CN1611605A - Method for producing human leukemia inhibitory factor using transgenic plant - Google Patents
Method for producing human leukemia inhibitory factor using transgenic plant Download PDFInfo
- Publication number
- CN1611605A CN1611605A CN 200310103423 CN200310103423A CN1611605A CN 1611605 A CN1611605 A CN 1611605A CN 200310103423 CN200310103423 CN 200310103423 CN 200310103423 A CN200310103423 A CN 200310103423A CN 1611605 A CN1611605 A CN 1611605A
- Authority
- CN
- China
- Prior art keywords
- human leukemia
- inhibitory factor
- leukemia inhibitory
- transgenic plant
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
This invention is one manufactering method of leucemia inhibiting factors by utilization of transgenic plants. It involves the field of plant gene engineering technology, and constructs leucemia inhibiting factors gene hLIF on plant expression vectors, rolls in plant cells and reproduces complete transgenic plants which achieves a new form and produces leucemia inhibiting factors in cells. The leucemia inhibiting factors produced in transgenic plants has biological activity. Leucemia inhibiting factors have extensive biological effects, and has a promising future of development as addition agent of cultivating mammalian cells and therapy medicine of leucemia. The method of using plants as the reactor is easy to carry out, has low cost, without pollution and is suitable for mass production.
Description
Technical field
The present invention relates to the plant gene engineering technology field, particularly relate to a kind of plant expression system that utilizes and carry out human leukemia inhibitory factor expression vector establishment and conversion, thereby utilize transgenic plant to produce the method for human leukemia inhibitory factor.
Background technology
Prior art is obtained human leukemia inhibitory factor (hLIF) gene, adopts the expression of human leukemia inhibitory factor (hLIF) gene in pichia pastoris phaff to realize usually.Its ultimate principle is: the human leukemia inhibitory factor gene of 575bp is cloned on the expression vector pPICZ α A, is built into recombinant plasmid pPICZ alpha A hLIF.PPICZ α A hLIF cuts through the SacI enzyme and is transformed among the pichia pastoris phaff cell X33 after making it linearizing.Transformant utilizes glycerine to increase bacterium and methanol induction after Mut phenotypic screen and pcr analysis evaluation, has realized the expression of hLIF gene in Bichi yeast system.SDS PAGE detects and Western blot analytical results shows that the molecular weight of expression product is about 58.5KD, and is close with natural hLIF size, and has immunogenicity.The gel thin-layer scanning analysis shows that reorganization hLIF accounts for 32.8% of supernatant total protein.Biological activity determination is the result show, expression product can suppress mouse teratocarcinoma cell F9 clone's formation.
Microbial fermentation often needs huge facility investment.This recombinant plasmid for the recombinant plasmid of escherichia expression system and plant expression system, less stable.For expressing eukaryotic gene, the accuracy of gained protein translation post-treatment is limited.There are some differences in the pichia pastoris glycosylation with the Mammals glycosylation, becomes the factor that this proteinoid is used as curative drug that limits.
Prior art shows, at present the research of human leukemia inhibitory factor is mainly concentrated on its biological function aspect, does not still utilize plant to produce the proteic technical literature report of human leukemia inhibitory factor (hLIF) as bio-reactor.
Summary of the invention
The technical problem to be solved in the present invention is to propose a kind of method of utilizing transgenic plant to produce human leukemia inhibitory factor.
The objective of the invention is to be achieved through the following technical solutions:
Human leukemia inhibitory factor gene hLIF (Leukemia inhibitory factor) is building up to plant expression vector; Change vegetable cell over to, and bear complete transfer-gen plant again; Thereby in transgenic plant cells, produce human leukemia inhibitory factor with biologic activity.From transgenic plant cells, extract soluble protein, as the additive of mammalian cell cultivation or the clinical treatment medicine of human leukemia.
The recombinant human leukaemia inhibitory factor albumen that extracts from tobacco can suppress leukemia cell's propagation, has the biologic activity identical with native protein, can be as the additive of mammalian cell cultivation or the clinical treatment medicine of human leukemia.
Description of drawings
Fig. 1 produces the method flow diagram of human leukemia inhibitory factor for the present invention utilizes transgenic plant;
Fig. 2 is the LIF gene PCR amplified fragments electrophorogram of regeneration plant;
Fig. 3 is the LIF gene Southern blotting analytical results figure of regeneration plant;
Fig. 4 detects histogram for the activity of reorganization LIF.
