research, cause the absorption of HIV-1 but do not rise to cause that it enters.For a kind of explanation of this result is that the mouse cell of expressing human CD4 represents not express CXCR4.In fact, the variation of the intracellular calcium concentration of NIH 3T3 cell is not induced in the stimulation of mouse PBSF/SDF-1.But mouse CXC R4 is expressed in CD4 and CD8 is total on the single male thymocyte of male thymocyte and CD4 or CD8.Whether the 3DT cell of therefore definite experiment usefulness expresses CXCR4 is very important (verifying whether above-mentioned explanation is correct).

The nearest mouse autoploid (mouse CCR5) that studies show that close monocyte HIV-1 acceptor people CCR5 is not supported entering of HIV-1.Specific specificity is different between the acceptor that this results suggest parent monocyte HIV-1 the is relative acceptor relative with pro t cell strain HIV-1.Compare with other Chemokine Receptors that contains CCR5, the aminoacid sequence of CXCR4 is high conservative between planting, the reason that perhaps Here it is makes a difference.The aminoacid sequence of mouse CXC R4 and people CXCR4's is 90% consistent, but CCR5 and the CCR2 consistence in mouse and people has only 82%, 71% respectively.High conservative has reflected such fact between the kind of CXCR4: when with the part MIP-1 α of CCR5, when other chemokines such as MIP-β, RANTES are compared, the part PBSF/SDF-1 of CXCR4 has unique function and thinks that leukocytic migration is relevant relative in chemokine beyond the PBSF/SDF-1 and the inflammation, and PBSF/SDF-1 has organisms such as hematopoiesis and heart formation are grown necessary function.

From present research and such fact: the mouse cell strain NIH3T3 of expressing human CD4 and Chemokine Receptors supports entering of HIV-1, but compare with people's cell, the generation efficient of virion is low, considers that lacking HIV-1 in the mouse cell duplicates molecule in the necessary cell.But, can develop the model mice that HIV-1 infects by making the transgenic mice that imports the molecule-people's gene that can cause the specific specificity barrier.Our result shows that in the model mice that people CXCR4 gene importing HIV-1 is infected be unnecessary.In addition, the physiological of CXCR4 is expressed and to be suitable for studying the startup and the process of being divided a word with a hyphen at the end of a line to pro t cell strain HIV-1 by close monocyte HIV-1 that causes the AIDS morbidity, provides useful information so can simulate the animal model that HIV-1 infects whole process for exploitation.

Utilize possibility on the industry

The present invention can provide the research to the mechanism of action of the curative of AIDS and HIV-1 infection to have With the novel mouse CXC chemokine receptor gene, the polypeptide of this gene code, this polypeptide Expression vector has imported the transformant of this expression vector, the monoclonal antibody of anti-aforesaid polypeptide, The useful aforesaid transformant method of producing aforesaid polypeptide also, moreover, swashing of aforementioned acceptor is provided The screening technique of moving agent or antagonist, and the screening technique of HIV-1 infection inhibitor.

Sequence table

SEQ?ID?NO：1

Sequence length: 1877

Sequence type: nucleic acid

Chain: two strands

Topological framework: linearity

Molecule type: cDNA → mRNA

Primary source

Biological: mouse

Sequence description:

