CN1569871A - Gene promoter of bacillus pumilus and its polynucleotide sequence - Google Patents

Abstract

The invention relates to a promotor nucleic acid sequence for expressing exogenesis genes in bacteria, the invention also relates to the carriers and host cells containing this nucleic acid sequence, wherein the promotor Bp53 from Bacillus pumilus strain (preservation number: CGMCC No.0518) is used in bacteria for express the leading-in genes at a high level.

Description

Gene promoter of bacillus pumilus and polynucleotide sequence thereof

Technical field the invention belongs to biological technical field.Specifically, the invention describes gene promoter and the polynucleotide sequence thereof of bacillus pumilus.

This laboratory of background technology once from the domestic refuse of Chengdu separation screening produce bacterium one bacillus pumilus (Bacillus pumilus) BA (06) to a strain Sumizyme MP.Bacillus pumilus (Bacillus pumilus) UN-31-C-42 is the outer Sumizyme MP superior strain (preserving number: CGMCC NO.0518) of born of the same parents that is obtained by wild strain BA (06) mutagenesis.The alkaline protease activity of BA (06) is about 500U/mL, and the proteolytic enzyme rate ratio starting strain of mutant strain is high 7 times, reaches 4000U/mL.Because the hair removal effect of the extracellular protease that this bacterial strain produces is fine, and the collagen hydrolytic activity is very low, therefore good application prospects is arranged in leather industry.And it only secretes a kind of proteolytic enzyme in substratum, so this bacterium comes expression alien gene to have big potentiality as genetically engineered host bacterium.Set up alkaline efficiently unhairing protease gene expression system in order to utilize this bacterial strain, and utilize this bacterium to express other foreign gene as genetically engineered host bacterium, need set up this bacterium conversion system and expression system efficiently, therefore from this strain gene group, separate strong basis and just seem most important because of promoter element.

Summary of the invention in view of the above, the strong basis that an object of the present invention is to provide this bacillus pumilus is because of promotor and fragment, analogue and derivative.

Another object of the present invention provides the polynucleotide of the strong basis of this bacillus pumilus because of promotor.

Another object of the present invention provides the strong basis that the contains this bacillus pumilus recombinant plasmid because of the polynucleotide of promotor.

Another object of the present invention provides the strong basis that the contains this bacillus pumilus genetically engineered host cell because of the polynucleotide of promotor.

The physicochemical property of the microorganism of the said generation unhairing protease of the present invention, the manufacture method of this enzyme and this enzyme we a related invention patent (number of patent application: 0012641.9, publication number: have a detailed description CN1361278A).The open strong basis that screens from the bacillus pumilus genome of this patent is because of the polynucleotide of promotor and this promotor is started the method for unhairing protease genetic expression in genetically engineered host cell Bacillus subtilus WB600 through the DNA recombinant technology.

The present invention relates to a kind of so isolating polynucleotide, it comprises a kind of nucleotide sequence or its variant that is selected from down group:

Polynucleotide with 1-184 among the SEQ ID No:1;

Sequence complementary polynucleotide with 1-184 among the SEQ ID No:1;

Have the polynucleotide of 70% homogeny at least with the polynucleotide sequence of 1-184 among the SEQ ID No:1.

The invention still further relates to a kind of carrier that contains polynucleotide of the present invention, particularly expression vector; This carrier of a kind of usefulness carries out genetically engineered host cell, comprises transformed host cells; Cultivate described host cell and detect the method for expressed unhairing protease and the purposes of this enzyme a kind of comprising.

Other aspects of the present invention are because disclosing of this paper technology is conspicuous to those skilled in the art.The following term of using in this specification sheets and claims has following implication unless stated otherwise:

" nucleotide sequence " is meant oligonucleotide, Nucleotide or polynucleotide and fragment or part, also can refer to genome or synthetic DNA, and they can be strand or two strands, represent sense strand or antisense strand.Polynucleotide " variant " are meant a kind of polynucleotide sequence that one or more Nucleotide change that has.Described change can comprise disappearance, insertion or the replacement of Nucleotide in the nucleotide sequence." disappearance " is meant the disappearance of one or more Nucleotide in nucleotide sequence." insertion " or " interpolation " is meant that the change in nucleotide sequence causes comparing the increase of one or more Nucleotide with naturally occurring molecule." replacement " is meant by different Nucleotide and replaces one or more Nucleotide.

" complementary " or " complementation " is meant under salt concn that allows and temperature condition by the natural combination of the polynucleotide of base pairing.For example, sequence " C-T-G-A " can combine with complementary sequence " G-A-C-T ".Complementation between two single chain molecules can be part or whole.Complementary degree between the nucleic acid chains has a significant effect for efficient of hybridizing between the nucleic acid chains and intensity.