Embodiment
Human leukemia inhibitory factor (hLIF) is a kind of multifunctional cytokine.Heavy dose almost acts on each organ and the tissue of body when using, mainly show as the growth that suppresses mouse M1 leukemia cell and induce its adjusting that is divided into the normal scavenger cell of form, increase megalokaryocyte and platelet count, the differentiation of inhibition embryonic stem cell and participation embryo growth and growth etc.In addition, human leukemia inhibitory factor also has the biological functions such as production of acute phase reactive protein in the growth metabolism of adjusting osseous tissue, the differentiation and proliferation that promotes the mankind hemopoietic stem cell, the production of obstruction adipocyte, the growth of stimulation sarcoplast and the adjusting liver cell.
Main technical principle of the present invention is that human leukemia inhibitory factor gene (hLIF) is building up to plant expression vector, change vegetable cell over to, and bear complete transfer-gen plant again, thereby in transgenic plant cells, produce human leukemia inhibitory factor with biologic activity.
The human leukemia inhibitory factor of producing with transgenic plant is identical with the aminoacid sequence of natural human leukemia inhibitory factor, has the effect as the clinical treatment medicine of the additive of mammalian cell cultivation or human leukemia.
Process of producing the method for human leukemia inhibitory factor with transgenic plant of the present invention is:
After being cloned into goal gene LIF on the conversion carrier, import tobacco by the Agrobacterium-mediated Transformation method; Add Bgl II restriction endonuclease point of contact in 5 ' upstream of LIF gene, add BstE II restriction endonuclease point of contact in 3 ' upstream; Utilize the outside, pcDNA6 carrier cloning site sequence, shown in following table one: and the restriction enzyme site that adds, design one couple of PCR amplimer specifically comprises:
1) adds Bgl II restriction endonuclease point of contact in 5 ' upstream of LIF gene, add BstEII restriction endonuclease point of contact in 3 ' upstream;
2) utilize the outside, pcDNA6 carrier cloning site sequence, and the restriction enzyme site that adds, design one couple of PCR amplimer: Sense primer 5 ' GTAGATCTCCACCATGAAGGTCTTGGC 3 '
Anti-sense?primer 5’AAGGTGACCTCTAGACTCGAGTCCAGAAG 3’
3) with pcDNA6 the LIF plasmid be template, pcr amplification LIF gene.The LIF gene of amplification is connected on the pGEM-T Easy intermediate carrier;
4) will be connected and be connected on the p3301 conversion carrier after LIF gene enzyme on the pGEM-T Easy carrier is cut;
5) after being cloned into goal gene LIF on the conversion carrier, import tobacco by the Agrobacterium-mediated Transformation method;
6) selecting to filter out kanamycin-resistant callus tissue on the substratum, induce embryoid or indefinite bud, carry out molecular Biological Detection after developing into seedling;
7) extract the plant albumen that molecular Biological Detection is positive and carry out the determination of activity of recombinant protein;
The whole plant of transgenic plant comprises root, stem, leaf, seed and cultured cells, all can produce human leukemia inhibitory factor albumen.All can express this albumen the time of infertility of transfer-gen plant.
Utilize transgenic plant to produce human leukemia inhibitory factor, be meant that all can change the plant of foreign gene (or vegetable cell) over to, comprise tobacco, potato, tomato, clover, rape, Arabidopis thaliana, corn, paddy rice, wheat (but being not limited to these plants), all can produce human leukemia inhibitory factor.Present experiment has extracted activated human leukemia inhibitory factor from transgene tobacco, therefore, this gene is changed in the other plant, is to obtain the transfer-gen plant of other plant and to extract activated protein according to the same method of the present invention.
