CN1306030C - Human interleukin-10 gene sequenc and E coli containing the said gene sequence - Google Patents
Human interleukin-10 gene sequenc and E coli containing the said gene sequence Download PDFInfo
- Publication number
- CN1306030C CN1306030C CNB011297069A CN01129706A CN1306030C CN 1306030 C CN1306030 C CN 1306030C CN B011297069 A CNB011297069 A CN B011297069A CN 01129706 A CN01129706 A CN 01129706A CN 1306030 C CN1306030 C CN 1306030C
- Authority
- CN
- China
- Prior art keywords
- human interleukin
- gene
- hil
- protein
- recombinant protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention relates to a human interleukin-10 gene sequence and artificially-synthesized colibacillus containing the human interleukin-10 gene sequence, which is mainly characterized in that codons of 35 sites of human interleukin-10 are substituted into codons preferred to the colibacillus; the construction of expression plasmids pTRX-hIL-10 is carried out on the basis; the high-efficiency expression is stably obtained in the colibacillus; and hIL-10 recombinant proteins having high purity and high activity are prepared by separation and purification. The present invention realizes the expression in vitro of human interleukin-10 and lays the groundwork for the medicament production of human interleukin-10.
Description
Technical field:
The present invention relates to-kind of human interleukin-10 gene sequenc and contain the colibacillus engineering that having of this gene can produce immunosuppression and anti-inflammatory activity material.
Background technology:
Human interleukin-10 (hIL-10) is the expression product that directly comes from Human genome, and traditional medicine biological technique can't prepare.Multiple advanced persons' such as utilization synthetic gene, molecular cloning, target protein expression and purifying modern molecular biology technique, the recombination human interleukin-10 (rhIL-10) that obtains to have natural biological to learn active and curative effect is a kind of of modern biotechnology.Efficiently express and the separation and purification of eucaryon small peptide gene is the key issue in the genetically engineered.At the constructional feature of homopolypeptide not, need take different phraseologies.For molecular weight smaller polypeptides albumen, if adopting non-amalgamation mode expresses, because expression product is difficult to form inclusion body, thereby very easily by the intracellular protein enzyme liberating, and it is an extremely complicated process that the change renaturation of inclusion body is handled, different proteic renaturation conditions are different, and renaturation yield often is difficult to improve, and easily causes the sex change inactivation of recombinant protein.Adopt the secreting, expressing mode can partly overcome this problem, but expression amount is on the low side, and expression amount is widely different, and the practical application difficulty is bigger, when particularly expressing the albumen that number molecular weight is less, disulfide linkage is more, the non-fusion expression system is difficult to obtain the albumen of biologic activity.HIL-10 is the micro-molecule glucoprotein that a molecular weight only has 18KD, and intramolecule has two pairs of disulfide linkage, and iso-electric point is 8.1.Human interleukin-10 (human Interleukin-10, hIL-10) be by Th2 cell and mononuclear macrophage, Th1, the strong immunosuppressive factor that the secretion of various kinds of cell such as B produces with polytropism biologic activity, can change the immunne response and the antigenic expression of MHC II class of body, mutual adjusting between mediation Th1 and the Th2 two class cells, suppress IL-2, IL-6, IL-β, IFN-γ, the secretion of the inflammatory mediator factor such as TNF-α and other proinflammatory factor discharges, original in the body, but non-activated inhibition mechanism at autoreactive T cell activates again, reaching and suppress immunoreactive purpose, is very effective anti-inflammatory medium.Research also shows the cytotoxicity of the antibody dependence that human interleukin-10 (hIL-10) participation monocyte mediates and comes kill tumor cell (Mosmann T R by activating natural killer cell (NK), New York:Academic Press, 1994:224).Aspect clinical application, IL-10 is the good medicine of the inflammation-inhibiting generation and the degree that reduces inflammation, be used for the treatment of various acute and chronic inflammation diseases very effectively, as (Lalani I et al such as anaphylaxis, rheumatoid arthritis, autoimmune disease, graft-rejection, ox-hide moss and hepatitis, Annals of allergy, Asthma ﹠amp; Immunology, 1997,79:469); Be used to prevent and treat septic shock and the shock of poisoning; Mycobacterium infects in treatment; Damage has provide protection to lung tissue; IL-10 and IL-2 share and carry out inheritance treatment cancer clinically.Biotech medicine product is the new trend of new drug development, according to statistics, the biotechnology medicine of having got permission to go on the market reached hundreds of more than, the industry annual earnings reach more than 2,000 hundred million.Because this type of disease patient enormous amount, as rheumatoid arthritis (RA) is modal systemic Immunological diseases, be worldwide distribution, in the U.S., the sickness rate of RA is 0.3-0.5%, sickness rate at China RA is 0.4-0.7%, patient's number reaches more than 5,000,000, does not also treat the specifics of these diseases at present, and, human interleukin-10 forms the medicine of can industrialization producing as yet at biological technical field, thereby the exploitation of this medicine will bring huge economic benefit and social benefit.