CCATCCTAAT?ACGACTCACT?ATA?23

GGGCTCGAGC?GGCCGCCCGG?GCAGGTGCAG?GTAGCAGTGA?CCCTCTGA?71

GGCGTTTGGTGCTCCGGTAACCACCACGGCTGTAGAGCGAGTGTTGCC?119

ATGGAACCGATCAGTGTGAGTATATACACTTCTGATAACTACTCTGAA?167

MetGluProIleSerValSerIleTyrThrSerAspAsnTyrSerGlu

1 5 10 15

GAAGTGGGGTCTGGAGACTATGACTCCAACAAGGAACCCTGCTTCCGG?215

GluValGlySerGlyAspTyrAspSerAsnLysGluProCysPheArg

20 25 30

GATGAAAACGTCCATTTCAATAGGATCTTCCTGCCCACCATCTACTTC?263

AspGluAsnValHisPheAsnArgIlePheLeuProThrIleTyrPhe

35 40 45

ATCATCTTCTTGACTGGCATAGTCGGCAATGGATTGGTGATCCTGGTC?311

IleIlePheLeuThrGlyIleValGlyAsnGlyLeuValIleLeuVal

50 55 60

ATGGGTTACCAGAAGAAGCTAAGGAGCATGACGGACAAGTACCGGCTG?359

MetGlyTyrGlnLysLysLeuArgSerMetThrAspLysTyrArgLeu

65 70 75 80

CACCTGTCAGTGGCTGACCTCCTCTTTGTCATCACACTCCCCTTCTGG?407

HisLeuSerValAlaAspLeuLeuPheValIleThrLeuProPheTrp

85 90 95

GCAGTTGATGCCATGGCTGACTGGTACTTTGGGAAATTTTTGTGTAAG?455

AlaValAspAlaMetAlaAspTrpTyrPheGlyLysPheLeuCysLys

100 105 110

GCTGTCCATATCATCTACACTGTCAACCTCTACAGCAGCGTTCTCATC?503

AlaValHisIleIleTyrThrValAsnLeuTyrSerSerValLeuIle

115 120 125

CTGGCCTTCATCAGCCTGGACCGGTACCTCGCCATTGTCCACGCCACC?551

LeuAlaPheIleSerLeuAspArgTyrLeuAlaIleValHisAlaThr

130 135 140

AACAGTCAAAGGCCAAGGAAACTGCTGGCTGAAAAGGCAGTCTATGTG?599

AsnSerGlnArgProArgLysLeuLeuAlaGluLysAlaValTyrVal

145 150 155 160

GGCGTCTGGATCCCAGCCCTCCTCCTGACTATACCTGACTTCATCTTT?647

GlyValTrpIleProAlaLeuLeuLeuThrIleProAspPheIlePhe

165 170 175

GCCGACGTCAGCCAGGGGGACATCAGTCAGGGGGATGACAGGTACATC?697

AlaAspValSerGlnGlyAspIleSerGlnGlyAspAspArgTyrIle

180 185 190

TGTGACCGCCTTTACCCCGATAGCCTGTGGATGGTGGTGTTTCAATTC?743

CysAspArgLeuTyrProAspSerLeuTrpMetValValPheGlnPhe

195 200 205

CAGCATATAATGGTGGGTCTCATCCTGCCCGGCATCGTCATCCTCTCC?791

GlnHisIleMetValGlyLeuIleLeuProGlyIleValIleLeuSer

210 215 220

TGTTACTGCATCATCATCTCTAAGCTGTCACACTCCAAGGGCCACCAG?839

CysTyrCysIleIleIleSerLysLeuSerHisSerLysGlyHisGln

225 230 235 240