Table one
EcoRV Bstxl
*Notl Xhol Xhal Apal
| | | | | |
1046?GAT?ATC?CAG?CAC?AGT?GGC?GGC?CGC?TCG?AGT?CTA?GAG?GGC?CCG?TTT?AAA
Asp?Ile?Gln?His?Ser?Gly?Gly?Arg?Ser?Ser?Leu?Glu?Gly?Pro?Phe?Lys
1142?TTT?GCC?CCT?CCC?CCG?TGC?CTT?CCT?TGA?CCCTGGAAGG?TGCCACTCCC
Phe?Ala?Pro?Pro?Pro?Cys?Leu?Pro
***
The present invention is described in detail below by specific embodiment:
Material and method
1 bacterial strain and plasmid: intestinal bacteria (E.coli) and Agrobacterium LBA4404 are available from vast company, and p3301 is available from Australian CAMBIA, and goal gene pcDNA6 LIF is so kind as to give by teacher Chang Zhijie of Tsing-Hua University.
2 toolenzymes and biochemical reagents: employed various restriction enzymes (Bgl II in the experiment, BstEII, Not I, Kpn I, Nhe I, Xho I etc.), modifying enzyme, RNase A, Taq DNA Polymerase, T4 DNA Ligase, pGEM-T Easy support agent box are available from Promega, Takara, the magnificent and white bio-engineering corporation in Yuanping City; IPTG, X-gal, penbritin (Amp), kantlex (Kan), Streptomycin sulphate microbiotic such as (Sm) are available from Sigma company; Plant hormone 6-BA, NAA, weedicide (PPT) are preserved by Agricultural biotechnologies National Key Laboratory.
3 instruments: pcr amplification instrument (GeneAmp PCR System 9700)
4 substratum
LB substratum (1 liter): peptone 10g, yeast extract 5g, NaCl 10g, pH7.0
(solid medium adds the 15g agar powder for every liter), autoclaving;
YEB substratum (1 liter): yeast extract 1g, extractum carnis 5g, peptone 5g, sucrose 5g, MgSO
4.7H
2O
0.5g, pH7.0 (solid medium adds the 15g agar powder for every liter), autoclaving;
MS minimum medium (1 liter): MS macroelement, trace element, organism, 30g sucrose, 8g agar,
pH5.8；
Tobacco division culture medium: MS substratum+3mg/L 6-BA+0.2mg/L NAA+6mg/L PPT+Cef
500μg/ml?pH5.8；
Tobacco root media: MS minimum medium+6mg/L PPT+Cef 500 μ g/ml, pH5.8
5 pcr amplification primers:
Sense?primer 5’GTA?GAT?CTC?CAC?CAT?GAA?GGT?CTT?GGC 3’
Anti-sense?primer?5’AAG?GTG?ACC?TCT?AGA?CTC?GAG?TCC?AGA?AG 3’
Example one: the structure of human leukemia inhibitory factor (LIF) gene plant expression vector
1 pcr amplification LIF gene
(1) in advance the PCR instrument is heated to 94 ℃ (warm start can guarantee to obtain special pcr amplification product);
(2) (on ice) adds following component successively in the PCR pipe:
H
2O 39.5μl
10×PCR?buffer 5μl
10mM?dNTP?mix 1μl
Sense?primer(10μM) 1μl
Anti-sense?Primer(10μM) 1μl
Dilution 50 (500) pcDNA6 doubly LIF plasmid 2 μ l
Taq enzyme (5U/ μ l) 0.5 μ l
Total 50μl
(3) from above mixture being put into the good PCR instrument of preheating on ice, increase according to following program: 94 ℃ of sex change 5min; Again in 94 ℃ of sex change 1min, 53 ℃ of annealing 1min, 72 ℃ are extended 1min, 5 circulations; Continue another program then, 94 ℃ of sex change 1min, 65.5 ℃ of annealing 1min, 72 ℃ are extended 1min, 25 circulations; 72 ℃ keep 7min, 4 ℃ of insulations.
(4) with reference to specification sheets with the PCR product cloning to pGEM-T Easy carrier, the plasmid called after pGEM-T Easy/LIF of formation.