" homology " is meant the complementary degree, can be portion homologous or complete homology." portion homologous " is meant a kind of part complementary sequence, and it can partly suppress the hybridization of complete complementary sequence and target nucleic acid at least.The inhibition of this hybridization can detect by hybridizing (Southern trace or Northern trace etc.) under the condition that reduces in the severity degree.Basically homologous sequence or hybridization probe can compete and suppress complete homologous sequence and target sequence the condition that reduces of severity degree under combine.This does not mean the conditions permit non-specific binding that the severity degree reduces because the conditional request two sequences that the severity degree reduces mutual be combined into specificity or selectivity mutually combines.

" homogeny percentage " be meant two or more nucleotide sequences relatively in the same or analogous percentage of sequence.The available electron method is measured the homogeny percentage, as passing through MEGALIGN program (Lasergenesoftware package, DNASTAR, Inc., Madison Wis.), MEGALIGN program.Can according to diverse ways such as Cluster method relatively two or more sequences (Higgins D.G., Sharp, P.M., Gene, 1988,73:237-244).The Cluster method is by checking distance between all pairings with each group series arrangement cluster, then with each bunch with in pairs or become set of dispense.With method well-known in the art such as JotunHein measure homogeny percentage between the nucleotide sequence (Hein J., Methods in enzymology, 1990,183:625-645).

" antisense " is meant and specific dna sequence dna complementary nucleotide sequence." antisense strand " is meant and " sense strand " complementary nucleic acid chains.

" isolating " speech refers to material is shifted out among its original environment (for example, if spontaneous its natural surroundings that just refers to).Such as it is exactly not to be separated that spontaneous polynucleotide are present in the live microorganism cell, but same polynucleotide separately are exactly isolating with the material that some or all coexist with it in natural system.Such polynucleotide may be the parts of a certain carrier, may such polynucleotide be parts of a certain composition also.Since carrier or composition are not the compositions of its natural surroundings, they remain isolating.

As used herein " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as the polynucleotide under the native state in the active somatic cell, but same polynucleotide as other materials that exist in the middle of the native state separately, then for separation and purification.

The invention provides isolating nucleic acid (polynucleotide), form by tool SEQ ID NO:1 polynucleotide substantially.Polynucleotide of the present invention are that (preserving number: the nucleotide sequence that comprises SEQ ID NO:1 that obtains CGMCC NO.0518), total length are 184 bases from bacillus pumilus (Bacillus pumilus) bacterial strain.

Polynucleotide of the present invention are dna forms.Dna form comprises the DNA of genomic dna or synthetic.DNA can be strand or double-stranded.

The invention still further relates to and the polynucleotide (having 70% homology between two sequences) of sequence hybridization described above.The present invention be more particularly directed to the polynucleotide that under stringent condition, can hybridize with polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or in (2) when hybridization, is with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1% Ficoll, 42 ℃ etc.; Or only just hybridize when above 70% at least at the homogeny between the two sequences (3).

The invention still further relates to nucleic acid fragment with sequence hybridization described above.The length of As used herein " nucleic acid fragment " contains 10 Nucleotide at least, better is 20-30 Nucleotide at least, is more preferably 50-60 Nucleotide at least, preferably 100 more than the Nucleotide.Nucleic acid fragment also can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of 1-184 among the SEQ of the having ID No:1 of the present invention.

Polynucleotide among the present invention preferably provide with isolating form, more preferably are purified to homogeneous.

The polynucleotide sequence of the gene promoter of special this bacillus pumilus of the present invention can obtain with several different methods.For example, separate polynucleotide with hybridization technique well known in the art.These technology including, but not limited to: with probe and genomic hybridization to detect the homologous polynucleotide sequence.

Sequence dna fragment of the present invention also can obtain in order to following method: 1) separate double chain DNA sequence from genomic dna; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of the polynucleotide sequence of 1-184 among the described SEQ of the having ID No:1.

In the above-mentioned method of mentioning, isolation of genomic DNA is the most frequently used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use, and available ordinary method is screened gene promoter of the present invention from these genomic libraries.These methods include, but is not limited to: DNA-DNA hybridization.In this method, hybridize used probe and be any a part of homology with the polynucleotide of gene promoter of the present invention, at least 10 Nucleotide of its length, better be at least 30 Nucleotide, be more preferably at least 50 Nucleotide, at least 100 Nucleotide preferably, probe used herein is the dna sequence dna of chemosynthesis on the basis of sequence information of the present invention normally.Gene promoter of the present invention itself or fragment certainly are used as probe.The mark of dna probe can be used radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.

