CN1587385A - High efficiency experssino human glicentin-1 gene engineering bacteria and its construction method and use - Google Patents
High efficiency experssino human glicentin-1 gene engineering bacteria and its construction method and use Download PDFInfo
- Publication number
- CN1587385A CN1587385A CN 200410054397 CN200410054397A CN1587385A CN 1587385 A CN1587385 A CN 1587385A CN 200410054397 CN200410054397 CN 200410054397 CN 200410054397 A CN200410054397 A CN 200410054397A CN 1587385 A CN1587385 A CN 1587385A
- Authority
- CN
- China
- Prior art keywords
- glp
- recombinant plasmid
- peptide
- gene
- human glucagon
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present invention belongs to the field of biological engineering technology. The gene engineering bacteria is colibacillus DH5-alpha, BL21(DE3) or BLR(DE3) carrying the recombinant plasmid of human glicentin-1 gene, i. e., GLP-1 gene. The construction process of the gene engineering bacteria includes connecting serially DNA sequence containing human glicentin-1 gene to form polymer, constituting expression vector and converting to colibacillus to obtain efficiently expressing human glicentin-1 gene engineering bacteria. With the gene engineering bacteria and through a three-step process of liquid culture, purification to produce human glicentin-1 fusion protein and preparation of human glicentin-1, human glicentin-1 product may be produced. The present invention has the advantages of high expression amount, less purification steps, high yield and low production cost.
Description
Technical field
The present invention relates to a kind of genetic engineering bacterium and construction process and application that efficiently expresses human glucagon-like-peptide-1, belong to technical field of bioengineering.
Background technology
Diabetes are worldwide diseases, and sickness rate is high, and human health is constituted a serious threat.According to international diabetes study institute (IDI) up-to-date address prediction in 2003, global diabetic subject has reached 1.94 hundred million people, and according to present rate of growth, by 2025, number of patients will reach 3.33 hundred million.China has diabetic subject more than 4,000 ten thousand, and in early 1980s, China's onset diabetes rate only is 0.67%, and ground sickness rate such as Beijing, Shanghai all surpass 10% now, and this numeral is also continuing increase.According to statistics, the year cost that common diabetic subject is used for the treatment of is 3726 yuan, and the diabetic subject needs lifelong medication, and the Glucovance of therefore developing high performance cheap has tempting prospect.
The type ii diabetes patient is the colony of a cause of disease complexity, its principal feature is the ability that pancreas has synthetic insulin, but insulin secretion quantity not sufficient, insulin secretion lags behind after the meal, therefore, promote that pancreatic beta-emiocytosis Regular Insulin and then controlling blood sugar are important goals of type ii diabetes medicine.
In recent years, to insulin secretion accelerating peptide: human glucagon-like-peptide-1 (glucagon-like peptide-1, progress GLP-1) is very fast, and it is fine to be applied to treat the diabetes effect.Human glucagon-like-peptide-1 mainly is that molecular weight is about 3.355KD by the polypeptide hormone of a kind of 31 peptides of the L emiocytosis of far-end ileum, colon and rectum.The major physiological effect of human glucagon-like-peptide-1 comprises: the release action of (1) glucose dependency pancreotropic hormone.Its mechanism of action be by with the special acceptor interaction on pancreatic beta cell surface, the insulin secretion of glucose induction is significantly increased.(2) secretion of release of stimulating growth chalone and glucagon suppression.(3) suppress parietal cell secretion hydrochloric acid in gastric juice, the emptying that prolongs stomach.(4) increase satiety, depress appetite reduces the picked-up of energy.Based on above-mentioned result of study, human glucagon-like-peptide-1 is expected to become the especially polypeptide drugs of type ii diabetes of treatment diabetes.The promoting insulin secretion of human glucagon-like-peptide-1 depends on the concentration of glucose, hypoglycemia can not take place with its treatment diabetes, shows that it aspect diabetes especially type ii diabetes treatment, has a good application prospect.
Chemosynthesis is adopted in the preparation of external human glucagon-like-peptide-1 more, and big, the synthetic cost height of the polypeptide technical difficulty of chemosynthesis, purification difficult.Product with this method preparation costs an arm and a leg, and is not suitable for China's actual conditions, therefore presses for the human glucagon-like-peptide-1 of the high performance cheap of development production domesticization.
Summary of the invention
Be the low human glucagon-like-peptide-1 of production cost, at first must find and make up a kind of human glucagon-like-peptide-1 that efficiently expresses, can produce the genetic engineering bacterium of human glucagon-like-peptide-1.
The technical problem that the present invention will solve is to propose a kind of genetic engineering bacterium that efficiently expresses human glucagon-like-peptide-1.This genetic engineering bacterium is bacillus coli DH 5 alpha, BL21 (DE3) or the BLR (DE3) that carries recombinant plasmid, described recombinant plasmid is the plasmid pET32a (+) that contains the GLP-1 gene, the string number that described recombinant plasmid contains the GLP-1 gene is 1～16 string, wherein, the GLP-1 gene is the human glucagon-like-peptide-1 gene.
Described genetic engineering bacterium is further characterized in that described recombinant plasmid is four kinds of recombinant plasmid: pET32a (+)-GLP-1, pET32a (+)-TrxA-GLP-1, pET32a (+)-P
T7-GLP-1 and pET32a (+)-P
T7One of-TrxA-GLP-1, wherein, TrxA is a Trx, P
T7It is the promotor of described plasmid pET32a (+).
Another technical problem that the present invention will solve provides a kind of construction process that efficiently expresses the genetic engineering bacterium of human glucagon-like-peptide-1.The present invention is by solving above technical problem by the following technical solutions.On dna level, the dna sequence dna series connection that will contain the human glucagon-like-peptide-1 gene is polymer, is built into expression vector, transformed into escherichia coli, and acquisition efficiently expresses the genetic engineering bacterium of human glucagon-like-peptide-1.
Now describe technical scheme of the present invention in detail.A kind of construction process that efficiently expresses the genetic engineering bacterium of human glucagon-like-peptide-1 is characterized in that, the concrete operations step:
The first step base sequence is synthetic
The biotech company that entrusts specialty is according to sequence: SD sequence-purification tag HisTag-enteropeptidase EK site-human glucagon-like-peptide-1, i.e. and GLP-1 gene-terminator codon TAA, chemosynthesis length is the base sequence of 215bp, and is as follows,
XbaI SD sequence
5’-CC
tctagaAATAATTTTGTTTAACTTTAAG
AAGGAGATATACATATGTCTGGA
Met?Ser?Gly
His·Tag BglII
TCAGGT
CATCATCATCATCATCATTCTTCT
agatctGATGACGACGACAAG
Ser?Gly?His?His?His?His?His?His?Ser?Ser?Gly?Thr?
Asp?Asp?Asp?Asp?Lys
EK
CATGCCGAAGGCACCTTTACCAGCGATGTGAGCAGCTATCTGGAAGGC
His?Ala?Glu?Gly?Thr?Phe?Thr?Ser?Asp?Val?Ser?Ser?Tyr?Leu?Glu?Gly
CAGGCCGCCAAAGAATTTATTGCCTGGCTGGTGAAAGGCAGAGGCTAA
Gln?Ala?Ala?Lys?Glu?Phe?Ile?Ala?Trp?Leu?Val?Lys?Gly?Arg?Gly?End
SpeI?EcoRI
G
actagt?
gaattcAC-3’
This base sequence is cloned among the plasmid pMD18-T, obtain containing SD sequence-purification tag HisTag-enteropeptidase EK site-human glucagon-like-peptide-1, be the recombinant plasmid pMD18-T-GLP-1 of the dna sequence dna of GLP-1 gene-terminator codon TAA, described base sequence contains restriction enzyme XbaI, BglII, SpeI and EcoRI site, and wherein restriction enzyme XbaI, SpeI are a pair of isocaudarners;
Second step made up the genetic engineering bacterium of the dna sequence dna that contains single string GLP-1 gene
The dna sequence dna of single string GLP-1 gene is SD-HisTag-EK-GLP-1-TAA, the recombinant plasmid pMD18-T-GLP-1 that obtains with two kinds of restriction enzymes double zyme cutting the first steps, described two kinds of restriction enzymes are XbaI and EcoRI, purifying reclaims small segment, with same two kinds of restriction enzymes double zyme cutting plasmid pET-32a (+), purifying reclaims big fragment, the small segment and the big fragment that connect above-mentioned recovery, obtain containing the singly recombinant plasmid pET-32a-GLP-1-1c of the dna sequence dna of string SD-HisTag-EK-GLP-1-TAA, recombinant plasmid pET-32a-GLP-1-1c is transformed in the bacillus coli DH 5 alpha, make the genetic engineering bacterium of the dna sequence dna that contains single string GLP-1 gene, that be connected with SD sequence in the described dna sequence dna is the promotor P of plasmid pET-32a (+)
T7
The 3rd step made up the genetic engineering bacterium that efficiently expresses human glucagon-like-peptide-1
With restriction enzyme HindIII/XbaI and the HindIII/SpeI recombinant plasmid pET-32a-GLP-1-1c that obtains of second step of double digestion respectively, the big fragment that restriction enzyme HindIII/SpeI double digestion is reclaimed is connected with the small segment that restriction enzyme HindIII/XbalI double digestion reclaims, obtain the dimer recombinant plasmid pET-32a-GLP-1-2c of GLP-1 gene, repeat above-mentioned steps three times, obtain the tetramer recombinant plasmid pET-32a-GLP-1-4c of GLP-1 gene respectively, 16 aggressiveness recombinant plasmid pET-32a-GLP-1-16c of eight aggressiveness recombinant plasmid pET-32a-GLP-1-8c of GLP-1 gene and GLP-1 gene, the recombinant plasmid that builds is transformed into respectively among intestinal bacteria BL 21 (DE3) or the BLR (DE3), obtains efficiently expressing the genetic engineering bacterium of human glucagon-like-peptide-1.
The plasmid pMD18-T that above-mentioned structure relates to, pET-32a (+), bacillus coli DH 5 alpha, BL21 (DE3) and BLR (DE3), restriction enzyme XbaI, BglII, SpeI, EcoRI and HindIII all can buy from market.Entrusting the biotech company of the specialty of synthetic described base sequence is the learned Bioisystech Co., Ltd in Shanghai.
1c in the above-mentioned recombinant plasmid, 2c, 4c, 8c or 16c represent that respectively the string number that contains the GLP-1 gene in the recombinant plasmid is single string, two strings, four strings, eight string or 16 strings.
Technical scheme of the present invention is further characterized in that, the dna sequence dna of single string GLP-1 gene is SD-HisTag-TrxA-EK-GLP-1-TAA in above-mentioned second step, the restriction enzyme that recombinant plasmid pMD18-T-GLP-1 and plasmid pET-32a (+) is carried out double digestion is KpnI and EcoRI, obtains containing the recombinant plasmid pET-32a-TrxA-GLP-1-1c of the dna sequence dna of single string SD-HisTag-TrxA-EK-GLP-1-TAA.
The restriction enzyme KpnI that above-mentioned structure relates to can buy from market.