2 connect product transforms and identifies
PGEM-T Easy/LIF plasmid is transformed in the bacillus coli DH 5 alpha competent cell, filter out positive colony containing on the LB solid medium (containing IPTG+X-gal) of penbritin (Amp), extract the plasmid DNA of positive colony, carry out BstE II and Bgl II double digestion, the evaluation of NotI single endonuclease digestion.Check order behind the positive clone of qualification result, sequencing result is as follows:
Sense?Primer
----?----?----?----?-----→
GTAGATCTCCACCATGAAGGTCTTGGCGGCAGGAGTTGTGCCCCTGCTGTTGGTTCTGCACTGGAAACATGG
------
Bgl?II
GGCGGGGAGCCCCCTCCCCATCACCCCTGTCAACGCCACCTGTGCCATACGCCACCCATGTCACAACAACCTC
ATGAACCAG
ATCAGGAGCCAACTGGCACAGCTCAATGGCAGTGCCAATGCCCTCTTTATTCTCTATTACACAGCCCAGGGGG
AGCCGTTCC
CCAACAACCTGGACAAGCTATGTGGCCCCAACGTGACGGACTTCCCGCCCTTCCACGCCAACGGCACGGAGAA
GGCCAAGCT
GGTGGAGCTGTACCGCATAGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTC
AACCCCAGT
GCCCTCAGCCTCCACAGCAAGCTCAACGCCACCGCCGACATCCTGCGAGGCCTCCTTAGCAACGTGCTGTGCC
GCCTGTGCA
GCAAGTACCACGTGGGCCATGTGGACGTGACCTACGGCCCTGACACCTCGGGTAAGGATGTCTTCCAAAAGAA
GAAGCTGGG
CTGTCAACTCCT
Anti-sense?Primer
←---------------------------
GGGGAAGTATAAGCAGATCATCGCCGTGTTGGCCCAGGCCTTCTGGACTCGAGTCTAGAGGTCACCTT
--------
BstE?II
Wherein, upstream ATG (shade demonstration) is an initiator codon, and downstream TAG (shade demonstration) is a terminator codon; Arrow indicates the used a pair of primer of pcr amplification; The horizontal line place is restriction enzyme site BstEII, the Bgl II of design.Afterwards, relatively with the homologous sequence among sequence results and the Genbank.The result is as follows:
Query：14 atgaaggtcttggcggcaggagttgtgcccctgctgttggttctgcactggaaacatggg?73
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct：65 atgaaggtcttggcggcaggagttgtgcccctgctgttggttctgcactggaaacatggg?124
Query：74 gcggggagccccctccccatcacccctgtcaacgccacctgtgccatacgccacccatgt?133
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct：125?gcggggagccccctccccatcacccctgtcaacgccacctgtgccatacgccacccatgt?184
Query：134?cacaacaacctcatgaaccagatcaggagccaactggcacagctcaatggcagtgccaat?193
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct：185?cacaacaacctcatgaaccagatcaggagccaactggcacagctcaatggcagtgccaat?244
Query：194?gccctctttattctctattacacagcccagggggagccgttccccaacaacctggacaag?253
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct：245?gccctctttattctctattacacagcccagggggagccgttccccaacaacctggacaag?304
Query：254?ctatgtggccccaacgtgacggacttcccgcccttccacgccaacggcacggagaaggcc?313
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct：305?ctatgtggccccaacgtgacggacttcccgcccttccacgccaacggcacggagaaggcc?364
Query：314?aagctggtggagctgtaccgcatagtcgtgtaccttggcacctccctgggcaacatcacc?373
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct：365?aagctggtggagctgtaccgcatagtcgtgtaccttggcacctccctgggcaacatcacc?424
Query：374?cgggaccagaagatcctcaaccccagtgccctcagcctccacagcaagctcaacgccacc?433
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct：425?cgggaccagaagatcctcaaccccagtgccctcagcctccacagcaagctcaacgccacc?484
Query：434?gccgacatcctgcgaggcctccttagcaacgtgctgtgccgcctgtgcagcaagtaccac?493
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct：485?gccgacatcctgcgaggcctccttagcaacgtgctgtgccgcctgtgcagcaagtaccac?544
Query：494?gtgggccatgtggacgtgacctacggccctgacacctcgggtaaggatgtcttccaaaag?553
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct：545?gtgggccatgtggacgtgacctacggccctgacacctcgggtaaggatgtcttccagaag?604
Query：554?aagaagctgggctgtcaactcctggggaagtataagcagatcatcgccgtgttggcccag?613
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct：605?aagaagctgggctgtcaactcctggggaagtataagcagatcatcgccgtgttggcccag?664
Query：614?gccttct?620
|||||||
Sbjct：665?gccttct?671
Wherein, the LIF gene that Sbjct representative order-checking obtains, the Query representative that delivered with the sequence LIF dna homolog, become g in the base of 601 (Sbjct) by a, form and protein expression but do not influence amino acid.