AAGCGCAAGGCCCTCAAGACGACAGTCATCCTCATCCTAGCTTTCTTT?887

LysArgLysAlaLeuLysThrThrValIleLeuIleLeuAlaPhePhe

245 250 255

GCCTGCTGGCTGCCATATTATGTGGGGATCAGCATCGACTCCTTCATC?935

AlaCysTrpLeuProTyrTyrValGlyIleSerIleAspSerPheIle

260 265 270

CTTTTGGGAGTCATCAAGCAAGGATGTGACTTCGAGAGCATTGTGCAC?983

LeuLeuGlyValIleLysGlnGlyCysAspPheGluSerIleValHis

275 280 285

AAGTGGATCTCCATCACAGAGGCCCTCGCCTTCTTCCACTGTTGCCTG?1031

LysTrpIleSerIleThrGluAlaLeuAlaPhePheHisCysCysLeu

290 295 300

AACCCCATCCTCTATGCCTTCCTCGGGGCCAAGTTCAAAAGCTCTGCC?1079

AsnProIleLeuTyrAlaPheLeuGlyAlaLysPheLysSerSerAla

305 310 315 320

CAGCATGCACTCAACTCCATGAGCAGAGGCTCCAGCCTCAAGATCCTT?1127

GlnHisAlaLeuAsnSerMetSerArgGlySerSerLeuLysIleLeu

325 330 335

TCCAAAGGAAAGCGGGGTGGACACTCTTCCGTCTCCACGGAGTCAGAA?1175

SerLysGlyLysArgGlyGlyHisSerSerValSerThrGluSerGlu

340 345 350

TCCTCCAGTTTTCACTCCAGCTAACCCTTATGCAAAGACTTATATAAT?1223

SerSerSerPheHisSerSer

355 359

ATATATATATATATGATAAAGAACTTTTTTATGTTACACATTTTCCAG?1271

ATATAAGAGACTGACCAGTCTTGTACAGTTTTTTTTTTTTTTTAATTG?1319

ACTGTTGGGAGTTTATGTTCCTCTAGTTTTTGTGAGGTTTGACTTAAT?1367

TTATATAAATATTGTTTTTTGTTTGTTTCATGTGAATGAGCGTCTAGG?1415

CAGGACCTGTGGCCAAGTTCTTAGTAGCTGTTTATCTGTGTGTAGGAC?1463

TGTAGAACTGTAGAGGAAGAAACTGAACATTCCAGAATGTGTGGTAAA?1511

TTGAATAAAGCTAGCCGTGATCCTCAGCTGTTGCTGCATAATCTCTTC?1559

ATTCCGAGGAGCACCCCACCCCCACCCCCACCCCCACCCCATTCTTAA?1607

ATTGTTTGGTTATGCTGTGTGATGGTTTGTTTGGTTTTTTTTTGTTGT?1655

TGTTGTTGTTTTTTTTTTCTGTAAAAGATGGCACTTAAAACCAAAGCC?1703

TGAAATGGTGGTAGAAATGCTGGGGTTTTTTTTGTTTGTTTGTTTTTT?1751

CAGTTTTCAAGAGTAGATTGACTTCAGTCCCTACAAATGTACAGTCTT?1799

GTATTACATTGTTAATAAAAGTCAATGATAAACTTAAAAAAAAAAAAA?1847

AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1877

SEQ?ID?NO：2

Sequence length: 690

Sequence type: nucleic acid

Chain: two strands

Topological framework: linearity

Molecule type: cDNA → mRNA

Primary source

Biological: mouse

Sequence description:

CTG 3

Leu

1

CACCTGTCAGTGGCTGACCTCCTCTTTGTCATCACACTCCCCTTCTGG 51

HisLeuSerValAlaAspLeuLeuPheValIleThrLeuProPheTrp

5 10 15

GCAGTTGATGCCATGGCTGACTGGTACTTTGGGAAATTTTTGTGTAAG 99

AlaValAspAlaMetAlaAspTrpTyrPheGlyLysPheLeuCysLys

20 25 30

GCTGTCCATATCATCTACACTGTCAACCTCTACAGCAGCGTTCTCATC?147

AlaValHisIleIleTyrThrValAsnLeuTyrSerSerValLeuIle

35 40 45

CTGGCCTTCATCAGCCTGGACCGGTACCTCGCCATTGTCCACGCCACC?195

LeuAlaPheIleserLeuAspArgTyrLeuAlaIleValHisAlaThr

50 55 60 65

AACAGTCAAAGGCCAAGGAAACTGCTGGCTGAAAAGGCAGTCTATGTG?243

AsnSerGlnArgProArgLysLeuLeuAlaGluLysAlaValTyrVal

70 75 80

GGCGTCTGGATCCCAGCCCTCCTCCTGACTATACCTGACTTCATCTTT?291

GlyValTrpIleProAlaLeuLeuLeuThrIleProAspPheIlePhe

85 90 95

GCCGACGTCAGCCAGGGGGACATCAGTCAGGGGGATGACAGGTACATC?339

AlaAspValSerGlnGlyAspIleSerGlnGlyAspAspArgTyrIle

100 105 110

TGTGACCGCCTTTACCCCGATAGCCTGTGGATGGTGGTGTTTCAATTC?387

CysAspArgLeuTyrProAspSerLeuTrpMetValValPheGlnPhe

115 120 125

CAGCATATAATGGTGGGTCTCATCCTGCCCGGCATCGTCATCCTCTCC?435

GlnHisIleMetValGlyLeuIleLeuProGlyIleValIleLeuSer

130 135 140 145

TGTTACTGCATCATCATCTCTAAGCTGTCACACTCCAAGGGCCACCAG?483

CysTyrCysIleIleIleSerLysLeuSerHisSerLysGlyHisGln

150 155 160

AAGCGCAAGGCCCTCAAGACGACAGTCATCCTCATCCTAGCTTTCTTT?531

LysArgLysAlaLeuLysThrThrValIleLeuIleLeuAlaPhePhe

165 170 175

GCCTGCTGGCTGCCATATTATGTGGGGATCAGCATCGACTCCTTCATC?579

AlaCysTrpLeuProTyrTyrValGlyIleSerIleAspSerPheIle

180 185 190

CTTTTGGGAGTCATCAAGCAAGGATGTGACTTCGAGAGCATTGTGCAC?627

LeuLeuGlyValIleLysGlnGlyCysAspPheGluSerIleValHis

195 200 205

AAGTGGATCTCCATCACAGAGGCCCTCGCCTTCTTCCACTGTTGCCTG?675

LysTrpIleSerIleThrGluAlaLeuAlaPhePheHisCysCysLeu

210 215 220 225

AACCCCATCCTCTAT 690

AsnProIleLeuTyr

230

SEQ?ID?NO：3

Sequence length: 685

Sequence type: nucleic acid

Chain: two strands

Topological framework: linearity

Molecule type: cDNA → mRNA

Primary source

Biological: mouse

Sequence description:

CCATCCTAATACGACTCACTATA 23

GGGCTCGAGCGGCCGCCCGGGCAGGTGCAGGTAGCAGTGACCCTCTGA?71

GGCGTTTGGTGCTCCGGTAACCACCACGGCTGTAGAGCGAGTGTTGCC?119

ATGGAACCGATCAGTGTGAGTATATACACTTCTGATAACTACTCTGAA?167

MetGluProIleSerValSerIleTyrThrSerAspAsnTyrSerGlu

1 5 10 15

GAAGTGGGGTCTGGAGACTATGACTCCAACAAGGAACCCTGCTTCCGG?215

GluValGlySerGlyAspTyrAspSerAsnLysGluProCysPheArg

20 25 30

GATGAAAACGTCCATTTCAATAGGATCTTCCTGCCCACCATCTACTTC?263

AspGluAsnValHisPheAsnArgIlePheLeuProThrIleTyrPhe

35 40 45

ATCATCTTCTTGACTGGCATAGTCGGCAATGGATTGGTGATCCTGGTC?311

IleIlePheLeuThrGlyIleValGlyAshGlyLeuValIleLeuVal

50 55 60

ATGGGTTACCAGAAGAAGCTAAGGAGCATGACGGACAAGTACCGGCTG?359

MetGlyTyrGlnLysLysLeuArgSerMetThrAspLysTyrArgLeu

65 70 75 80

CACCTGTCAGTGGCTGACCTCCTCTTTGTCATCACACTCCCCTTCTGG?407

HisLeuSerValAlaAspLeuLeuPheValIleThrLeuProPheTrp

85 90 95

GCAGTTGATGCCATGGCTGACTGGTACTTTGGGAAATTTTTGTGTAAG?455

AlaValAspAlaMetAlaAspTrpTyrPheGlyLysPheLeuCysLys

100 105 110

GCTGTCCATATCATCTACACTGTCAACCTCTACAGCAGCGTTCTCATC?503

AlaValHisIleIleTyrThrValAsnLeuTyrSerSerValLeuIle

115 120 125

CTGGCCTTCATCAGCCTGGACCGGTACCTCGCCATTGTCCACGCCACC?551

LeuAlaPheIleSerLeuAspArgTyrLeuAlaIleValHisAlaThr

130 135 140

AACAGTCAAAGGCCAAGGAAACTGCTGGCTGAAAAGGCAGTCTATGTG?599

AsnSerGlnArgProArgLysLeuLeuAlaGluLysAlaValTyrVal

145 150 155 160

GGCGTCTGGATCCCAGCCCTCCTCCTGACTATACCTGACTTCATCTTT?647

GlyValTrpIleProAlaLeuLeuLeuThrIleProAspPheIlePhe

165 170 175

GCCGACGTCAGCCAGGGGGACATCAGTCAGGGGGATGA 685

AlaAspValSerGlnGlyAspIleSerGlnGlyAsp

180 185

SEQ?ID?NO：4

Sequence length: 1694

Sequence type: nucleic acid

Chain: two strands

Topological framework: linearity

Molecule type: genomic dna

Primary source

Biological: mouse

Sequence description:

ATATACACTTCTGATAACTACTCTGAA 27

IleTyrThrSerAspAsnTyrSerGlu

1 5

GAAGTGGGGTCTGGAGACTATGACTCCAACAAGGAACCCTGCTTCCGG?75

GluValGlySerGlyAspTyrAspSerAsnLysGluProCysPheArg

10 15 20 25

GATGAAAACGTCCATTTCAATAGGATCTTCCTGCCCACCATCTACTTC?123

AspGluAsnValHisPheAsnArgIlePheLeuProThrIleTyrPhe

30 35 40

ATCATCTTCTTGACTGGCATAGTCGGCAATGGATTGGTGATCCTGGTC?171

IleIlePheLeuThrGlyIleValGlyAsnGlyLeuValIleLeuVal

45 50 55

ATCGGTTACCAGAAGAAGCTAAGGAGCATGACGGACAAGTACCGGCTG?219

MetGlyTyrGlnLysLysLeuArgSerMetThrAspLysTyrArgLeu

60 65 70

CACCTGTCAGTGGCTGACCTCCTCTTTGTCATCACACTCCCCTTCTGG?267

HisLeuSerValAlaAspLeuLeuPheValIleThrLeuProPheTrp

75 80 85

GCAGTTGATGCCATGGCTGACTGGTACTTTGGGAAATTTTTGTGTAAG?315

AlaValAspAlaMetAlaAspTrpTyrPheGlyLysPheLeuCysLys

90 95 100 105

GCTGTCCATATCATCTACACTGTCAACCTCTACAGCAGCGTTCTCATC?363

AlaValHisIleIleTyrThrValAsnLeuTyrSerSerValLeuIle

110 115 120

CTGGCCTTCATCAGCCTGGACCGGTACCTCGCCATTGTCCACGCCACC?411

LeuAlaPheIleSerLeuAspArgTyrLeuAlaIleValHisAlaThr

125 130 135

AACAGTCAAAGGCCAAGGAAACTGCTGGCTGAAAAGGCAGTCTATGTG?459

AsnSerGlnArgProArgLysLeuLeuAlaGluLysAlaValTyrVal

140 145 150

GGCGTCTGGATCCCAGCCCTCCTCCTGACTATACCTGACTTCATCTTT?507

GlyValTrpIleProAlaLeuLeuLeuThrIleProAspPheIlePhe

155 160 165

GCCGACGTCAGCCAGGGGGACATCAGTCAGGGGGATGACAGGTACATC?555

AlaAspValSerGlnGlyAspIleSerGlnGlyAspAspArgTyrIle

170 175 180 185

TGTGACCGCCTTTACCCCGATAGCCTGTGGATGGTGGTGTTTCAATTC?603

CysAspArgLeuTyrProAspSerLeuTrpMetValValPheGlnPhe

190 195 200

CAGCATATAATGGTGGGTCTCATCCTGCCCGGCATCGTCATCCTCTCC?651

GlnHisIleMetValGlyLeuIleLeuProGlyIleValIleLeuSer

205 210 215

TGTTACTGCATCATCATCTCTAAGCTGTCACACTCCAAGGGCCACCAG?699

CysTyrCysIleIleIleSerLysLeuSerHisSerLysGlyHisGln

220 225 230

AAGCGCAAGGCCCTCAAGACGACAGTCATCCTCATCCTAGCTTTCTTT?747

LysArgLysAlaLeuLysThrThrValIleLeuIleLeuAlaPhePhe

235 240 245

GCCTGCTGGCTGCCATATTATGTGGGGATCAGCATCGACTCCTTCATC?795

AlaCysTrpLeuProTyrTyrValGlyIleSerIleAspSerPheIle

250 255 260 265

CTTTTGGGAGTCATCAAGCAAGGATGTGACTTCGAGAGCATTGTGCAC?843

LeuLeuGlyValIleLysGlnGlyCysAspPheGluSerIleValHis

270 275 280

AAGTGGATCTCCATCACAGAGGCCCTCGCCTTCTTCCACTGTTGCCTG?891

LysTrpIleSerIleThrGluAlaLeuAlaPhePheHisCysCysLeu

285 290 295

AACCCCATCCTCTATGCCTTCCTCGGGGCCAAGTTCAAAAGCTCTGCC?939

AsnProIleLeuTyrAlaPheLeuGlyAlaLysPheLysSerSerAla

300 305 310

CAGCATGCACTCAACTCCATGAGCAGAGGCTCCAGCCTCAAGATCCTT?987

GlnHisAlaLeuAsnSerMetSerArgGlySerSerLeuLysIleLeu

315 320 325

TCCAAAGGAAAGCGGGGTGGACACTCTTCCGTCTCCACGGAGTCAGAA?1035

SerLysGlyLysArgGlyGlyHisSerSerValSerThrGluSerGlu

330 335 340 345

TCCTCCAGTTTTCACTCCAGCTAACCCTTATGCAAAGACTTATATAAT?1083

SerSerSerPheHisSerSer

350

ATATATATATATATGATAAAGAACTTTTTTATGTTACACATTTTCCAG?1131

ATATAAGAGACTGACCAGTCTTGTACAGTTTTTTTTTTTTTTTAATTG?1179

ACTGTTGGGAGTTTATGTTCCTCTAGTTTTTGTGAGGTTTGACTTAAT?1227

TTATATAAATATTGTTTTTTGTTTGTTTCATGTGAATGAGCGTCTAGG?1275

CAGGACCTGTGGCCAAGTTCTTAGTAGCTGTTTATCTGTGTGTAGGAC?1323

TGTAGAACTGTAGAGGAAGAAACTGAACATTCCAGAATGTGTGGTAAA?1371

TTGAATAAAGCTAGCCGTGATCCTCAGCTGTTGCTGCATAATCTCTTC?1419

ATTCCGAGGAGCACCCCACCCCCACCCCCACCCCCACCCCATTCTTAA?1467

ATTGTTTGGTTATGCTGTGTGATGGTTTGTTTGGTTTTTTTTTGTTGT?1515

TGTTGTTGTTTTTTTTTTCTGTAAAAGATGGCACTTAAAACCAAAGCC?1563

TGAAATGGTGGTAGAAATGCTGGGGTTTTTTTTGTTTGTTTGTTTTTT?1611

CAGTTTTCAAGAGTAGATTGACTTCAGTCCCTACAAATGTACAGTCTT?1659

GTATTACATTGTTAATAAAAGTCAATGATAAACTT 1694

SEQ?ID?NO：5

Sequence length: 20

Sequence type: nucleic acid

Chain: strand

Topological framework: linearity

Molecule type: other nucleic acid (synthetic DNA)

Feature: 13,15 (inosines)

Sequence description:

CTSMGTTTGK?CMNTNKCYGA 20

SEQ?ID?NO：6

Sequence length: 26

Sequence type: nucleic acid

Chain: strand

Topological framework: linearity

Molecule type: other nucleic acid (synthetic DNA)

Feature: 8,9,17 (inosines)

Sequence description:

TAGAKSANNG?GRTTSANRCA?RCAGTG 26

SEQ?ID?NO：7

Sequence length: 25

Sequence type: nucleic acid

Chain: strand

Topological framework: linearity

Molecule type: other nucleic acid (synthetic DNA)

Sequence description:

TCATCCCCCT?GACTGATGTC?CCCCT 25

SEQ?ID?NO：8

Sequence length: 27

Sequence type: nucleic acid

Chain: strand

Topological framework: linearity

Molecule type: other nucleic acid (synthetic DNA)

Sequence description:

CCATCCTAAT?ACGACTCACT?ATAGGGC 27

SEQ?ID?NO：9

Sequence length: 30

Sequence type: nucleic acid

Chain: strand

Topological framework: linearity

Molecule type: other nucleic acid (synthetic DNA)

Sequence description:

CGCGTCGACC?ACAACATGCT?GTCCACATCA 30

SEQ?ID?NO：10

Sequence length: 30

Sequence type: nucleic acid

Chain: strand

Topological framework: linearity

Molecule type: other nucleic acid (synthetic DNA)

Sequence description:

CGCTCTAGAT?TATAAACCAG?CCGAGACTTC 30

SEQ?ID?NO：11

Sequence length: 29

Sequence type: nucleic acid

Chain: strand

Topological framework: linearity

Molecule type: other nucleic acid (synthetic DNA)

Sequence description:

CGCGTCGACG?TTACCATGGA?GGGGATCAG 29

SEQ?ID?NO：12

Sequence length: 32

Sequence type: nucleic acid

Chain: strand

Topological framework: linearity

Molecule type: other nucleic acid (synthetic DNA)

Sequence description:

CGCGCGGCCG?CTTAGCTGGA?GTGAAAACTT?GA 32

SEQ?ID?NO：13

Sequence length: 27

Sequence type: nucleic acid

Chain: strand

Topological framework: linearity

Molecule type: other nucleic acid (synthetic DNA)

Sequence description:

TAGCGGCCGC?GTTGCCATGG?AACCGAT 27

SEQ?ID?NO：14

Sequence length: 27

Sequence type: nucleic acid

Chain: strand

Topological framework: linearity

Molecule type: other nucleic acid (synthetic DNA)

Sequence description:

GCGTCGACTA?AGGGTTAGCT?GGAGTGA 27

SEQ?ID?NO：15

Sequence length: 20

Sequence type: nucleic acid

Chain: strand

Topological framework: linearity

Molecule type: other nucleic acid (synthetic DNA)

Sequence description:

CTGCACCTGT?CAGTGGCTGA 20

SEQ?ID?NO：16

Sequence length: 27

Sequence type: nucleic acid

Chain: strand

Topological framework: linearity

Molecule type: other nucleic acid (synthetic DNA)

Sequence description:

TAGATGAGGG?GGATTGAGAC?AACAGTG 27

SEQ?ID?NO：17

Sequence length: 359

Sequence type: amino acid

Topological framework: linearity

Molecule type: protein

Primary source

Biological: mouse

Sequence description:

MetGluProIleSerValSerIleTyrThrSerAspAsnTyrSerGlu

1 5 10 15

GluValGlySerGlyAspTyrAspSerAsnLysGluProCysPheArg

20 25 30

AspGluAsnValHisPheAsnArgIlePheLeuProThrIleTyrPhe

35 40 45

IleIlePheLeuThrGlyIleValGlyAsnGlyLeuValIleLeuVal

50 55 60

MetGlyTyrGlnLysLysLeuArgSerMetThrAspLysTyrArgLeu

65 70 75 80

HisLeuSerValAlaAspLeuLeuPheValIleThrLeuProPheTrp

85 90 95

AlaValAspAlaMetAlaAspTrpTyrPheGlyLysPheLeuCysLys

100 105 110

AlaValHisIleIleTyrThrValAsnLeuTyrSerSerValLeuIle

115 120 125

LeuAlaPheIleSerLeuAspArgTyrLeuAlaIleValHisAlaThr

130 135 140

AsnSerGlnArgProArgLysLeuLeuAlaGluLysAlaValTyrVal

145 150 155 160

GlyValTrpIleProAlaLeuLeuLeuThrIleProAspPheIlePhe

165 170 175

AlaAspValSerGlnGlyAspIleSerGlnGlyAspAspArgTyrIle

180 185 190

CysAspArgLeuTyrProAspSerLeuTrpMetValValPheGlnPhe

195 200 205

GlnHisIleMetValGlyLeuIleLeuProGlyIleValIleLeuSer

210 215 220

CysTyrCysIleIleIleSerLysLeuSerHisSerLysGlyHisGln

225 230 235 240

LysArgLysAlaLeuLysThrThrValIleLeuIleLeuAlaPhePhe

245 250 255

AlaCysTrpLeuProTyrTyrValGlyIleSerIleAspSerPheIle

260 265 270

LeuLeuGlyValIleLysGlnGlyCysAspPheGluSerIleValHis

275 280 285

LysTrpIleSerIleThrGluAlaLeuAlaPhePheHisCysCysLeu

290 295 300

AsnProIleLeuTyrAlaPheLeuGlyAlaLysPheLysSerSerAla

305 310 315 320

GlnHisAlaLeuAsnSerMetSerArgGlySerSerLeuLysIleLeu

325 330 335

SerLysGlyLysArgGlyGlyHisSerSerValSerThrGluSerGlu

340 345 350

SerSerSerPheHisSerSer

355 359

Claims (22)

1. DNA, the polypeptide that its coding is made up of whole aminoacid sequences of 17 records of sequence number in the sequence table, described polypeptide is the coreceptor of HIV-1, wherein said polypeptide have can with mouse PBSF/SDF-1 bonded receptor active.

2. DNA, in whole aminoacid sequences that sequence number 17 is put down in writing in the tabulation of its code sequence, one or more amino-acid residue disappearances, interpolation, insertion or replacement have a speciogenesis at least, have can with the polypeptide of mouse PBSF/SDF-1 bonded receptor active, described polypeptide is the coreceptor of HIV-1.

3. DNA, it is made up of whole base sequences of 1 record of sequence number in the sequence table, its encoded polypeptides have can with mouse PBSF/SDF-1 bonded receptor active, and described polypeptide is the coreceptor of HIV-1.

4. DNA, it is to have a kind of situation generation and generation at least by one or more base deletion, interpolation, insertion or replacements in whole base sequences of 1 record of sequence number in the sequence table, and encoded polypeptides have can with mouse PBSF/SDF-1 bonded receptor active peptide, and described polypeptide is the coreceptor of HIV-1.