Summary of the invention:
Change into vivoexpression for human interleukin-10 is expressed from human body gene, thereby realize its medicineization, the invention provides a kind of human interleukin-10 gene sequenc that can efficiently express in microorganism, this gene order has been done the transformation of following codon, Human interleukin-10 (hIL-10) the gene order (see figure 1) of delivering according to Genbank is at following nucleotide site: 51,72,78,81,91,94,136,139,142,144,159,193,210,234,249,252,285,294,304,306,310,312,315,318,330,339,342,378,393,423,450,465,471,474,477 carry out the replacement of codon, replace to the codon of intestinal bacteria preference.Genetic code has versatility, and is for example viral from the simplest biology, until human, in proteinic biosynthesizing, all use same set of genetic code.And the genetic code degeneracy discovered that different biologies has " preferences " to codon in translation process.At intestinal bacteria preference and the high codon of frequency of utilization, under the situation of the aminoacid sequence that does not change coded by said gene, carry out the transformation (see figure 2) of the above-mentioned base sequence of human interleukin-10 gene, efficiently express to reach in intestinal bacteria.
For the gene clone that obtains human interleukin-10 and carry out sequencing, add at 5 ' end of a kind of human interleukin-10 gene sequenc of the present invention
AATTC is to constitute EcoR I recognition site, and 3 ' end adds
AGCTTTo constitute Hind III recognition site, can directly be cloned into the pUC18 plasmid, be used for the mensuration of hIL-10 composition sequence, and obtain a large amount of hIL-10 goal gene through pcr amplification.
A kind of preferred human interleukin-10 gene sequenc of the present invention is as follows:
TCTCCGGGCCAGGGCACCCAGTCTGAGAACAGCTGCACCCACTTCCCAGGTAACCTGCCT 60
AACATGCTTCGTGATCTGCGTGATGCCTTCAGCCGTGTGAAGACTTTCTTTCAAATGAAGG 120
GTTGCCAAGCCCTGTCTGAGATGATCCAATTTACCTGGAGGAGGTGATGCCGCAAGCTG 240
TCCGTCTGCGTCTGCGTCGCTGTCATCGTTTTCTTCCGTGCGAAAACAAGAGCAAGGCCGT 360
GGAGCAGGTGAAGAACGCCTTTAATAAGCTGCAGGAGAAAGGCATCTACAAAGCCATGA 420
GCGAGTTTTGACATCTTCATCAACTACATCGAAGCCTACATGACTATGAAAATCCGTAAC 480
TGA
In order to make up the pTRX-hIL-10 cloning by expression, the present invention has added KpnI recognition sequence GGT ACC in upstream primer, the hIL-10 goal gene that pcr amplification obtains in downstream primer, added Not I recognition sequence G CGG CCG C, so that can directly be cloned the corresponding cloning site in the pTRX expression vector.
In order to cut the companion body albumen in the fusion rotein, after upstream primer KpnI recognition sequence, designed enteropeptidase cleavage site GAT GAC GAT GAC AAG, enteropeptidase can be discerned N-Asp-Asp-Asp-Asp-Lys-C five amino acid residue site in the polypeptide chain specifically, cut point is at the carboxyl terminal of Lys, the foreign protein that cuts down does not have extra amino acid at aminoterminal, thereby makes its aminoacid sequence and native protein in full accord.
For the human interleukin-10 gene can must be inserted into human interleukin-10 gene sequenc in the plasmid vector earlier at expression in escherichia coli, the invention provides a kind of expression plasmid pTRX-hIL-10 (see figure 6) that is loaded with the said gene sequence.It is characterized in that containing in the pTRX prokaryotic fusion expression vector T7 strong promoter with optimization translation initiation sequence (TIR), TRX companion body albumen (afterwards connecing flexible zone), 6 Histidine purifying sites, connect one section composite sequence (see figure 5) of the multiple clone site of foreign gene.PTRX is the efficient prokaryotic fusion expression vector that is made up by this chamber, the translation initiation sequence of its strong promoter and optimization (TIR) help the high efficiency stable expression of recombinant protein in prokaryotic organism (Calvez H L et al, Gene, 1996,170:51).Merging the companion body is that molecular weight is about 12KD from colibacillary Trx (TRX), and its conformation is tight, Heat stability is good.Merging the companion body both can protect foreign protein to avoid the degraded of bacteria protease; can assist correct folding (the Smith et al of foreign protein again; Gene1988; 67:31); therefore, the recombinant protein solvability of expression is good, more approaches the conformation of native protein; to guaranteeing that its biologic activity has very important effect, be fit to very much the mass production and the preparation of recombinant protein.HIL-10 Recombinant Protein Expression amount reaches more than 40%, 95% solvablely among the present invention, accounts for 40% of the total soluble protein of bacterium.Designed the flexible zone of a GSGSG (glycine, Serine) sequence behind the fusion companion body gene, its molecular weight is little, sterically hindered little, snappiness is good, the mutual interference mutually of merging on the companion body and the foreign protein space structure and some rigid structures that may occur have been reduced, more help the correct folding of foreign protein, guaranteed that the foreign protein native conformation forms and biologic activity.The purifying site of being made up of 6 Histidines has been designed in the joining region of pTRX, and Histidine can provide coordination electronics and some metal ions such as Ni
2+Chelating, 6 successive Histidines can make albumen be adsorbed in containing metal Ni well
+Chromatographic stuffing on, thereby can utilize metal-chelate to close chromatography and come purified fusion protein, thereby simplify the downstream purification work of recombinant protein greatly, purity reaches more than 95%, and the purification efficiency height, cost is low, is fit to very much mass preparation.Gene order is connected in the flexible zone after the TRX companion body albumen, makes the joining region of merging between the companion body and the foreign protein sterically hindered little, more helps enteropeptidase the proteic effective cutting of the companion body is obtained the target protein monomer.