The structure of 3 plant expression vectors: the LIF gene is through transforming, because restriction endonuclease sites has been added at two ends, so size becomes 644bp.PGEM-T Easy/LIF is carried out BglII and BstE II double digestion with the p3301 carrier, and enzyme is cut the fragment that the product electrophoresis reclaims corresponding about 644bp and 9.9kb, reclaims product and connects 4hr (16 ℃ of water-baths) with the T4 dna ligase.Connect the product transformed into escherichia coli, filter out positive colony containing on the substratum of kantlex.Extract the plasmid DNA of positive colony, carry out enzyme respectively and cut with PCR and identify.The target gene fragment (LIF) of the 644bp size that negative contrast do not have has all appearred in the result in the amplified reaction that with the positive colony is template.Prove that thus the LIF gene successfully is building up on the plant conversion carrier p3301.
Enzyme is cut, connection and method for transformation be all with reference to the specification sheets of " molecular cloning experiment guide " (Sa nurse Brooker is compiled, cold spring harbor laboratory, calendar year 2001, third edition) and agents useful for same.
Example two: the genetic transformation of LIF gene in tobacco
A large amount of plasmid DNA of extracting p3301/LIF are got 1 μ g and are transformed Agrobacterium LBA4404 competent cell, and 28 ℃, YEB substratum (containing Km and Sm) are gone up and cultivated two days.Select that two clones are a small amount of to extract that plasmid DNA are done pcr amplification and enzyme is cut evaluation, result's amplification obtains size and be that the purpose band of 644bp, enzyme are cut and identify that institute's slitting band is big or small and also be consistent with theoretical size.
The Agrobacterium that will contain plant expression vector is inoculated in the YEB liquid medium (containing 100 μ g/ml Kan and 125 μ g/ml Sm), 28 ℃ of shaking culture to OD600 be 0.6-0.8; 4000rpm, centrifugal 10 minutes of room temperature with MS salts solution (PH7.0) thalline that suspends again, adopts 20-50 that the MS salts solution is diluted to original volume doubly during use.
With leaf dish method transformation of tobacco blade.Get tobacco aseptic seedling blade, cut blade edge and main vein, blade is cut into 0.4 * 0.6cm
2Size, explant were soaked 10 minutes in the Agrobacterium bacterium liquid for preparing, and blotted the bacterium liquid on vegetable material surface with aseptic filter paper, changed the MS minimum medium of upper berth one deck filter paper over to, the dark cultivation.Forward to after 3 days in the screening culture medium of adding weedicide PPT (6mg/L) and Cef 500 μ g/ml and cultivate illumination every day 12～16 hours, 28 ℃ of cultivations.Per two all subcultures are once lost the blade and the callus of flavescence at every turn, and big callus cuts into fritter, through three to four generation succeeding transfer culture callus grow seedling successively.Seedling is transferred to root induction in the Cans that root media is housed, indoor 28 ℃ of cultivations, every day, the illumination of 3000Lx light intensity was 16 hours, will soon take root, treat that root system development fully after, be transplanted in the greenhouse.
Example three: the Molecular Detection of transgenic plant
1 PCR detects
Get the 30-50ml centrifuge tube, add 7.5ml CTAB and extract damping fluid, preheating 30min in 60 ℃ of waters bath with thermostatic control; Take by weighing the 2.0g tobacco leaf, in mortar, add liquid nitrogen and be ground into powder; Powder is carefully scraped in the liquid of centrifuge tube, stirred mixing, be incubated 30min in 60 ℃ of water-baths, jog several times therebetween; Take out centrifuge tube, add the saturated phenol of 1ml in every pipe, adding 6.5ml chloroform/primary isoamyl alcohol (24: 1) again after shaking evenly slightly and up hill and dale mixes, more than the placement 5min, treats after the protein denaturation centrifugal; Supernatant liquor is transferred in the new centrifuge tube, added the Virahol of 2/3rds volumes, mixing, it is cotton-shaped that nucleic acid is precipitated into, and picking is deposited in another centrifuge tube, adds the 5-10ml washing lotion, places more than the 30min; Abandon supernatant, dry up precipitation.Use 0.5ml TE dissolution precipitation then, lysate is transferred in the 1.5ml centrifuge tube, use phenol/chloroform (1: 1) and each extracting of chloroform/primary isoamyl alcohol (24: 1) once; Add RnaseA to final concentration 10 μ g/ml, 37 ℃ of insulation 1h, digestion RNA; Add the precooling dehydrated alcohol of 7.5mol/L ammonium acetate to final concentration 2.5mol/L and 2.5 times of volumes afterwards, low temperature is placed more than the 10min down, and the centrifugal 10min of 12000rpm abandons supernatant; With the washing with alcohol precipitation of 1ml70%, the centrifugal 10min of 12000rpm abandons supernatant; On super clean bench, dry up precipitation, be dissolved in an amount of TE or the sterilized water (50-100 μ l) 4 ℃ of preservations.