5. DNA, it is in 5 * SSPE, 50% methane amide, 1 * Denhardt ' s liquid, 10% dextran sulfuric acid disodium, 50 μ g/ml salmon sperm DNAs, 0.1%SDS under 42 ℃ the stringent condition, the DNA that can hybridize with the complementary strand of DNA in the arbitrary claim of claim 1-4, and coding have can with the polypeptide of mouse PBSF/SDF-1 bonded receptor active, and described polypeptide is the coreceptor of HIV-1.

6. a peptide species, it is by the DNA encoded polypeptide in the arbitrary claim of claim 1-5, wherein said polypeptide have can with mouse PBSF/SDF-1 bonded receptor active, and described polypeptide is the coreceptor of HIV-1.

7. a peptide species, it is made up of whole aminoacid sequences of 17 records of sequence number in the sequence table, and wherein said polypeptide has and mouse PBSF/SDF-1 bonded receptor active, and described polypeptide is the coreceptor of HIV-1.

8. a peptide species, it be by in whole aminoacid sequences of sequence number in the sequence table 17 record one or more the amino-acid residue disappearance, add, insert or replace and have at least a kind of situation to take place and produce, wherein said polypeptide have can with mouse PBSF/SDF-1 bonded receptor active, and described polypeptide is the coreceptor of HIV-1.

9. the polypeptide in the arbitrary claim of claim 6-8, it derives from mouse B precursor cell strain DW34.

10. expression vector, it comprises the DNA in the arbitrary claim of claim 1-5.

11. a transformant, it is the expression vector in the claim 10 is imported the host and to obtain.

12. the transformant of claim 11, wherein the host is the cells of mamma animals strain.

13. a production have can with the method for mouse PBSF/SDF-1 bonded receptor active polypeptide, wherein said polypeptide is the coreceptor of HIV-1, it is characterized in that, cultivate the transformant in the claim 11 or 12 under the condition that the expression vector in claim 10 can be expressed.

14. a monoclonal antibody, it is the polypeptide in the arbitrary claim of anti-claim 6-9.

15. the polypeptide in the arbitrary claim of expression claim 6-9 and the cell of human CD 4 protein, wherein said polypeptide is the coreceptor of HIV-1.

16. a method of screening AIDS morbidity inhibitor or HIV-1 infection inhibitor is characterized in that it comprises

(a) will express the cell of polypeptide in the arbitrary claim of claim 6-9 or the cell of claim 15, the HIV-1 of relatives T cell strain and the material that becomes the screening object mix, then the mixture that obtains of incubation; With

(b) analyze the location of HIV-1 in this cell.

17. the method for claim 16, the monoclonal antibody of wherein analyzing the HIV-1 of application of HIV-1 localization step and anti-relatives T cell strain carries out.

18. a method of screening AIDS morbidity inhibitor or HIV-1 infection inhibitor is characterized in that it comprises

(a) will express the cell of polypeptide in the arbitrary claim of claim 6-9 or the cell of claim 15, the material of expressing the cell of HIV-1 envelope protein and becoming the screening object mixes, then the mixture that obtains of incubation; With

(b) measure the cell of expression HIV-1 envelope protein matter and the amalgamation of this cell.

Inhibitor or HIV-1 infection inhibitor 19. a screening AIDS falls ill, or the agonist of screening PBSF/SDF-1 or the method for antagonist is characterized in that

(a) will express the cell of polypeptide in the arbitrary claim of claim 6-9 or the cell of claim 15, mouse PBSF/SDF-1 or people PBSF/SDF-1 and the material that becomes the screening object mix, then the mixture that obtains of incubation; With

(b) measure this intracellular calcium ion concn, and/or measure the combination activity of polypeptide expressed and this mouse PBSF/SDF-1 or people PBSF/SDF-1.

20. the method for claim 19, wherein said antagonist are the hemopoietic stem cell releasing agent.

21. a test kit that is used to detect AIDS morbidity or HIV-1 infection, it comprises the cell of polypeptide in the arbitrary claim of expression claim 6-9 or the cell of claim 15.

22. the cell of expressing the cell of polypeptide in the arbitrary claim of claim 6-9 or claim 15 is used for detecting the application of the reagent that AIDS morbidity or HIV-1 infect in preparation.

Images