In order to obtain the engineering bacteria of expressing human interleukin 10 recombinant protein, the invention provides a kind of intestinal bacteria that above-mentioned plasmid (pTRX-hIL-10) transforms that are loaded with.It is characterized in that: with pTRX-hIL-10 prokaryotic expression carrier transformed into escherichia coli, carry out the screening of recombinant clone then, obtain colibacillus engineering.Because the T7Promoter on the PTRX is a T7 phage rna polymerase gene promoter, so utilize the expression vector of T7 promotor need be with the lysogenic strain of defective type lambda particles phage DE3, as BL21 (DE3) as the host, the t7 rna polymerase gene that it carries is controlled by LacUV5 promotor and operator gene, and the foreign gene that inserts is subjected to the control of the strong promoter Φ 10 of t7 rna polymerase, induce with IPTG, can make exogenous gene expression strengthen 10
5Doubly.Above-mentioned conversion can be adopted traditional plasmid inverting biological technology.
In order to obtain efficiently expressing of human interleukin-10 recombinant protein, the invention provides a kind of colibacillary best inducing culture condition of the above-mentioned pTRx-hIL-10 of containing plasmid, it is characterized in that: engineering bacteria shakes bacterium in 35-39 ℃ and is cultured to logarithmic phase, and get and cultivate bacterium liquid by 1: 50-100 amplification culture to nectar degree is OD
600nmDuring=0.4-0.8, add IPTG and glucose to final concentration and be respectively 0.1-0.5mM and 0.1-05%, in 20-28 ℃, 200-280rpm inducing culture 7h-12h, centrifugal results thalline.Intestinal bacteria can normally breed growth, 1 in the shaking table velocity range of 35-39 ℃ culture temperature and 200-280rPm: 50-100 amplification culture doubly is beneficial to intestinal bacteria and reaches logarithmic phase fast.The temperature optimization test shows that 20-28 ℃ is best abduction delivering temperature, Recombinant Protein Expression amount height, and the analysis of gel density scan is to account for 40% of total protein, solubility is best, and is solvable more than 95%, and low temperature helps the stable existence of recombinant protein.Plant the daughter bacteria amplification culture to nectar degree OD
600nmBacterium is in the optimum growh state during=0.4-0.8, and this moment, the abduction delivering amount of recombinant protein was the highest, nectar Du Taigao, and thalline is aging, is unfavorable for the expression of foreign protein.IPTG concentration optimization Test shows that when the induced concentration of IPTG was 1.0mM-0.1mM, recombinant protein all can reach and efficiently express, but IPTG costs an arm and a leg, select the 0.1-0.5mMIPTG induced concentration the most reasonable, promptly guaranteed the high-efficient expression of recombinant protein, greatly reduce production cost again.Add an amount of glucose when inducing as carbon source material, be beneficial to the escherichia coli expression foreign protein.
In order to prepare the human interleukin-10 recombinant protein of purifying, the invention provides the separation purification method of the expressed recombinant protein of a kind of thalline of above-mentioned condition inducing culture, its step comprises: the Ni of the hIL-10 recombinant protein of (1) hIL-10 recombinant protein
+-Chelating Sepharose affinity chromatography; (2) recombinant protein of chromatography gained being carried out enzyme cuts; (3) the hIL-10 recombinant protein after enzyme is cut carries out the SP-Sephadex cation-exchange chromatography.Affinity chromatography has specificity height, purification efficiency height, product purity advantages of higher, but price is expensive, cost is high.Metal Ni of the present invention
+It is that 6 Histidines can provide coordination electronics and some metal ions such as Ni on the fusion rotein of utilize expressing that huge legendary turtle is closed affinity chromatography
+Huge legendary turtle is closed, and 6 successive Histidine sequences can make recombinant protein be adsorbed in containing metal Ni well
+Chromatographic stuffing on, thereby can utilize metal-chelate to close chromatography and come purified fusion protein, thereby simplify the downstream purification work of recombinant protein greatly, purity reaches more than 95%, and the purification efficiency height, cost is low, is fit to very much mass preparation.The SP-Sephadex cation-exchange chromatography is a method very commonly used in the separation and purification of protein technology.At 50mMPB, 100mMNaCI is under the buffer conditions of pH=6.0, the fusion companion body (TRX) after the enteropeptidase cutting is electrically charged different with hIL-10 protein monomer institute, through SP-Sephadex cationic exchange column purification, the percolation peak is a TRX companion body albumen, uses 50mM PB, 500mMNaCI, the buffer solution elution of pH=7.0 can obtain the hIL-10 albumen of purifying, and purity reaches more than 95%, yield is about 10mg/ and rises fermented liquid, and is simple to operate quick.
Learn active human interleukin-10 albumen in order to obtain to have high-performance bio, the invention provides a kind of effective enzyme tangent condition.Enteropeptidase is a kind of serine protease, N-Asp-Asp-Asp-Asp-Lys-C five amino acid residue in its energy specific recognition skin chain, high specificity, cutting efficiency height, reaction conditions gentleness.The present invention's enteropeptidase under 2-10 ℃ temperature is done 10-15 hour, has both guaranteed the activity of recombinant protein, is beneficial to the cutting fully of enteropeptidase again.
Description of drawings
Human interleukin-10 (hIL-10) the gene order figure of Fig. 1 institute of the present invention foundation.
Fig. 2 a kind of synoptic diagram that human interleukin-10 (hIL-10) gene order is carried out the codon replacement of the present invention.
Fig. 3 a kind of human interleukin-10 of the present invention (hIL-10) gene order figure
Fig. 4 hIL-10PCR electrophoresis result of the present invention figure.
Swimming lane M: molecular weight standard; Swimming lane 1:hIL-10PCR product
The physical map of Fig. 5 fusion expression vector pTRx of the present invention.
Fig. 6 pTRX-hIL-10 construction of recombinant plasmid of the present invention figure.
Fig. 7 pTRx-hIL-10 recombinant plasmid of the present invention enzyme is cut and is identified electrophoresis result figure.
Swimming lane M: molecular weight standard;
Swimming lane 1:pTRX/KpnI+NotI; Swimming lane 2:pTRX-hIL-10/KpnI+NotI
The electrophoretic analysis figure of Fig. 8 hIL-10 recombinant protein of the present invention abduction delivering.
Swimming lane M: protein standard; Swimming lane 1,3,5,7: total bacterioprotein;
The electrophoretic analysis figure of hIL-10 expression of recombinant proteins under the different inducing temperatures of Fig. 9 the present invention.
Swimming lane M: protein standard; Swimming lane 9: contrast
Figure 10 different IP TG concentration of the present invention is induced down the electrophoretic analysis figure of hIL-10 expression of recombinant proteins
Swimming lane M: protein standard; Swimming lane 15: contrast
The SDS-PAGE analysis chart of Figure 11 hIL-10 expression of recombinant proteins of the present invention and purifying.
Swimming lane M: protein standard; Swimming lane 1: contrast; Swimming lane 2: total bacterioprotein; Swimming lane 3: total soluble protein;
Swimming lane 4: the foreign protein of affinity chromatography wash-out; Swimming lane 5: the pTRX-hIL-10 fusion rotein of affinity purification;
Swimming lane 6:pTRX-hIL-10/EK enzyme is cut; Swimming lane 7: the hIL-10 recombinant protein of ion-exchange purification
The Ni of Figure 12 hIL-10 recombinant protein of the present invention
2+-Chelating Sepharose affinity chromatography collection of illustrative plates.
A: use 50mM PB, 500mM NaCl (pH7.8) wash-out; B: use 50mM PB, 500mM NaCl (pH6.0) wash-out;
C: use 50mM PB, 500mM NaCl, 150mM imidazoles (pH6.0) wash-out; D: use 50mM PB, 500mM NaCl, 300mM imidazoles (pH6.0) wash-out
The SP-Sephadex cationic exchange collection of illustrative plates of Figure 13 hIL-10 recombinant protein of the present invention.
A:pTRX percolation peak; B:50mM PB, 500mM NaCl (pH7.5) elution peak
Figure 14 hIL-10 recombinant protein of the present invention Western-blot collection of illustrative plates.
Swimming lane M: protein standard; Swimming lane 1:pTRX-hIL-10 fusion rotein;
Swimming lane 2: the hIL-10 recombinant protein of purifying; Swimming lane 3: contrast
The provide protection synoptic diagram of Figure 15 the present invention hIL-10 activity identification analysis of recombinating---mouse inflammation shock death that intracellular toxin is caused
○LPS 1mg；□LPS 1mg+hIL-10 150ul；▲LPS 1mg+hIL-10 300ul
Embodiment
1.hIL-10 the clone of gene and order-checking
Human interleukin-10 gene sequenc according to the Genbank report, replace some rare codon in the sequence, give birth to the synthetic IL-10 gene that contains the high codon of intestinal bacteria preference and frequency of utilization of worker's biotechnology company limited by Shanghai, 5 ' end adds EcoR I recognition site (AATTC), 3 ' end adds Hind III recognition site (AGCTT), is cloned into the pUC18 plasmid.Sequencing result and the consistent (see figure 3) of expection.
2.pTRX-hIL-10 construction of recombinant plasmid and evaluation
Be cloned on the prokaryotic fusion expression vector pTRX of this laboratory structure construction expression plasmid pTRX-hIL-10 (see figure 6) according to a conventional method.
Upstream primer 5 ' CGG
GGT ACC GAT GAC GAT GAC AAGTCT CCG GGC CAG GGC 3 '
Kpn I Enterokinase site
Downstream primer 5 ' TG
G CGG CCG CCT TGC CAA GCT TCT ATC AGT TAC GGA 3 '
Not I
Primer is given birth to worker's biotechnology company limited by Shanghai and is synthesized, upstream primer design Kpn I recognition site and the special cleavage site of enteropeptidase, downstream primer design Not I recognition site.Two-step approach amplifying target genes, reaction parameter are 94 ℃ of sex change 5min, 94 ℃ of 50s, and 68 ℃ of 2s, 35 circulations, last circulation is extended 10min for 72 ℃.The electrophoretic analysis of PCR product, visible 500bp purpose band (see figure 4), product reclaims through agarose electrophoresis.Purpose fragment and pTRX carrier are used Kpn I and Not I double digestion respectively, and electrophoresis reclaims, through connection, conversion, recombinant clone screening, construction recombination plasmid pTRX-hIL-10.Identify that through Kpn I and Not I double digestion electrophoretic analysis shows the correct (see figure 7) of result
3.hIL-10 the screening of Recombinant Protein Expression and engineering bacteria
According to a conventional method, with pTRX-hIL-10 plasmid transformation escherichia coli BL21 (DE3).Connect the single bacterium colony of pTRX-hIL-10-BL21 (DE3) and contain in the LB substratum of penbritin in 100ml, 37 ℃, 250rpm cultivates 12h-14h to logarithmic phase, and getting and cultivating bacterium liquid is OD by 1: 100 amplification culture to nectar degree
600nm=0.6 o'clock, add 100mMIPTG and 20% glucose to final concentration and be respectively 1.0mM and 0.2%, in 37 ℃, 250rpm inducing culture 9h-10h, centrifugal results thalline.Get an amount of thalline and be suspended among the TE, carrying out ultrasonic bacteria breaking (200W, 99 next circulations), centrifugal collection supernatant.Total thalline and ultrasonic supernatant show that through the SDS-PAGE electrophoretic analysis tangible target protein band is arranged after inducing, molecular weight is about the 31kD (see figure 8), conform to expection, identify that through Western-blot expressing protein is hIL-10 (seeing Figure 14).Through a large amount of screenings, obtain the high and stable engineering bacteria of expression amount.This project bacterium is preserved in Wuhan City Wuhan University China typical culture collection center September calendar year 2001, and preserving number is: CCTCC M 201034
4. the optimization of abduction delivering condition
By optimizing the discovery of groping of inductive condition, different IPTG induced concentrations has a significant effect to Recombinant Protein Expression with different inducing temperatures.Connect pTRX-hIL-10-BL21 (DE3) engineering bacteria and fall within the LB substratum that 100ml contains penbritin, 37 ℃, 250rpm cultivates 12h-14h to logarithmic phase, and get and cultivate bacterium liquid by 1: 50-100, for example 1: 100 amplification culture to nectar degree is OD
600nmDuring=0.4-0.8, the final concentration that adds 100mM IPTG is respectively 1.0mM, 0.5mM, and 0.3mM, 0.2mM, 0.1mM, 0.05mM, 0.01mM, under 37 ℃, 30 ℃, 25 ℃, 16 ℃, 250rpm inducing culture 8h-10h, centrifugal results thalline.Get an amount of thalline and be suspended among the TE, carrying out ultrasonic bacteria breaking (500W, 99 5 circulations), centrifugal collection supernatant.Total thalline and ultrasonic supernatant show through the SDS-PAGE electrophoretic analysis, experiment shows that best inducing culture condition is: 0.1-0.5mM IPTG induces down the highest (see figure 10) of hIL-10 Recombinant Protein Expression amount, the solubility of 20-28 ℃ of inducing culture hIL-10 recombinant protein is better, and temperature is controlled at and is best (see figure 9) about 25 ℃.The gel density scan is analyzed, and the expression of recombinant proteins amount accounts for 40% of bacterial protein, is in solvable state basically, and solubility is up to more than 95%.
5.hIL-10 the purifying of recombinant protein
With the total thalline of results with TE (pH8.0) washing, be suspended in PBS (5omMPB, 500mMNaCl, pH7.8) in, carrying out ultrasonic bacteria breaking (500W, 99 times, 5cycles), lysate centrifugal (10000rpm, 40min), supernatant, last Ni
2+ChelatingSepharose affinity column (going up sample speed 5ml/min) is used A liquid (50mMPB, 500mMNaCl respectively under the Ultraviolet Detector monitoring, pH7.8), B liquid (50mMPB, 500mMNaCl, pH6.0), C liquid (50mMPB, 500mMNaCl, the 150mM imidazoles, pH6.0), D liquid (50mMPB, 500mMNaCl, 300mM imidazoles, pH6.0) eluted protein.Foreign protein and the Ni expressed according to vector plasmid pTXR
2+Chelating Sepharose affinity column is analyzed in conjunction with stronger characteristics and SDS-PAGE electrophoresis detection, and recombinant protein is eluted (seeing Figure 11,12) at D liquid.Collect 50mMPB, 500mMNaCl, 300mM imidazoles (pH6.0) recombinant protein elution peak, the desalination of last Sephadex G-25 post converts 50mMTris-Cl to, 150mMNaCl damping fluid (pH7.5).Utilize Folin-phenol method to measure protein concentration.According to Invitrogen company enteropeptidase (EK) products instruction, add enteropeptidase and enzyme and cut Buffer, the enteropeptidase effect is 12 hours at low temperatures, cut result's (seeing Figure 11) with SDS-PAGE electrophoresis detection enzyme, can obviously see hIL-10 monomeric protein band (18kD) and TRX and merge companion body protein band (14KD).Reaction solution changes 50mMPB into through the G-25 post, 100mMNaCl damping fluid (pH6.0), last SP-Sephadex ion exchange column (seeing Figure 13), collect the percolation peak, use 50mMPB, 500mMNaCl, the pH7.5 buffer solution eluted protein, detect (seeing Figure 14) through SDS-PAGE electrophoretic analysis and Western-blot, the percolation peak is a TRX companion body albumen, and protein peak is the hIL-10 recombinant protein of purifying.The desalination of last G-25 post converts 50mMPB to, 150mMNaCl, and pH7.5 buffering system (PBS), filtration can be directly used in animal and cell experiment.More than per step all do the SDS-PAGE electrophoresis detection, through the gel scanning analysis, purity reaches more than 95%, yield is about 10mg/ and rises fermented liquid (seeing Figure 11).
This technical process is simple to operate, quick, only need two-step purifying can obtain highly purified hIL-10 recombinant protein, and cost is low, and the efficient height is fit to the scale operation preparation very much.
6.hIL-10 the activity of recombinant protein detects
According to document announcement, hIL-10 is very effective anti-inflammatory medicaments, particularly chronic inflammatory diseases is had very significantly curative effect.
Female NIH mice, 20.0 ± 2.0g divides 3 groups, 30 every group, is respectively NS group (ip LPS1mg+PBS 0.2ml), hIL-10 low dose group (ip LPS1mg+hIL-10 150ul) and high dose group (ip LPS1mg+hIl-10 300ul).72 hours animal dead numbers (seeing Table 1) of observed and recorded after abdominal injection and the Not I i administration.Experimentation on animals is the result show, the mouse inflammation shock death that the reorganization hIL-10 of purifying causes intracellular toxin has significant protective effect (p＜0.0001), and effect is dose-dependently (seeing Figure 15).
The provide protection of the mouse inflammation shock death that table 1 reorganization hIL-10 causes intracellular toxin
Tab.1 The protective effect of the recombinant hIL-10 on mice inflammatory lethal induced by endotoxemia
| Group | Number of | 72 hours dead animal numbers |
| LPS1mg+PBS 200μl LPS1mg+IL-10 150μl LPS1mg+IL-10 | 30 30 30 | 17 9 * 1 *** |
With the NS ratio,
*P＜0.05,
* *P＜0.0001
Claims (9)
1. human interleukin-10 gene sequenc is characterized in that: at following human interleukin-10 gene sequenc:
TCTCCGGGCC AGGGCACCCA GTCTGAGAAC AGCTGCACCC ACTTCCCAGG
CAACCTGCCT 60
AACATGCTTC G
AGATCT
CCG
AGATGCCTTC
AGC
AGAGTGA AGACTTTCTT TCAAATGAAG 120
GATCAGCTGG ACAAC
TTG
TT G
TT
AAAGGAG TCCTTGCT
GG AGGACTTTAA GGGTTACCTG 180
GGTTGCCAAG CC
TTGTCTGA GATGATCCAG TTTTACCTGG AGGAGGTGAT GCC
CCAAGCT 240
GAGAACCA
AG A
CCCAGACAT CAAGGCGCAT GTGAACTCCC TGGG
GGAGAA CCT
GAAGACC 300
CTC
AG
GCTG
A G
GCT
ACG
GCG CTGTCATCG
A TTTCTTCC
CT G
TGAAAACAA GAGCAAGGCC 360
GTGGAGCAGG TGAAGAA
TGC CTTTAATAAG CT
CCAGGAGA AAGGCATCTA CAAAGCCATG 420
AG
TGAGTTTTG ACATCTTCAT CAACTACAT
A GAAGCCTACA TGAC
AATGAA
GAT
ACG
AAAC 480
Following nucleotide site among the TGA: 51,72,78,81,91,94,136,139,142,144,159,193,210,234,249,252,285,294,304,306,310,312,315,318,330,339,342,378,393,423,450,465,471,474,477 carry out the replacement of codon, replace to the codon of intestinal bacteria preference.
2. human interleukin-10 gene sequenc that comprises the described gene of claim 1, it is characterized in that: the two ends in the described gene order of claim 1 add cloning site respectively, promptly add at 5 ' end
AATTCTo constitute EcoR I recognition site, 3 ' end adds
AGCTTTo constitute Hind III recognition site.
3. gene order according to claim 2 is characterized in that:
AATTCTCTCCGGGCCAGGGCACCCAGTCTGAGAACAGCTGCACCCACTTCCCAGGTAACC 60
TGCCTAACATGCTTCGTGATCTGCGTGATGCCTTCAGCCGTGTGAAGACTTTCTTTCAAAT 120
GAAGG ATCAGCTGGACAACCTGCTGCTGAAGGAGTCCTTGCTCGAGGACTTTAAGGGTTA 180
CCTGGGTTGCCAAGCCCTGTCTGAGATGATCCAATTTTACCTGGAGGAGGTGATGCCGCA 240
AGCTGAGAACCAGGATCCAGACATCAAGGCGCATGTGAACTCCCTGGGCGAGAACCTTAA 300
GACCCTCCGTCTGCGTCTGCGTCGCTGTCATCGTTTTCTTCCGTGCGAAAACAAGAGCAAG 360
GCCGT GGAGCAGGTGAAGAACGCCTTTAATAAGCTGCAGGAGAAAGGCATCTACAAAGC 420
CATGAGCGAGTTTTGACATCTTCATCAACTACATCGAAGCCTACATGACTATGAAAATCC 480
GTAACTGA
AGCTT。
4. the upstream primer of the described gene order of claim 3 and downstream primer is characterized in that:
5’CGG GGT ACC GAT GAC GAT GAC AAG TCT CCG GGC CAG GGC 3’
5’TGG CGG CCG CCT TGC CAA GCT TCT ATC AGT TAC GGA 3’。
5. expression plasmid pTRX-hIL-10 who contains the described gene order of claim 3, its feature is as follows: contain in the pTRX prokaryotic fusion expression vector have the T7 strong promoter of optimizing translation initiation sequence TIR, one section composite sequence in TRX companion body protein gene, 6 Histidine purifying sites.
6. the intestinal bacteria that the described plasmid of claim 5 transforms is characterized in that: with pTRX-hIL-10 prokaryotic expression carrier transformed into escherichia coli, carry out the screening of recombinant clone then, obtain colibacillus engineering.
7. described colibacillary method for inducing and cultivating of claim 6, it is characterized in that: engineering bacteria shakes bacterium in 35-39 ℃ and is cultured to logarithmic phase, and get and cultivate bacterium liquid by 1: 50-100 amplification culture to nectar degree is OD
600nmDuring=0.4-0.8, add IPTG and glucose to final concentration and be respectively 0.1-0.5mM and 0.1-0.5%, in 20-28 ℃, 200-280rpm inducing culture 7h-12h, centrifugal results thalline.
8. the expressed human interleukin-10 protein monomer of thalline that produces of claim 7 method for inducing and cultivating, it is characterized in that: it is got by the expressed purified separation of human interleukin-10 recombinant protein of the described intestinal bacteria of claim 6, and its step comprises: (1) human interleukin-10 recombinant protein is through Ni2
+-Chelating Sepharose affinity chromatography; (2) recombinant protein of chromatography gained is carried out enzyme and cut, (3) human interleukin-10 recombinant protein after enzyme is cut carries out the SP-Sephadex cation-exchange chromatography, collects to get final product.
9. human interleukin-10 protein monomer according to claim 8 is characterized in that: the enzyme tangent condition in the described purifies and separates step (2) is enteropeptidase effect under 2-10 ℃ of low temperature 10-15 hour.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB011297069A CN1306030C (en) | 2001-09-28 | 2001-09-28 | Human interleukin-10 gene sequenc and E coli containing the said gene sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB011297069A CN1306030C (en) | 2001-09-28 | 2001-09-28 | Human interleukin-10 gene sequenc and E coli containing the said gene sequence |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1408863A CN1408863A (en) | 2003-04-09 |
| CN1306030C true CN1306030C (en) | 2007-03-21 |
Family
ID=4669378
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB011297069A Expired - Fee Related CN1306030C (en) | 2001-09-28 | 2001-09-28 | Human interleukin-10 gene sequenc and E coli containing the said gene sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1306030C (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1306032C (en) * | 2005-06-02 | 2007-03-21 | 中国科学技术大学 | Coding gene of interleukin 10 and its expression method in bacillus coli |
| CN101979572B (en) * | 2010-11-08 | 2012-05-23 | 中山大学 | Preparation for South China Sea conus striatus toxin S4.3 and application |
| CN102250938B (en) * | 2010-12-31 | 2013-10-09 | 中山大学 | Preparation method of cardiactide |
| AU2015369808A1 (en) * | 2014-12-23 | 2017-06-29 | Armo Biosciences, Inc. | Methods of improving yield in recombinant protein production |
| CN108192905A (en) * | 2018-01-25 | 2018-06-22 | 南华大学 | A kind of expression cassette, expression vector, the method for host strain and preparation without label recombined human IL37 mature peptides |
| CN108588046A (en) * | 2018-05-11 | 2018-09-28 | 武汉博百欧生物科技有限公司 | The method that natural myeloperoxidase is prepared from blood of human body neutrophil leucocyte azurophilic granule |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5624823A (en) * | 1991-11-22 | 1997-04-29 | The General Hospital Corporation | DNA encoding procine interleukin-10 |
| CN1230223A (en) * | 1996-07-19 | 1999-09-29 | 美国拜尔公司 | High-affinity interleukin-4 muteins |
-
2001
- 2001-09-28 CN CNB011297069A patent/CN1306030C/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5624823A (en) * | 1991-11-22 | 1997-04-29 | The General Hospital Corporation | DNA encoding procine interleukin-10 |
| CN1230223A (en) * | 1996-07-19 | 1999-09-29 | 美国拜尔公司 | High-affinity interleukin-4 muteins |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1408863A (en) | 2003-04-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1363559A (en) | Insulinotropic hormone secretion peptide derivative | |
| CN1306030C (en) | Human interleukin-10 gene sequenc and E coli containing the said gene sequence | |
| CN1821397A (en) | Method for preparing recombinant goose interferon I and II | |
| CN1831012A (en) | Immunological adjuvant with immunity vegulating agent for treating and preventing diabetic from insulin-dependent | |
| CN108948163B (en) | Macadamia nut plant defensin and application thereof | |
| CN1611604A (en) | Swine alpha-interferon gene synthesis, expression vector establishment and product preparing method | |
| CN101570757A (en) | Porcine alpha interferon and interleukin 2 chimeric gene, construction method and protein purification method thereof | |
| CN1786165A (en) | Preparation method of recombination staphylococcus aureus enterotoxin C2 | |
| CN1062565C (en) | Recombination human alpha type composite interferon, prepn. method and use therefor | |
| CN1255542C (en) | Constructing genetic engineering Vaccine of adhesin of confluent Helicobacter pylor and preparation method | |
| CN101045923A (en) | Process of producing interleukin analog | |
| CN1088107C (en) | Method for preparing human granulocyte macrophage colony stimulating factor and its expressing carrier and engineering bacteria | |
| CN1033837A (en) | Cultivate the method for recombinant protein expression cells | |
| CN1191088C (en) | Application of VMIP derivatives in medicine for treating AIDS and inflammation pathology | |
| CN103937828A (en) | Preparation method of fusion protein of porcine interferon-alpha 1 and thymosin-alpha 1 | |
| CN1313611C (en) | Novel tumor wilting matter 2 ligand gene, its expressed tumor wilting matter and its preparation method | |
| CN1012645B (en) | Production of protein | |
| CN1258747A (en) | Preparation of 4-tandem thymosin Alpha-1 with colon bacillus | |
| CN109776653A (en) | A kind of novel human serum albumins adhesion peptide and its application | |
| CN1185261C (en) | Interleukin -2/granulocyte-macrophage colony stimulating factor fusion protein | |
| CN1523040A (en) | Fusion protein of human thymosin alpha1 and human composite interferon and preparation thereof | |
| CN1616652A (en) | Gene engineering bacteria of high efficiency expression of human alpha 1-thymulin and its construction method and use | |
| CN1100875C (en) | Method for preparing recombination human interleukin-2 and its expressing carrier and engineering bacteria | |
| CN1800382A (en) | Recombinant human hepassocin preparation method and its uses in preparing medicine for anti-liver injury | |
| CN1284798C (en) | Poly thymosin-alpha 1, its composition, its preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20070321 Termination date: 20150928 |
|
| EXPY | Termination of patent right or utility model |