PCR reaction system: ddH2O 31 μ l
10×Buffer 5μl
dNTP(10mM) 1μl
5’primer(μM) 2μl
3’primer(μM) 2μl
Taq(5U/μl) 2μl
The total DNA 4 μ l of tobacco
Total 50μl
Reaction conditions: 94 ℃ of 5min
72℃ 7min
4℃ ∝
Get PCR product 10 μ l and carry out electrophoresis detection.With plasmid p3301/LIF is over against photograph, and transfer-gen plant is not negative contrast, all has size to be the goal gene band of 644bp in most of sample, and negative contrast does not then have.The results are shown in Figure 5, wherein, 0+: over against photograph, plasmid p3301/LIF; M:1Kb Ladder; O-: negative contrast, not genetically modified tobacco; 1-14: number the transgene tobacco of LIF1-LIF14 respectively, major part has strong or weak band.
2 Southern hybridization
The SDS method is extracted the total DNA of tobacco in a large number, carries out enzymolysis in the 1.5mlEppendorf pipe: add following component:
Genomic dna 30 μ g
10×Buffer 10μl
EcoR I restriction endonuclease 10 μ l
DdH
2The O make up water is to 400 μ l
37 ℃ of enzymolysis 12 hours, whether enzyme cuts entirely to get 1 μ l electrophoresis detection, as not exclusively, then adds enzyme and Buffer; After enzyme cuts, electrophoresis, commentaries on classics nylon membrane.Preserve or be directly used in hybridization for 4 ℃.
Label probe:
The PCR product of purifying adopts the random priming label probe.Get the probe 50ng of preparation,, press the Prime-a-GeneLabelling System Kit explanation of Promega company, add successively with distilled water polishing 30 μ l, sex change 5min in the boiling water, ice bath 5min:
5×labeling?buffer 10μl
dA.T.G(0.5Mm?each) 2μl
BSA(10mg/ml) 2μl
Klenow?Framents(5units/μl) 1μl
α-
32p-dCTP(10μCi/μl) 5Cl
Total 50.0μl
Place 5hr in 37 ℃ of thermostat containers, marked product is removed free isotope through Sephadex G-50 column chromatography.Collection contains the elutriant of label probe, sex change 10min in the boiling water, and ice bath 5min, standby.
Prehybridization and hybridization:
There is one of DNA to face up the nylon membrane that takes a turn for the better and puts into hybridizing box, add prehybridization solution (salmon sperm dna μ g/ml+ 0% methane amide of 5 * SSPE+0.1%SDS+95～100 ℃ heat denatured 5min), in 42 ℃ of prehybridization 5hr; Add probe, 42 ℃ of hybridization 12～16hr through heat denatured; Hybridization is used 2 * SSC+0.5%SDS after finishing successively, 1 * SSC+0.1%SDS, and 0.2 * SSC washes film at 65 ℃, each 30min; After washing the film end, blot the moisture on film surface with filter paper, preservative film is wrapped, and puts magazine into ,-70 ℃ of radioautograph, and the time of autography is determined according to the power of signal.
The transgenic tobacco plant that pcr amplification is positive carries out Southern hybridization, and partial results is seen Fig. 6.0+ wherein: over against photograph, the LIF gene PCR reclaims segment; 0-: negative contrast, not genetically modified tobacco; 1-7: the transgene tobacco of numbering LI F1-LIF7 respectively.The signal band that occurs on the X-mating plate marks with literal.The illustration purpose gene has been incorporated in the tobacco gene group, and tangible insertion site is arranged in most of plant, and its result and pcr amplification detect and match.