Technical scheme of the present invention is further characterized in that the dna sequence dna of single string GLP-1 gene is P in above-mentioned second step
T7-SD-HisTag-EK-GLP-1-TAA, the restriction enzyme that recombinant plasmid pMD18-T-GLP-1 and plasmid pET-32a (+) is carried out double digestion is XbaI and EcoRI, obtains containing single string P
T7The recombinant plasmid pET-32a-P of the dna sequence dna of-SD-HisTag-TrxA-EK-GLP-1-TAA
T7-GLP-1-1c is in above-mentioned the 3rd step, with recombinant plasmid pET-32a-P
T7After-GLP-1-1c cut with restriction enzyme ClaI enzyme, the Klenow fragment was mended flat, cut with restriction enzyme Hind III enzyme again, and purifying reclaims small segment, with recombinant plasmid pET-32a-P
T7-GLP-1-1c restriction enzyme Sal I/HindIII double digestion, purifying reclaims big fragment, connects the small segment and the big fragment of above-mentioned recovery, obtains the dimer recombinant plasmid pET-32a-P of GLP-1 gene
T7-GLP-1-2c.
Restriction enzyme ClaI that above-mentioned structure relates to and SalI and Klenow fragment all can be buied from market.
Technical scheme of the present invention is further characterized in that the dna sequence dna of single string GLP-1 gene is P in above-mentioned second step
T7-SD-HisTag-TrxA-EK-GLP-1-TAA, the restriction enzyme that recombinant plasmid pMD18-T-GLP-1 and plasmid pET-32a (+) is carried out double digestion is KpnI and EcoRI, obtains containing single string P
T7The recombinant plasmid pET-32a-P of the dna sequence dna of-SD-HisTag-TrxA-EK-GLP-1-TAA
T7-TrxA-GLP-1-1c is in above-mentioned the 3rd step, with recombinant plasmid pET-32a-P
T7After-TrxA-GLP-1-1c cut with restriction enzyme ClaI enzyme, the Klenow fragment was mended flat, cut with restriction enzyme Hind III enzyme again, and purifying reclaims small segment, with recombinant plasmid pET-32a-P
T7-TrxA-GLP-1-1c restriction enzyme Sal I/Hind III double digestion, purifying reclaims big fragment, connects the small segment and the big fragment of above-mentioned recovery, obtains the dimer recombinant plasmid pET-32a-P of GLP-1 gene
T7-TrxA-GLP-1-2c.
Another technical problem that the present invention will solve is to propose a kind of application that efficiently expresses the genetic engineering bacterium of human glucagon-like-peptide-1, promptly proposes the method that the described genetic engineering bacterium of a kind of usefulness is produced human glucagon-like-peptide-1.
The present invention solves the problems of the technologies described above by following technical scheme.The method that the described genetic engineering bacterium of a kind of usefulness is produced human glucagon-like-peptide-1 is characterized in that the concrete operations step:
The first step liquid culture
The above-mentioned genetic engineering bacterium that efficiently expresses human glucagon-like-peptide-1 that builds is cultured to OD600nm=0.4～0.8 o'clock in the LB liquid nutrient medium, the adding final concentration is that the IPTG of 0.4～1mM carried out abduction delivering 3～5 hours, produces and accumulate the human glucagon-like-peptide-1 fusion rotein of solubility expression;
The human glucagon-like-peptide-1 fusion rotein that the second step purifying makes
Centrifugal collection thalline is with the resuspended thalline of damping fluid, after the carrying out ultrasonic bacteria breaking, centrifugal collection supernatant, carry out affinity chromatography, collector's glucagon-like-peptide-1 fusion rotein component is that the Millipore Amicon Ultra-15 ultrafiltration pipe of 1～5KD is concentrated into 2～5mg/mL with albumen with molecular weight cut-off;
The 3rd step preparation human glucagon-like-peptide-1
With enteropeptidase enzymolysis human glucagon-like-peptide-1 fusion rotein, 4～37 ℃ of following cracking 2～16 hours, termination reaction is carried out affinity chromatography once more, collects absorption peak, and lyophilize obtains human glucagon-like-peptide-1.
The invention has the advantages that: (1) produces human glucagon-like-peptide-1 by the method for genetic engineering technique, and it is low to produce the human glucagon-like-peptide-1 cost than chemical synthesis process; (2) method by genetic engineering technique makes up the genetic engineering bacterium that contains the human glucagon-like-peptide-1 gene, has improved the expression amount of human glucagon-like-peptide-1 greatly; (3) as long as carry out affinity chromatography one time, just can obtain purer human glucagon-like-peptide-1 fusion rotein from fermented liquid, purification step is easy, is easier to operation than the repeatedly chromatography of conventional art.(4) just can obtain human glucagon-like-peptide-1 as long as carry out primary enzymolysis, purifying is very easy, the yield height.
Thereby produce human glucagon-like-peptide-1 with genetic engineering bacterium provided by the invention, and the output height, purifying process is simplified, and production cost is lower.
Description of drawings
Fig. 1 is the structure synoptic diagram of recombinant plasmid pET-32a-GLP-1-2c.
Fig. 2 is the structure synoptic diagram of recombinant plasmid pET-32a-GLP-1-8c.
Fig. 3 is the hypoglycemic activity figure as a result of human glucagon-like-peptide-1.Series 1 is physiology saline control group; Series 2 is the glucose control group; Series 3 is human glucagon-like-peptide-1 administration group.The result shows among the figure: the human glucagon-like-peptide-1 with method preparation of the present invention has kept the hypoglycemic biologic activity of natural human glucagon-like-peptide-1.
Embodiment
Below in conjunction with accompanying drawing,, further describe the present invention by embodiment.The experimental technique of unreceipted actual conditions among specification sheets and the embodiment, condition is carried out routinely.
The first step base sequence is synthetic
The biotech company that entrusts specialty is according to sequence: SD sequence-purification tag HisTag-enteropeptidase EK site-human glucagon-like-peptide-1, i.e. and GLP-1 gene-terminator codon TAA, chemosynthesis length is the base sequence of 215bp, and is as follows,
XbaI SD sequence
5’-CC
tctagaAATAATTTTGTTTAACTTTAAG
AAGGAGATATACATATGTCTGGA
Met?Ser?Gly
His·Tag BglII
TCAGGT
CATCATCATCATCATCATTCTTCT
agatctGATGACGACGACAAG
Ser?Gly?His?His?His?His?His?His?Ser?Ser?Gly?Thr?
Asp?Asp?Asp?Asp?Lys
EK
CATGCCGAAGGCACCTTTACCAGCGATGTGAGCAGCTATCTGGAAGGC
His?Ala?Glu?Gly?Thr?Phe?Thr?Ser?Asp?Val?Ser?Ser?Tyr?Leu?Glu?Gly
CAGGCCGCCAAAGAATTTATTGCCTGGCTGGTGAAAGGCAGAGGCTAA
Gln?Ala?Ala?Lys?Glu?Phe?Ile?Ala?Trp?Leu?Val?Lys?Gly?Arg?Gly?End
SpeI?EcoRI
G
actagt?
gaattcAC-3’
This base sequence is cloned among the plasmid pMD18-T, obtain containing SD sequence-purification tag HisTag-enteropeptidase EK site-human glucagon-like-peptide-1, be the recombinant plasmid pMD18-T-GLP-1 of the dna sequence dna of GLP-1 gene-terminator codon TAA, described base sequence contains restriction enzyme XbaI, BglII, SpeI and EcoRI site, and wherein restriction enzyme XbaI, SpeI are a pair of isocaudarners;
Second step made up the genetic engineering bacterium of the dna sequence dna that contains single string GLP-1 gene
The dna sequence dna of single string GLP-1 gene is SD-HisTag-TrxA-EK-GLP-1-TAA, the recombinant plasmid pMD18-T-GLP-1 that obtains with two kinds of restriction enzymes double zyme cutting the first steps, described two kinds of restriction enzymes are KpnI/EcoRI, purifying reclaims small segment, with same two kinds of restriction enzymes double zyme cutting plasmid pET-32a (+), purifying reclaims big fragment, the small segment and the big fragment that connect above-mentioned recovery, obtain containing the singly recombinant plasmid pET-32a-TrxA-GLP-1-1c of the dna sequence dna of string SD-TrxA-HisTag-EK-GLP-1-TAA, recombinant plasmid pET-32a-TrxA-GLP-1-1c is transformed in the bacillus coli DH 5 alpha, makes the genetic engineering bacterium of the dna sequence dna that contains single string SD-TrxA-HisTag-EK-GLP-1-TAA;
The 3rd step made up the genetic engineering bacterium that efficiently expresses human glucagon-like-peptide-1
With restriction enzyme HindIII/XbaI and the HindIII/SpeI recombinant plasmid pET-32a-TrxA-GLP-1-1c that obtains of second step of double digestion respectively, the big fragment that restriction enzyme HindIII/SpeI double digestion is reclaimed is connected with the small segment that restriction enzyme HindIII/XbalI double digestion reclaims, obtain the dimer recombinant plasmid pET-32a-TrxA-GLP-1-2c of GLP-1 gene, repeat above-mentioned steps three times, obtain the tetramer recombinant plasmid pET-32a-TrxA-GLP-1-4c of GLP-1 gene respectively, 16 aggressiveness recombinant plasmid pET-32a-TrxA-GLP-1-16c of eight aggressiveness recombinant plasmid pET-32a-TrxA-GLP-1-8c of GLP-1 gene and GLP-1 gene, the recombinant plasmid that builds is converted into respectively among e. coli bl21 (DE3) or the BLR (DE3), obtains efficiently expressing the genetic engineering bacterium of human glucagon-like-peptide-1.
Embodiment 2 makes up a kind of genetic engineering bacterium that efficiently expresses human glucagon-like-peptide-1: contain 1～16 single string P
T7The genetic engineering bacterium of-SD-HisTag-EK-GLP-1-TAA.
The first step base sequence is synthetic
The first step with embodiment 1;
Second step made up the genetic engineering bacterium of the dna sequence dna that contains single string GLP-1 gene
The dna sequence dna of single string GLP-1 gene is P
T7-SD-HisTag-EK-GLP-1-TAA, the recombinant plasmid pMD18-T-GLP-1 that obtains with two kinds of restriction enzymes double zyme cutting the first steps, described two kinds of restriction enzymes are XbaI and EcoRI, purifying reclaims small segment, with same two kinds of restriction enzymes double zyme cutting plasmid pET-32a (+), purifying reclaims big fragment, connects the small segment and the big fragment of above-mentioned recovery, obtains containing single string P
T7The recombinant plasmid pET-32a-P of the dna sequence dna of-SD-HisTag-EK-GLP-1-TAA
T7-GLP-1-1c is with recombinant plasmid pET-32a-P
T7-GLP-1-1c is transformed in the bacillus coli DH 5 alpha, makes to contain single string P
T7The genetic engineering bacterium of the dna sequence dna of-SD-HisTag-EK-GLP-1-TAA;
The 3rd step made up the genetic engineering bacterium that efficiently expresses human glucagon-like-peptide-1
Go on foot the recombinant plasmid pET-32a-P that makes with second
T7After-GLP-1-1c cut with restriction enzyme ClaI enzyme, the Klenow fragment was mended flat, cut with restriction enzyme Hind III enzyme again, and purifying reclaims small segment, with recombinant plasmid pET-32a-P
T7-GLP-1-1c restriction enzyme Sal I/Hind III double digestion, purifying reclaims big fragment, connects the small segment and the big fragment of above-mentioned recovery, obtains the dimer recombinant plasmid pET-32a-P of GLP-1 gene
T7-GLP-1-2c repeats above-mentioned steps three times, obtains the tetramer recombinant plasmid pET-32a-P of GLP-1 gene respectively
T7Eight aggressiveness recombinant plasmid pET-32a-P of-GLP-1-4c, GLP-1 gene
T716 aggressiveness recombinant plasmid pET-32a-P of-GLP-1-8c and GLP-1 gene
T7-GLP-1-16c is converted into the recombinant plasmid that builds respectively among intestinal bacteria BL 21 (DE3) or the BLR (DE3), obtains efficiently expressing the genetic engineering bacterium of human glucagon-like-peptide-1.
Embodiment 3 makes up a kind of genetic engineering bacterium that efficiently expresses human glucagon-like-peptide-1: contain 1～16 single string P
T7The genetic engineering bacterium of-SD-TrxA-HisTag-EK-GLP-1-TAA.
The first step base sequence is synthetic
The first step with embodiment 1;
Second step made up the genetic engineering bacterium of the dna sequence dna that contains single string GLP-1 gene
The dna sequence dna of single string GLP-1 gene is P
T7-SD-HisTag-TrxA-EK-GLP-1-TAA, the recombinant plasmid pMD18-T-GLP-1 that obtains with two kinds of restriction enzymes double zyme cutting the first steps, described two kinds of restriction enzymes are KpnI/EcoRI, purifying reclaims small segment, with same two kinds of restriction enzymes double zyme cutting plasmid pET-32a (+), purifying reclaims big fragment, connects the small segment and the big fragment of above-mentioned recovery, obtains containing single string P
T7The recombinant plasmid pET-32a-P of the dna sequence dna of-SD-TrxA-HisTag-EK-GLP-1-TAA
T7-TrxA-GLP-1-1c is with recombinant plasmid pET-32a-P
T7-TrxA-GLP-1-1c is transformed in the bacillus coli DH 5 alpha, makes to contain single string P
T7The genetic engineering bacterium of the dna sequence dna of-SD-TrxA-HisTag-EK-GLP-1-TAA;
The 3rd step made up the genetic engineering bacterium that efficiently expresses human glucagon-like-peptide-1
With the 3rd step of embodiment 2, being used for the recombinant plasmid that enzyme cuts is pET-32a-P
T7-TrxA-GLP-1-1c.
4 one kinds of application that efficiently express the genetic engineering bacterium of human glucagon-like-peptide-1 of embodiment are promptly produced human glucagon-like-peptide-1 with described genetic engineering bacterium.Following affinity chromatography medium is the NTAO resin, and available from Novagen company, following enteropeptidase EK is available from NEB company.
The first step liquid culture
In the LB liquid nutrient medium, be cultured to OD600nm=0.4～0.8 o'clock with containing 1～16 polymeric genetic engineering bacterium of single string SD-HisTag-EK-GLP-1-TAA gene among the embodiment 1 that builds, the adding final concentration is that the IPTG of 0.4～1mM carried out abduction delivering 3～5 hours, produces and accumulate the human glucagon-like-peptide-1 fusion rotein of solubility expression;
The second step purifying makes the human glucagon-like-peptide-1 fusion rotein
Centrifugal collection thalline, with the resuspended thalline of NTAO damping fluid, after the carrying out ultrasonic bacteria breaking, centrifugal collection supernatant, carry out NTAO resin affinity chromatography, collecting glucagon-like-peptide-1 fusion rotein component, is that the Millipore Amicon Ultra-15 ultrafiltration pipe of 1～5KD is concentrated into 2～5mg/mL with albumen with molecular weight cut-off;
The 3rd step preparation human glucagon-like-peptide-1
With enteropeptidase enzymolysis human glucagon-like-peptide-1 fusion rotein, 4～37 ℃ of cracking 2～16 hours, termination reaction, and then carry out NTAO resin affinity chromatography, and collect absorption peak, lyophilize obtains human glucagon-like-peptide-1.
The hypoglycemic activity of embodiment 5 human glucagon-like-peptide-1s.
Experiment material and method:
Male and healthy kunming mice (cleaning level, Fudan University in Shanghai medical college animal center provides);
50% glucose solution, 0.9%NaCl solution, human glucagon-like-peptide-1;
Blood glucose monitoring system (the newly upright medicine equipment company limited in Shanghai);
Male and healthy kunming mice overnight fasting is divided into 3 groups (n=6).1, the physiological saline control group; 2, the glucose control group; 3, human glucagon-like-peptide-1 administration group.
The human glucagon-like-peptide-1 of administration group abdominal injection 100ul 50% glucose solution and 0.4ug, note were at this moment zero moment.Carried out mouse tail vein respectively at 10,30,60,90,120,150,180,210,240 minutes and get blood 10ul, measure blood sugar concentration, with surveyor's glucagon-like-peptide-1 hypoglycemic activity with blood glucose monitoring system.A physiological saline control group injecting normal saline; A glucose control group injectable dextrose monohydrate and physiological saline, the administration of human glucagon-like-peptide-1 is not pressed identical time interval determination blood sugar.
The result as shown in Figure 3, shown in numerical value be the average of n=6.Compare with the glucose group mouse, within after the administration 60 minutes, human glucagon-like-peptide-1 administration group can reduce mouse blood sugar, illustrates that the human glucagon-like-peptide-1 of preparing by the inventive method has the biologic activity of lowering blood glucose.
Claims (8)
1. genetic engineering bacterium that efficiently expresses human glucagon-like-peptide-1, it is characterized in that, this genetic engineering bacterium is bacillus coli DH 5 alpha, BL21 (DE3) or the BLR (DE3) that carries recombinant plasmid, described recombinant plasmid is the plasmid pET32a (+) that contains the GLP-1 gene, the string number that described recombinant plasmid contains the GLP-1 gene is 1～16 string, wherein, the GLP-1 gene is into the glucagon-like-peptide-1 gene.
2. the genetic engineering bacterium that efficiently expresses human glucagon-like-peptide-1 according to claim 1 is characterized in that, described recombinant plasmid is four kinds of recombinant plasmid: pET32a (+)-GLP-1, pET32a (+)-TrxA-GLP-1, pET32a (+)-P
T7-GLP-1 and pET32a (+)-P
T7One of-TrxA-GLP-1, wherein, TrxA is a Trx, P
T7It is the promotor of described plasmid pET32a (+).
3. claim 1 or the 2 described construction processs that efficiently express the genetic engineering bacterium of human glucagon-like-peptide-1 is characterized in that the concrete operations step:
The first step base sequence is synthetic
The biotech company that entrusts specialty is according to sequence: SD sequence-purification tag HisTag-enteropeptidase EK site-human glucagon-like-peptide-1, i.e. and GLP-1 gene-terminator codon TAA, chemosynthesis length is the base sequence of 215bp, and is as follows,
XbaI SD sequence
5’-CC
tctagaAATAATTTTGTTTAACTTTAAG
AAGGAGATATACATATGTCTGGA
Met?Ser?Gly
His·Tag BglII
TCAGGT
CATCATCATCATCATCATTCTTCT
agatctGATGACGACGACAAG
Ser?Gly?His?His?His?His?His?His?Ser?Ser?Gly?Thr?
Asp?Asp?Asp?Asp?Lys
EK
CATGCCGAAGGCACCTTTACCAGCGATGTGAGCAGCTATCTGGAAGGC
His?Ala?Glu?Gly?Thr?Phe?Thr?Ser?Asp?Val?Ser?Ser?Tyr?Leu?Glu?Gly
CAGGCCGCCAAAGAATTTATTGCCTGGCTGGTGAAAGGCAGAGGCTAA
Gln?Ala?Ala?Lys?Glu?Phe?Ile?Ala?Trp?Leu?Val?Lys?Gly?Arg?Gly?End
SpeI?EcoRI
G
actagt?
gaattcAC-3’
This base sequence is cloned among the plasmid pMD18-T, obtain containing SD sequence-purification tag HisTag-enteropeptidase EK site-human glucagon-like-peptide-1, be the recombinant plasmid pMD18-T-GLP-1 of the dna sequence dna of GLP-1 gene-terminator codon TAA, described base sequence contains restriction enzyme XbaI, BglII, SpeI and EcoRI site, and wherein restriction enzyme XbaI, SpeI are a pair of isocaudarners;
Second step made up the genetic engineering bacterium of the dna sequence dna that contains single string GLP-1 gene
The dna sequence dna of single string GLP-1 gene is SD-HisTag-EK-GLP-1-TAA, the recombinant plasmid pMD18-T-GLP-1 that obtains with two kinds of restriction enzymes double zyme cutting the first steps, described two kinds of restriction enzymes are XbaI and EcoRI, purifying reclaims small segment, with same two kinds of restriction enzymes double zyme cutting plasmid pET-32a (+), purifying reclaims big fragment, the small segment and the big fragment that connect above-mentioned recovery, obtain containing the singly recombinant plasmid pET-32a-GLP-1-1c of the dna sequence dna of string SD-HisTag-EK-GLP-1-TAA, recombinant plasmid pET-32a-GLP-1-1c is transformed in the bacillus coli DH 5 alpha, make the genetic engineering bacterium of the dna sequence dna that contains single string GLP-1 gene, that be connected with SD sequence in the described dna sequence dna is the promotor P of plasmid pET-32a (+)
T7
The 3rd step made up the genetic engineering bacterium that efficiently expresses human glucagon-like-peptide-1
With restriction enzyme HindIII/XbaI and the HindIII/SpeI recombinant plasmid pET-32a-GLP-1-1c that obtains of second step of double digestion respectively, the big fragment that restriction enzyme HindIII/SpeI double digestion is reclaimed is connected with the small segment that restriction enzyme HindIII/XbalI double digestion reclaims, obtain the dimer recombinant plasmid pET-32a-GLP-1-2c of GLP-1 gene, repeat above-mentioned steps three times, obtain the tetramer recombinant plasmid pET-32a-GLP-1-4c of GLP-1 gene respectively, 16 aggressiveness recombinant plasmid pET-32a-GLP-1-16c of eight aggressiveness recombinant plasmid pET-32a-GLP-1-8c of GLP-1 gene and GLP-1 gene, the recombinant plasmid that builds is transformed into respectively among intestinal bacteria BL 21 (DE3) or the BLR (DE3), obtains efficiently expressing the genetic engineering bacterium of human glucagon-like-peptide-1.
4. the construction process that efficiently expresses the genetic engineering bacterium of human glucagon-like-peptide-1 according to claim 3, it is characterized in that, the dna sequence dna of single string GLP-1 gene is SD-HisTag-TrxA-EK-GLP-1-TAA in second step, the restriction enzyme that recombinant plasmid pMD18-T-GLP-1 and plasmid pET-32a (+) is carried out double digestion is KpnI and EcoRI, obtains containing the recombinant plasmid pET-32a-TrxA-GLP-1-1c of the dna sequence dna of single string SD-HisTag-TrxA-EK-GLP-1-TAA.
5. the construction process that efficiently expresses the genetic engineering bacterium of human glucagon-like-peptide-1 according to claim 3 is characterized in that, the dna sequence dna of single string GLP-1 gene is P in second step
T7-SD-HisTag-EK-GLP-1-TAA, the restriction enzyme that recombinant plasmid pMD18-T-GLP-1 and plasmid pET-32a (+) is carried out double digestion is XbaI and EcoRI, obtains containing single string P
T7The recombinant plasmid pET-32a-P of the dna sequence dna of-SD-HisTag-TrxA-EK-GLP-1-TAA
T7-GLP-1-1c is in the 3rd step, with recombinant plasmid pET-32a-P
T7After-GLP-1-1c cut with restriction enzyme ClaI enzyme, the Klenow fragment was mended flat, cut with restriction enzyme HindIII enzyme again, and purifying reclaims small segment, with recombinant plasmid pET-32a-P
T7-GLP-1-1c restriction enzyme SalI/HindIII double digestion, purifying reclaims big fragment, connects the small segment and the big fragment of above-mentioned recovery, obtains the dimer recombinant plasmid pET-32a-P of GLP-1 gene
T7-GLP-1-2c.
6. the construction process that efficiently expresses the genetic engineering bacterium of human glucagon-like-peptide-1 according to claim 3 is characterized in that, the dna sequence dna of single string GLP-1 gene is P in second step
T7-SD-HisTag-TrxA-EK-GLP-1-TAA, the restriction enzyme that recombinant plasmid pMD18-T-GLP-1 and plasmid pET-32a (+) is carried out double digestion is KpnI and EcoRI, obtains containing single string P
T7The recombinant plasmid pET-32a-P of the dna sequence dna of-SD-HisTag-TrxA-EK-GLP-1-TAA
T7-TrxA-GLP-1-1c is in the 3rd step, with recombinant plasmid pET-32a-P
T7After-TrxA-GLP-1-1c cut with restriction enzyme ClaI enzyme, the Klenow fragment was mended flat, cut with restriction enzyme HindIII enzyme again, and purifying reclaims small segment, with recombinant plasmid pET-32a-P
T7-TrxA-GLP-1-1c restriction enzyme SalI/HindIII double digestion, purifying reclaims big fragment, connects the small segment and the big fragment of above-mentioned recovery, obtains the dimer recombinant plasmid pET-32a-P of GLP-1 gene
T7-TrxA-GLP-1-2c.
7. method that the genetic engineering bacterium that makes up with claim 3,4,5 or 6 described methods is produced human glucagon-like-peptide-1 is characterized in that the concrete operations step:
The first step liquid culture
The genetic engineering bacterium that efficiently expresses human glucagon-like-peptide-1 is cultured to OD600nm=0.4～0.8 o'clock in the LB liquid nutrient medium, the adding final concentration is that the IPTG of 0.4～1mM carried out abduction delivering 3～5 hours, produces and accumulate the human glucagon-like-peptide-1 fusion rotein of solubility expression;
The human glucagon-like-peptide-1 fusion rotein that the second step purifying makes
Centrifugal collection thalline is with the resuspended thalline of damping fluid, after the carrying out ultrasonic bacteria breaking, centrifugal collection supernatant, carry out affinity chromatography, collector's glucagon-like-peptide-1 fusion rotein component is that the Millipore Amicon Ultra-15 ultrafiltration pipe of 1～5KD is concentrated into 2～5mg/mL with albumen with molecular weight cut-off;
The 3rd step preparation human glucagon-like-peptide-1 sample
With enteropeptidase enzymolysis human glucagon-like-peptide-1 fusion rotein, 4～37 ℃ of following cracking 2～16 hours, termination reaction is carried out affinity chromatography once more, collects absorption peak, and lyophilize obtains human glucagon-like-peptide-1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100543979A CN100392070C (en) | 2004-09-08 | 2004-09-08 | High efficiency experssino human glicentin-1 gene engineering bacteria and its construction method and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100543979A CN100392070C (en) | 2004-09-08 | 2004-09-08 | High efficiency experssino human glicentin-1 gene engineering bacteria and its construction method and use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1587385A true CN1587385A (en) | 2005-03-02 |
| CN100392070C CN100392070C (en) | 2008-06-04 |
Family
ID=34603114
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2004100543979A Expired - Fee Related CN100392070C (en) | 2004-09-08 | 2004-09-08 | High efficiency experssino human glicentin-1 gene engineering bacteria and its construction method and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100392070C (en) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1320117C (en) * | 2005-07-22 | 2007-06-06 | 浙江大学 | Adiponectin-Glucagon-like peptide-1-like peptide recombinant protein expression vector and construction |
| CN1982336B (en) * | 2006-03-03 | 2011-01-12 | 华东师范大学 | Human pancreas glucagon sample peptide-1-derivative, its production and use |
| CN101328221B (en) * | 2008-04-14 | 2011-03-23 | 中国药科大学 | Hypoglycemic polypeptide fused protein, structure and use of derivate thereof |
| CN101367873B (en) * | 2008-10-08 | 2011-05-04 | 南开大学 | Modified glucagon sample peptide-1analogue and modifying matter, and uses thereof |
| CN102660491A (en) * | 2012-05-18 | 2012-09-12 | 华东师范大学 | Gene engineering bacteria high-efficiently expressing recombined human glucagon-like peptide-1 (1-37) and construction method and application thereof |
| CN103103210A (en) * | 2013-01-31 | 2013-05-15 | 武汉工业学院 | Construction method and application of recombinant lactobacillus acidophilus for expressing glucagon-like peptide-2 |
| CN106434717A (en) * | 2015-11-05 | 2017-02-22 | 杭州九源基因工程有限公司 | Method for biosynthesis preparation of human GLP-1 polypeptide or analogue thereof |
| CN109868281A (en) * | 2019-03-06 | 2019-06-11 | 江苏大学附属医院 | A method of Gluca Gen sample peptide -1 is expressed using bacillus subtilis |
| CN110092825A (en) * | 2019-05-06 | 2019-08-06 | 山东汉泰生物科技有限公司 | A method of Liraglutide intermediate polypeptide is prepared using genetic recombination |
| CN110437329A (en) * | 2019-08-14 | 2019-11-12 | 中国药科大学 | Orally-taken blood sugar reducing peptide, its derivative of fatty acid and purposes |
| WO2024087761A1 (en) * | 2022-10-24 | 2024-05-02 | 扬州奥锐特药业有限公司 | Method for producing polypeptide from recombinant fusion protein and use thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104232666A (en) * | 2014-09-01 | 2014-12-24 | 江苏海王生物制药有限公司 | Gene expressing recombinant exenatide and carrier thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5512549A (en) * | 1994-10-18 | 1996-04-30 | Eli Lilly And Company | Glucagon-like insulinotropic peptide analogs, compositions, and methods of use |
| US5846774A (en) * | 1997-03-21 | 1998-12-08 | Bionebraska, Inc. | Chlorella virus promoters |
| CN1363654A (en) * | 2001-07-19 | 2002-08-14 | 上海华谊生物技术有限公司 | Genetically engineered bacteria and process for preparing insulinotropic hormone secretion peptide GLP-1 (7-36) |
-
2004
- 2004-09-08 CN CNB2004100543979A patent/CN100392070C/en not_active Expired - Fee Related
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1320117C (en) * | 2005-07-22 | 2007-06-06 | 浙江大学 | Adiponectin-Glucagon-like peptide-1-like peptide recombinant protein expression vector and construction |
| CN1982336B (en) * | 2006-03-03 | 2011-01-12 | 华东师范大学 | Human pancreas glucagon sample peptide-1-derivative, its production and use |
| CN101328221B (en) * | 2008-04-14 | 2011-03-23 | 中国药科大学 | Hypoglycemic polypeptide fused protein, structure and use of derivate thereof |
| CN101367873B (en) * | 2008-10-08 | 2011-05-04 | 南开大学 | Modified glucagon sample peptide-1analogue and modifying matter, and uses thereof |
| CN102660491A (en) * | 2012-05-18 | 2012-09-12 | 华东师范大学 | Gene engineering bacteria high-efficiently expressing recombined human glucagon-like peptide-1 (1-37) and construction method and application thereof |
| CN103103210A (en) * | 2013-01-31 | 2013-05-15 | 武汉工业学院 | Construction method and application of recombinant lactobacillus acidophilus for expressing glucagon-like peptide-2 |
| CN103103210B (en) * | 2013-01-31 | 2015-03-04 | 武汉工业学院 | Construction method and application of recombinant lactobacillus acidophilus for expressing glucagon-like peptide-2 |
| CN106434717A (en) * | 2015-11-05 | 2017-02-22 | 杭州九源基因工程有限公司 | Method for biosynthesis preparation of human GLP-1 polypeptide or analogue thereof |
| CN109868281A (en) * | 2019-03-06 | 2019-06-11 | 江苏大学附属医院 | A method of Gluca Gen sample peptide -1 is expressed using bacillus subtilis |
| CN110092825A (en) * | 2019-05-06 | 2019-08-06 | 山东汉泰生物科技有限公司 | A method of Liraglutide intermediate polypeptide is prepared using genetic recombination |
| CN110437329A (en) * | 2019-08-14 | 2019-11-12 | 中国药科大学 | Orally-taken blood sugar reducing peptide, its derivative of fatty acid and purposes |
| CN110437329B (en) * | 2019-08-14 | 2021-03-30 | 中国药科大学 | Oral hypoglycemic peptide, its fatty acid derivative and use |
| WO2024087761A1 (en) * | 2022-10-24 | 2024-05-02 | 扬州奥锐特药业有限公司 | Method for producing polypeptide from recombinant fusion protein and use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100392070C (en) | 2008-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110128552B (en) | Fusion protein and method for preparing liraglutide intermediate polypeptide by using same | |
| CN1587385A (en) | High efficiency experssino human glicentin-1 gene engineering bacteria and its construction method and use | |
| CN1268640C (en) | Glucagon-like peptide-2 analogs | |
| WO2022012020A1 (en) | Preparation method for glp-1 analogue polypeptide and use thereof in type ii diabetes | |
| CN102618552B (en) | Productive technology of recombined exenatide | |
| CN1982336B (en) | Human pancreas glucagon sample peptide-1-derivative, its production and use | |
| CN1363654A (en) | Genetically engineered bacteria and process for preparing insulinotropic hormone secretion peptide GLP-1 (7-36) | |
| CN110724187A (en) | Recombinant engineering bacterium for efficiently expressing liraglutide precursor and application thereof | |
| CN1817904A (en) | Gerobriecin pancrease glucagon peptidel (SGLP-1), its preparation and use | |
| CN101525387A (en) | Recombined long-acting glucagons peptide analogue and preparation method thereof | |
| CN1872346A (en) | Vaccine for diabetes in type I, and constructing method | |
| CN102660491A (en) | Gene engineering bacteria high-efficiently expressing recombined human glucagon-like peptide-1 (1-37) and construction method and application thereof | |
| CN1831012A (en) | Immunological adjuvant with immunity vegulating agent for treating and preventing diabetic from insulin-dependent | |
| CN102191207A (en) | Gene engineering bacterium of expression of soluble FGF-21 and construction method and application thereof | |
| CN1309740C (en) | Soluble tumour necrosis factor receptor II- | |
| CN102212127B (en) | Glucagon-like peptide-2 poly(ethylene glycol) conjugate, and preparation method and application thereof | |
| CN1306030C (en) | Human interleukin-10 gene sequenc and E coli containing the said gene sequence | |
| CN100335633C (en) | Method for preparing N-end acetylation modified thymosin alpha with recombined E. coli | |
| CN103613657B (en) | Shorten Exendin4 and the genetically engineered application thereof of peptide chain | |
| CN1990862A (en) | Production method of recombined human alpha1-thymus peptide and preparation thereof | |
| CN102260346B (en) | Exendin-4 analog | |
| CN1616652A (en) | Gene engineering bacteria of high efficiency expression of human alpha 1-thymulin and its construction method and use | |
| CN1255543C (en) | Expression and application of transduction peptides - human insulinogen fusion protein | |
| CN1212336C (en) | Prepn of recombinant human parathyroid hormone PTH (1-34) | |
| CN1778914A (en) | Expression of soluble TRAIL protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080604 Termination date: 20140908 |
|
| EXPY | Termination of patent right or utility model |