The method of application round pcr DNA amplification (Saiki, et al., Science, 1985,230:1350-1354) be optimized for acquisition gene promoter of the present invention.The primer that is used for PCR can suitably be selected according to polynucleotide sequence information disclosed by the invention, and available ordinary method is synthetic.Available ordinary method is as the dna fragmentation by gel electrophoresis separation and purifying amplification.

Can use ordinary method such as dideoxy nucleotide chain cessation method (Sanger, et al.PNAS, 1977,74:5463-5467) mensuration as the polynucleotide sequence of above-mentioned gene promoter of the present invention that obtains or various dna fragmentations etc.This class polynucleotide sequence is measured also available commercial sequencing kit etc.

The present invention also relates to comprise the carrier of the polynucleotide of gene promoter of the present invention, and express the host cell of interested genes encoding region sequence, and the method that produces proteins of interest matter through recombinant technology with carrier of the present invention and gene engineering method.

Among the present invention, the polynucleotide sequence of coding unhairing protease can be inserted in the carrier, contains the recombinant vectors of the polynucleotide of gene promoter of the present invention with formation.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: and reproducible expression vector based on the T7 promotor in intestinal bacteria (Rosenberg, et al., Gene, 1987,56:125); Intestinal bacteria-Bacillus subtilus shuttle expression carrier pSUGV4 (Liu Chengjun, et al., Sichuan University's journal (natural science edition), 2001,38:243).In a word, as long as can duplicate in host and genetic stability, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication orgin, promotor, marker gene and translational control element usually.

Method well-known to those having ordinary skill in the art can be used to make up polynucleotide and the dna sequence dna of coding unhairing protease and the expression vector of suitable transcribing/translational control element that comprises gene promoter of the present invention.These methods comprise (Sambrook, et al., Molecular Cloning, a Labororatory Nanual, Cold SpringHarbor Laboratory such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body.New?York，1989)。Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.

In addition, expression vector preferably comprises one or more selected markers to be provided for selecting the phenotypic character of transformed host cells, cultivate the Tetrahydrofolate dehydrogenase of usefulness as eukaryotic cell, neomycin resistance and green fluorescent protein (GFP), or be used for colibacillary tsiklomitsin or amicillin resistance etc., or be used for kalamycin resistance of Bacillus subtilus and bacillus pumilus etc.

Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.

Among the present invention, the recombinant vectors that contains the polynucleotide of this gene promoter can be transformed into host cell, contains the genetically engineered host cell of the recombinant vectors of these polynucleotide with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria; Streptomycete; Bacterial cell such as Salmonella typhimurium; Eukaryotic cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.

Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host is prokaryotic organism, the competent cell that can absorb DNA can obtain at the exponential growth after date, use CaCl ₂Method is handled, and used step is well-known in this area.If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select the protoplast transformation method for use, particle gun conversion method, DNA infection protocol, coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.

Recombinant DNA technology by routine (Science, 1984,224:1431), utilize the polynucleotide sequence of gene promoter of the present invention to express or produce the protein of reorganization.Be example illustrative experiment step below with the unhairing protease:

(1) obtain gene promoter of the present invention and the coding unhairing protease gene.

(2) recombinant expression vector with the polynucleotide that contain this gene promoter and the polynucleotide of coding unhairing protease transforms proper host cell;

(3) in suitable medium, cultivate host cell;

(4) separation, protein purification from substratum or cell.

In step (1), the gene of gene promoter of the present invention and coding unhairing protease can be from bacillus pumilus (Bacillus pumilus) bacterial strain (preserving number: clone CGMCC NO.0518).The clone can be undertaken by the method for knowing.The embodiment of these methods is: synthetic suitable primer, and by the method for PCR clone's target gene or target sequence.

In step (2), in order to prepare polynucleotide that comprise this gene promoter and the recombinant vectors of encoding the unhairing protease gene, described gene can be recombinated to and is suitable for carrying out in the purpose host in any carrier of genetic expression, as intestinal bacteria-Bacillus subtilus shuttle expression carrier pSUGV4 (Liu Chengjun, et al., Sichuan University's journal (natural science edition), 2001,38:243).In a word, as long as can duplicate in host cell and genetic stability, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication orgin, promotor, marker gene and translational control element usually.

Use thus obtained recombinant plasmid, by transforming the host such as ordinary methods such as protoplasm body or competent cell methods.Though the host is not had concrete restriction, microorganism is preferred.

In step (3), any substratum that can make the microorganism growth that produces unhairing protease and produce said unhairing protease may be used to produce unhairing protease.

For example, can use glucose, fructose, maltose, sucrose, dextrin as carbon source, use inorganic nitrogen compound (as ammonium oxalate, ammonium chloride, saltpetre, Secondary ammonium phosphate etc.) or organic nitrogen compound (as casein, soybean cake, corn immersion liquid, analysis for soybean powder etc.) as nitrogenous source, to add mineral substance in addition, as phosphoric acid salt, sylvite, magnesium salts and calcium salt.The initial pH value of substratum is 7.5-10.In the present invention, culture is cultivated under aerobic condition, culture temperature is 37 ℃, and incubation time is 36-48 hour, can obtain the enzyme of maximum production.

In step (4), can carry out purifying to the proteolytic enzyme that obtains by above process according to the separation and the purification process of routine.By salt precipitation protein, spray drying process, lyophilization etc., soluble salt is joined in the supernatant liquor or filtrate (said supernatant liquor and filtrate are to obtain by solid residue centrifugal or filtration somatic cells and substratum) of gained, can obtain proteolytic enzyme.The purification process (as ion exchange chromatography and gel permeation chromatography) that also can be used in combination other is further purified said enzyme.The contriver is the unhairing protease called after DHAP that is obtained by the way.

The depilation activity of measuring protease activities and testing it by following method.

1, the mensuration of proteinase activity

1ml enzyme liquid is measured under the pH9.6 condition at 50 ℃, and the enzyme amount that the per minute caseinhydrolysate produces 1 μ g tyrosine is an enzyme activity unit (U).

2, the active test of losing hair or feathers

Is 9.6 with borax one sodium hydrate buffer solution (pH9.6) with the fermented liquid adjust pH, dress fermented liquid 50ml in the 250ml triangular flask, put into (10 * 15cm) 3 of pig buttocks salt brined hides after the cleaning, 37 ℃ of constant temperature shaking tables (rotating speed 160r/min) are gone up depilation, regularly observe the depilation situation, judge hair removal effect according to feel.

Use behind unhairing protease that can gene promoter of the present invention is expressed and stand-in, agonist, antagonist and inhibitor and the suitable additive combination.These additives can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination or some other additive that is used to make the proteolytic enzyme zymin.

Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.

Description of drawings Fig. 1 utilizes the strategy of promoter probe pSUPV4 screening promotor

The total DNA's of Fig. 2 bacillus pumilus is partially digested

1-6:1,0.5,0.25,0.125,0.0625 and 0.03175U Sau3AI partially digested

7: enzyme is not cut total DNA 8: λ/HindIII marker

The restriction analysis of Fig. 3 Kanr recon

1：DL2000?marker

2-12: the HindIII enzyme of different recons is cut

The HindIII enzyme of 13:pSUPV4 is cut

14：λ/EcoRI-HindIII?marker

The segmental nucleotide sequence of Fig. 4 Bp53

TATA box and GACA box represent that with following horizontal line sequence ATG represents with the bold-faced letter of overstriking.

Fig. 5 Bp53 fragment and unhairing protease gene coding region pcr amplification

1: unhairing protease gene signal peptide+propetide+mature polypeptide coding sequence

The 2:Bp53 fragment

3：λ/H?marker

The restriction analysis of Fig. 6 recon pMD-BpAp

1-2: enzyme is not cut pUC18, pMD-BpAp

The EcoRI enzyme of 3:pMD-BpAp is cut

The BamHI-SalI enzyme of 4:pMD-BpAp is cut

The BamHI-SalI enzyme of 5:pUC18 is cut

The HindIII enzyme of 6:pMD-BpAp is cut

7：λ/H?marker

Insert segmental pcr analysis among Fig. 7 recon pMD-BpAp

1：λ/HindIII?marker

The amplification of 2-3:Bp53 upstream primer-Ap downstream primer and Ap upstream primer-Ap downstream primer

The negative contrast of 4-5:Bp53 upstream primer-Ap downstream primer and Ap upstream primer-Ap downstream primer is expanded

Increase

6：λ/EcoRI-HindIII?marker

The construction strategy of Fig. 8 unhairing protease gene expression plasmid pSU-BpAp

The restriction analysis of Fig. 9 recon pSU-BpAp

1: λ/HinaIII marker 2-3: not digested plasmid pSUGV4 and pSU-BpAp

The pSUGV4 that the 4-5:XbaI enzyme is cut, pSU-BpAp,

The pSUGV4 that the 6-7:BamHI-SalI enzyme is cut, pSU-BpAp

8：λ/EcoRI-HindIII?marker

Insert segmental pcr analysis among Figure 10 recon pSU-BpAp

The 1-2:Bp53 fragment amplification is from pSU-BpAp, the total DNA of bacillus pumilus

(3.pSUGV4 negative contrast)

4-5: unhairing protease gene coding region sequence amplification is from pSU-BpAp, the total DNA of bacillus pumilus

6:pSUGV4 (negative contrast) 7: λ/EcoRI-HindIII marker

The growth of Figure 11 Bacillus subtilus WB600 transformant on the milk flat board

A：pSUGV4/WB600

B：pSU-BpAp/WB600

The SDS-PAGE of the fermented supernatant fluid of Figure 12 transformant pSU-BpAp/WB600 analyzes

M：Marker

1: negative contrast: pSUGV4/WB600

2: transformant: pSU-BpAp/WB600

3：B.pumilis?UN31-C-42

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to molecular clonings that the people showed such as normal condition such as Sambrook: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the method for advising according to manufacturer.

Embodiment

The clone of embodiment 1 bacillus pumilus gene promoter (its clone's strategy is seen accompanying drawing 1) the multiple clone site district of pSUPV4 and the nucleotide sequence of kalamycin resistance gene coding region fusion place are: 5 ' AGG AAT TCG ATA TCA AGC TTA TCG ATA CCG TCG ACCTCG AGG CCG CGA 3 '

R P R

Wherein, there is underscore partly to be the multiple clone site district; Rest part is kalamycin resistance gene coding region and amino acid sequence corresponding thereof.

Clone's strategy of bacillus pumilus gene promoter is seen accompanying drawing 1.Total DNA of bacillus pumilus is partially digested with Sau3AI, endonuclease bamhi is mainly concentrated between the 0.5-5Kb (see accompanying drawing 2).Dephosphorylation behind promoter probe pSUPV4 (seeing accompanying drawing 1) the usefulness BamHI complete degestion is connected transformed into escherichia coli (Escherichia coli) DH5 α again with suitable proportion with the dna fragmentation of above-mentioned partially digested gained.Transformant is coated on earlier on penbritin (the 100 μ g/mL) flat board, obtain about 10000 transformants altogether, random choose surplus 1000 a transformant point on kantlex (25 μ g/mL) flat board, obtain 83 positive bacterium colonies altogether, successively called after pSU-Bpl......pSU-Bp83.Therefrom again at random picking 32 resistance bacterium colony isolated plasmid dnas, cut and agarose electrophoretic analysis through the HindIII enzyme, show that each plasmid all has the DNA that differs in size to insert fragment, size (is seen accompanying drawing 3) between 200-2500bp.Clip size and kalamycin resistance level just do not have dependency (seeing Table 1).83 positive bacterium colonies that obtain are seeded in respectively on the kantlex flat board of 400,800,1000 and 1500 μ g/mL, check its resistance level.Experiment shows, with increasing of kantlex concentration, the positive colony number reduces, transformant pSU-Bp3 wherein, pSU-Bp14, pSU-Bp19, pSU-Bp21, pSU-Bp53, pSU-Bp55, pSU-Bp57, pSU-Bp62, pSU-Bp70, pSU-Bp71 can resist the kantlex of 1000 μ g/mL.Further experiment shows: pSU-Bp53, pSU-Bp57, pSU-Bp21 can be on the kantlex flat board of 1500 μ g/mL growth well, pSU-Bp53 even can on the kantlex flat board of 2000 μ g/mL, grow.

Insert the relation of segmental size and its kalamycin resistance level in the table 1 part recon

Insert segmental sample

Bp3 Bp14 Bp19 Bp21 Bp38 Bp53 Bp54 Bp57 Bp70

The product numbering

Insert clip size

200 1600 2200 220 700 180 1100 540 300

(bp)

Kalamycin resistance 100

1000 1000 1500 800 2000 400 1500 1000

(μg/mL) 0

The sequencing and the analysis of embodiment 2 Bp53 promoter fragments

The Bp53 promoter fragment has been carried out sequencing, and the result as shown in Figure 4.The Bp53 promoter fragment is less, and 184bp is only arranged.At the 38bp place sequence TATTTT who is similar to the TATA box is arranged, a sequence TTAACA similar to the TTGACA box is arranged at the 17bp place, have one similarly to be rich in the sequence A GGAAAG of AG at the 112bp place with ribosome bind site.This fragment 3 ' end has an initiator codon ATG, and the 48bp place also has the codon ATG of a phase place unanimity at its upstream.Distance according to initiator codon and ribosome bind site is many between 9-14bp, and we infer that the ATG at 131bp place is an initiator codon.After merged 16 amino acid that initiator codon ATG downstream has more and kalamycin resistance gene coding region, the latter's reading frame did not change.Studies show that more than kalamycin resistance gene coding region 5 ' end can be done bigger change and not influence its biological activity.Known array among this sequence and the Genebank is carried out homology relatively, do not have to find to have the sequence of homology with it.This sequence is new dna sequence dna.

The nucleotides sequence of kalamycin resistance gene coding region fusion place is classified as in this promoter fragment and the carrier: 5 ' TGTCATCTTATTAAGTGATGAGATG GATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATA CCGTCGACCTCGAGGCCGGAC3 '.

Wherein, underscore being arranged partly is the nucleotide sequence in multiple clone site district in the carrier; Rest part is the nucleotide sequence of promoter fragment Bp53.

Embodiment 3 pcr amplification bacillus pumilus gene promoter Bp53 fragments

Because the sequence of Bp53 promoter fragment is measured, therefore designed a pair of primer:

Bp53 upstream primer: 5 '-CCG GGATCCTCATTTAGTCAGCTTTAACAT-3 ' (seeing SEQ ID NO:2)

BamHI

Bp53 downstream primer: 5 '-CCG TCTAGACATCTCATCACTTAAGAT-3 ' (seeing SEQ ID NO:3)

XbaI

Utilize this to primer directly from bacillus pumilus (B.pumilus) (preserving number: CGMCC NO.0518) carry out pcr amplification the genome.The pcr amplification condition: 94 ℃ of 3min, 30 * (94 ℃ of 30sec, 59 ℃ of 30sec, 72 ℃ of 30sec), 72 ℃ of 5min amplify size and are the specific band (seeing accompanying drawing 5) of 184bp.The PCR product carries out enzyme with XbaI then and cuts through the test kit purifying, and enzyme is cut rear electrophoresis and reclaimed.

Embodiment 4 pcr amplification unhairing protease genes encoding region sequences

Because unhairing protease genes encoding region sequence measures, therefore designed another to primer:

Ap upstream primer: 5 '-CCG TCTAGAATGTGCGTGAAAAAGAAAAAT-3 ' (seeing SEQ ID NO:4)

XbaI

Ap downstream primer: 5 '-CGC GTCGACGGCATCAAGAACCGTGCAGC-3 ' (seeing SEQ ID NO:5)

SalI

(preserving number: total DNA CGMCC NO.0518) is a template with bacillus pumilus (B.pumilus), signal peptide+propetide+mature peptide the coding region sequence (being the Ap fragment) of unhairing protease gene is amplified with PCR method, pcr amplification condition: 94 ℃ of 5min, 30 * (94 ℃ of 30sec, 58 ℃ of 30sec, 72 ℃ of 60sec), 72 ℃ of 10min, size is 1365bp (seeing accompanying drawing 5).Its upstream primer contains the XbaI site, and downstream primer contains the SalI site.The PCR product carries out enzyme with XbaI and cuts behind the test kit purifying, and enzyme is cut rear electrophoresis and reclaimed.

Embodiment 5 Bp53 fragments link to each other with the unhairing protease gene coding region

Electrophoresis again after above-mentioned two reclaimed products and link to each other reclaims the dna fragmentation of expection size then, is inserted in the pMD18T carrier of TaKaRa company (Dalian Bao Bio-Engineering Company) again, has made up recon pMD-BpAp.Select by the pearl opal bacterium colony, select positive colony.The restriction analysis of recon pMD-BpAp is seen accompanying drawing 6, and accompanying drawing 7 is seen in the PCR checking of recon pMD-BpAp.

Correct in order to ensure two dna fragmentation fusion place nucleotide sequences, pMD-BpAp checks order to recon.The junction sequence that records conforms to expected results.

ATCTTTAATAACAATGTCATCTTATTAAGTGATGAGATG? TCT?AGA?ATG?TGC?GTG?AAA?AAG?AAA

AAT?GTG?ATG?ACA?AGT?GTT?TTA?TTG?GCT?GTC?CCT?CTT?CTG?TTTTCA?GCA?GGG?TTT

GGA

First ATG in the sequence is the initiator codon on the Bp53 fragment, second first amino acid that ATG is the AP gene signal peptide, and guaranteed that the initiator codon on the Bp53 fragment is consistent with the phase place of first amino acid code of AP gene signal peptide.TCTAGA is the recognition sequence of XbaI.

The structure of embodiment 6 expression vector pSU-BpAp

With above-mentioned recon pMD-BpAp BanHI and SalI double digestion, the BpAp DNA band of separation and purification 1.5Kb.The shuttle plasmid pSUGV4 of intestinal bacteria-Bacillus subtilus (seeing accompanying drawing 8) BamHI and SalI double digestion, and dephosphorylation is handled, be connected with suitable proportion with the BpAp gene fragment, transformed into escherichia coli (E.coli) DH5 α has obtained recon (called after pSU-BpAp) again.The structure route of pSU-BpAp is seen accompanying drawing 8, and the restriction analysis of recon pSU-BpAp the results are shown in accompanying drawing 9, and the PCR checking the results are shown in accompanying drawing 10.

Embodiment 7 expression of unhairing protease gene in Bacillus subtilus WB600

Recon pSU-BpAp has been transferred among the Bacillus subtilus WB600 with the competence conversion method, has obtained transformant (called after pSU-BpAp/WB600).This transformant not only can produce transparent hydrolysis circle (seeing accompanying drawing 11B) on the milk flat board, and has detected the enzyme work of unhairing protease in the fermented supernatant fluid of transformant.Original vector pSUGV4 then detects less than hydrolysis circle (seeing accompanying drawing 11A) and protease activities after being transferred to Bacillus subtilus WB600.The preserving number of transformant pSU-BpAp/WB600 is: CGMCC NO.0956.

The SDS-PAGE of the fermented supernatant fluid of embodiment 8 pSU-BpAp/WB600 analyzes

As shown in figure 12: the fermented supernatant fluid of the fermented supernatant fluid of transformant pSU-BpAp/WB600 and the former bacterium bacillus pumilus that sets out (B.pumilis UN-31-C-42) all demonstrates a protein belt that is approximately 31KD in SDS-PAGE.According to the existing result in this laboratory, the protease molecule amount of purifying is approximately 31KD.Prove thus: the unhairing protease gene has obtained expression in Bacillus subtilus WB600.The fermented supernatant fluid of transformant pSUGV4/WB600 does not then demonstrate the protein belt (seeing accompanying drawing 12 the 1st road) of 31KD.

The enzyme activity determination of embodiment 9 transformant pSU-BpAp/WB600 fermented liquids

The unhairing protease vitality test carries out (enzyme (U/ml)=O.D. alive according to China National Light Industrial Products Department's ministerial standard _500nm* extension rate * slope).Fermentation condition: plant 24h in age, inoculum size 1%, 100ml LB places the 250ml triangular flask, kantlex content 20 μ g/ml, 37 ℃ of shaking tables are cultivated rotating speed 200r/min.Behind inoculation 4h, every 4h takes a sample once, totally 12 times.Enzyme activity determination shows that this bacterial strain begins to produce enzyme behind fermentation 20h, peak at 48h, and the result is as shown in table 2 for its enzyme activity determination: transformant pSU-BpAp/WB600 has given expression to activated unhairing protease.

The proteolytic enzyme enzyme activity determination of table 2pSU-BpAp/WB600 transformant fermentation different time

Sample number into spectrum 123456789 10 11 12

Fermentation time

8 12 16 20 24 28 32 36 40 44 48 52

(h)

19.

Enzyme (U/ml) 000 5.4 8.3 11.8 12.6 15.5 18.1 20.4 21.2 alive

7

Detect in the fermented supernatant fluid of transformant pSUGV4/WB600 less than the enzyme of unhairing protease and live.

The depilation experiment of embodiment 10 transformant pSU-BpAp/WB600 fermented liquids

Get the 48h fermented liquid of transformant pSU-BpAp/WB600, transferring the pH value of fermented liquid with borax one sodium hydrate buffer solution (pH9.6) is 9.6, dress fermented liquid 50ml in the 250ml triangular flask, put into (10 * 15cm) 3 of pig buttocks salt brined hides after the cleaning, 37 ℃ of constant temperature shaking tables (rotating speed 160r/min) are gone up depilation, regularly observe the depilation situation, judge hair removal effect according to feel.The result shows that transformant pSU-BpAp/WB600 fermented liquid can lose hair or feathers, and to the not damage of leather collagen.Hair removal effect is as shown in table 3:

The depilation experiment of table 3pSU-BpAp/WB600 transformant fermented liquid

Sequence number 123456789

Treatment time (h) 8 12 16 20 24 28 32 36 48

Hair removal effect----+++++ ++

Annotate: "-" expression can not be lost hair or feathers; "+" expression can be lost hair or feathers, but effect is general; " ++ " expression can be lost hair or feathers, and effect is fine.

Damping fluid with identical pH value loses hair or feathers for bearing the fermented supernatant fluid that contrasts transformant pSUGV4/WB600, does not detect hair removal effect.

Shown by experimental result: the basic protein endonuclease capable that the Ap fragment is produced among the transformant pSU-BpAp/WB600 is independently finished the depilation of rawhide, and to the not damage of leather collagen.Proved further that thus we separate the gene promoter fragment Bp53 that obtains and can start the segmental expression of unhairing protease gene coding region Ap that comes from bacillus pumilus equally effectively in Bacillus subtilus WB600 from bacillus pumilus.Show that we separate the gene promoter fragment Bp53 that obtains and have the startup function in gram-positive microorganism and gram-negative bacteria, at the structure of expression vector and utilize gram-positive microorganism to express all to have a wide range of applications aspect the foreign protein as the host bacterium.Therefore the expression unit that utilizes this promotor to make up in the efficient expression vector of Bacillus subtilus and bacillus pumilus is feasible, also can be used for making up the marker gene in the shuttle plasmid that is applicable to simultaneously between intestinal bacteria, Bacillus subtilus and bacillus pumilus.This research work is also had laid a good foundation for further setting up the engineering bacteria that can express alkaline unhairing protease gene efficiently with Bacillus subtilus and bacillus pumilus as the host bacterium.

Sequence table

(1) general information:

(i) denomination of invention: gene promoter of bacillus pumilus and polynucleotide sequence thereof

(ii) sequence number: 5

(2) information of SEQ ID NO:1:

(i) sequence signature:

(A) length: 184bp

(B) type: nucleic acid

(C) chain: two strands

(D) open up the complementary class type: linearity

(E)(1)...(130)Promoter

(ii) molecule type: DNA

(iii) sequence description: SEQ ID NO:1:

1 TCATTTAGTC?AGCTTTAACA?TGTTAAAATG?ATAAAAGTAT?TTTTTTAATA

51 AAGTATGATA?GATTAAAATG?AGAACGTTAC?ATTTTCTCTG?GATTTTCTTC

101?TTTAGGATTG?TAGGAAAGTG?GGTGATCTAA?ATGAAAATCA?AAAAAATCTT

151?TAATAACAAT?GTCATCTTAT?TAAGTGATGA?GATG

(3) information of SEQ ID NO:2

(i) sequence signature:

(A) length: 30 bases

(B) type: nucleic acid

(C) chain: strand

(D) open up the benefit structure: linearity

(E) PCR primer

(ii) molecule type: oligonucleotide

(iii) sequence description: SEQ ID NO:2

CCGGGATCCTCATTTAGTCAGCTTTAACAT

(4) information of SEQ ID NO:3

(i) sequence signature:

(A) length: 27 bases

(B) type: nucleic acid

(C) chain: strand

(D) open up the benefit structure: linearity

(E) PCR primer

(ii) molecule type: oligonucleotide

(iii) sequence description: SEQ ID NO:3

CCGTCTAGACATCTCATCACTTAAGAT

(5) information of SEQ ID NO:4

(i) sequence signature:

(A) length: 30 bases

(B) type: nucleic acid

(C) chain: strand

(D) open up the benefit structure: linearity

(E) PCR primer

(ii) molecule type: oligonucleotide

(iii) sequence description: SEQ ID NO:4

CCGTCTAGAATGTGCGTGAAAAAGAAAAAT

(6) information of SEQ ID NO:5

(i) sequence signature:

(A) length: 29 bases

(B) type: nucleic acid

(C) chain: strand

(D) open up the benefit structure: linearity

(E) PCR primer

(ii) molecule type: oligonucleotide

(iii) sequence description: SEQ ID NO:5

CGCGTCGACGGCATCAAGAACCGTGCAGC

Claims (6)

1. isolating polynucleotide is characterized in that described polynucleotide comprise to be selected from down a kind of in the group:

(a) have fragment, the analogue of nucleotide sequence shown in the SEQ ID NO:1, the polynucleotide of derivative;

(b) with polynucleotide (a) complementary polynucleotide; Or

(c) with (a) or (b) have the polynucleotide of 70% homogeny at least.

2. polynucleotide as claimed in claim 1 is characterized in that described polynucleotide comprise the polynucleotide with sequence shown in the SEQ ID NO:1.

3. polynucleotide as claimed in claim 1 is characterized in that described polynucleotide include the sequence of 1-130 position among the SEQ ID NO:1.

4. recombinant vectors that contains exogenous polynucleotide is characterized in that it is the recombinant vectors that is formed by the described polynucleotide of arbitrary claim among the claim 1-3 and plasmid or other vector constructions.

5. a genetically engineered host cell that contains exogenous polynucleotide is characterized in that it is to be selected from following a kind of host cell: (a) host cell that transforms or transduce with the described recombinant vectors of claim 4; Or

(b) host cell that transforms or transduce with the described polynucleotide of the arbitrary claim among the claim 1-3.

6. the method for high level ground expression alien gene in bacterium is characterized in that in intestinal bacteria or subtilis expression alien gene under the regulation and control of the described polynucleotide sequence of arbitrary claim in claim 1-3.

Images