The Western of 3 transgene tobaccos detects
Extracting tobacco leaf solubility total protein carries out the SDS-PAGE electrophoresis and makees Western suction seal, (compile by Sa nurse Brooker with reference to " molecular cloning experiment guide " for method, cold spring harbor laboratory, calendar year 2001, the third edition), the result can observe target protein, but because the specificity of used antibody is not strong, therefore has non-specific band on the film of Western suction seal.
The activity of 4 reorganization LIF detects
NHX NHX Lysis
Cont Sample buffer Bank 1# 2# 3# 4# 5#
45734 104445 75552 68840 155257 283252 253613 169544 437530
108101 135209 93227 62290 262752 228151 135653 493223
104763 128892 121292 80942 381120 440253 283584 205105 487465
Average?86199.33?122848.7?96690.33?70690.67?266376.3?361752.5 255116?170100.7?472739.3
STDEV 35083.73?16247.99?23065.84?9462.716?112975.1?111016.5?27747.05?34729.35?30627.79
6# 7# 9# 10# 11# 12#
246106 81852 90158 85237 420340 55540
159036 71366 122449 50707 444579 61531
154799 95355 126232 86320 455202 48405
Average 186647?82857.67?112946.3 74088?440040.3?55158.67
STDEV 51536.57?12026.08?19825.71?20255.78?17868.67?6571.304
Ginseng sees the above table, extract the transgene tobacco leaf protein with the phosphoric acid buffer that contains 1% polyvinylpyrrolidone (PH7.0), extracting solution is joined among the cultured leukemia cell, observe these leukemia cell's growths and whether be suppressed, thereby whether the recombinant protein of determining gained has biologic activity; Wherein 1#-12# numbers the transgene tobacco of LIF1-LIF12 respectively, and the result surveys has 5 strains to have the proteic biology expression activity of LIF in the 12 strain transgenic tobacco plants, and result and pcr amplification and Southern hybridization detected result match.
It should be noted last that: above embodiment is the unrestricted technical scheme of the present invention in order to explanation only, although the present invention is had been described in detail with reference to the foregoing description, those of ordinary skill in the art is to be understood that: still can make amendment or be equal to replacement the present invention, and not breaking away from any modification or partial replacement of the spirit and scope of the present invention, it all should be encompassed in the middle of the claim scope of the present invention.
Claims (7)
1, a kind of method of utilizing transgenic plant to produce human leukemia inhibitory factor is characterized in that:
(1) human leukemia inhibitory factor gene hLIF is building up to plant expression vector;
(2) change vegetable cell over to, and bear complete transfer-gen plant again;
Thereby in transgenic plant cells, produce human leukemia inhibitory factor, from transgenic plant cells, extract soluble protein, as the additive of mammalian cell cultivation or the clinical treatment medicine of human leukemia with biologic activity.
2, the method for utilizing transgenic plant to produce human leukemia inhibitory factor according to claim 1 is characterized in that: after being cloned into goal gene LIF on the conversion carrier, import tobacco by the Agrobacterium-mediated Transformation method.
3, the method for utilizing transgenic plant to produce human leukemia inhibitory factor according to claim 1 and 2 is characterized in that:
1) adds Bgl II restriction endonuclease point of contact in 5 ' upstream of LIF gene, add BstEII restriction endonuclease point of contact in 3 ' upstream;
2) utilize the outside, pcDNA6 carrier cloning site sequence, and the restriction enzyme site that adds, design one couple of PCR amplimer: Sense primer 5 ' GTAGATCTCCACCATGAAGGTCTTGGC 3 '
Anti-sense?primer?5’AAGGTGACCTCTAGACTCGAGTCCAGAAG?3’
3) with pcDNA6 the LIF plasmid be template, pcr amplification LIF gene, with the amplification the LIF gene be connected on the pGEM-T Easy intermediate carrier;
4) will be connected and be connected on the p3301 conversion carrier after LIF gene enzyme on the pGEM-T Easy carrier is cut.
4, the method for utilizing transgenic plant to produce human leukemia inhibitory factor according to claim 1 is characterized in that: selecting to filter out resistant calli on the substratum, induce embryoid or indefinite bud, carry out molecular Biological Detection after developing into seedling.
5, the method for utilizing transgenic plant to produce human leukemia inhibitory factor according to claim 1 is characterized in that: extract soluble proteins from the plant that molecular Biological Detection is positive, carry out the determination of activity of human leukemia inhibitory factor.
6 methods of utilizing transgenic plant to produce human leukemia inhibitory factor according to claim 5 is characterized in that: the whole plant of the transgenic plant that utilized, comprise root, stem, leaf, seed, and all can produce human leukemia inhibitory factor albumen.
7, the method for utilizing transgenic plant to produce human leukemia inhibitory factor according to claim 2 is characterized in that: describedly can transform the plant that produces human leukemia inhibitory factor with agrobacterium tumefaciens and include, but are not limited to tobacco, potato, tomato, clover, rape, Arabidopis thaliana, corn, paddy rice, wheat.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310103423 CN1262657C (en) | 2003-10-31 | 2003-10-31 | Method for producing human leukemia inhibitory factor using transgenic plant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310103423 CN1262657C (en) | 2003-10-31 | 2003-10-31 | Method for producing human leukemia inhibitory factor using transgenic plant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1611605A true CN1611605A (en) | 2005-05-04 |
| CN1262657C CN1262657C (en) | 2006-07-05 |
Family
ID=34756657
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200310103423 Expired - Fee Related CN1262657C (en) | 2003-10-31 | 2003-10-31 | Method for producing human leukemia inhibitory factor using transgenic plant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1262657C (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105671072A (en) * | 2014-11-17 | 2016-06-15 | 江苏命码生物科技有限公司 | Preparation method and applications of transgenic plant containing anti-miRNA-214 |
-
2003
- 2003-10-31 CN CN 200310103423 patent/CN1262657C/en not_active Expired - Fee Related
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105671072A (en) * | 2014-11-17 | 2016-06-15 | 江苏命码生物科技有限公司 | Preparation method and applications of transgenic plant containing anti-miRNA-214 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1262657C (en) | 2006-07-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1155709C (en) | Whisker-mediated transformation of plant cell aggregates and plant tissues and regeneration of plants thereof | |
| CN1887903A (en) | Nitrate transport protein of diatom and its coding gene and application | |
| CN1990871A (en) | Preparation method of recombinant human plasminogen Kringle 5(hk5) | |
| CN1291021C (en) | Use of boea crassifolia BcBCP1 gene for breeding drought-salt-tolerant plants | |
| CN1680437A (en) | Fe(II) transfer protein of crabapple and its coding gene and use | |
| CN1788087A (en) | Alcohol dehydrogenase gene of acetic acid bacterium | |
| CN1824779A (en) | Soyabean thermal excited transcryption factor, its coding gene and application | |
| CN1769457A (en) | Butterfly orchid pPI15 encoding sequence and its uses | |
| CN1844143A (en) | Plant salt-tolerance associated protein and genes encoding same and use thereof | |
| CN1325448A (en) | Modification of plant fibres | |
| CN1765924A (en) | Plant adversity resistance related protein and encoding gene thereof and application | |
| CN1908011A (en) | Plant inverse-resistant zinc finger protein, coding gene and application thereof | |
| CN1262657C (en) | Method for producing human leukemia inhibitory factor using transgenic plant | |
| CN1733802A (en) | Plant DREB transcription factor and its coding gene and uses | |
| CN1295248C (en) | Small salt mustard sodium hydrogen pump protein gene TNHX1 and its anti salt application | |
| CN1153832C (en) | A thermophilic alkaline phosphoesterase and its expression | |
| CN1218959C (en) | Paddy rice ethylene receptor protein, coded gene and use thereof | |
| CN1900280A (en) | Rice tiller regulating gene OsTIL1 and its use | |
| CN1563386A (en) | Reducing enzyme protein coded sequence of sulfoxide methionine of cotton | |
| CN1385530A (en) | Method for raising taxol content by gene engineering technology | |
| CN1614024A (en) | Transgened-tobacco for degrading organic mercury pollution | |
| CN1546672A (en) | Construction method of recombinant expression vector of plant gene | |
| CN1746299A (en) | A kind of thermally-stabilised TreP and encoding gene and application | |
| CN1814755A (en) | High-temperature neutral protease and preparing method | |
| CN1335855A (en) | Novel protein, gene encoding the same and method of utilization thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |