CN1539967A - A group of nucleotide sequence for anti infection of coronavirus and preventing SARS and application - Google Patents
A group of nucleotide sequence for anti infection of coronavirus and preventing SARS and application Download PDFInfo
- Publication number
- CN1539967A CN1539967A CNA031279015A CN03127901A CN1539967A CN 1539967 A CN1539967 A CN 1539967A CN A031279015 A CNA031279015 A CN A031279015A CN 03127901 A CN03127901 A CN 03127901A CN 1539967 A CN1539967 A CN 1539967A
- Authority
- CN
- China
- Prior art keywords
- sequence
- prevents
- diagnosed
- application
- medicine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicinal Preparation (AREA)
Abstract
A nucleotide sequence for preventing infection of coronavirus and preventing and treating SARS is disclosed. A series of PNA sequence fragments homologous with coronavirus sequence is obtained by homologous comparisons. Its derived dual-chain RNA sequence and its plasmid transcripted RNA can suppress the expression of coronavirus.
Description
Technical field
The present invention relates to one group of anti-coronavirus infection and prevent and treat the nucleotide sequence and the application thereof of atypical pneumonia.
Background technology
In recent years result of study confirms that short double-stranded RNA has the RNA interfering function in multiple mammalian cell, can special inhibition specific gene in intracellular expression.Also can suppress virogene in intracellular expression by this approach, thereby be used for the prevention and the treatment of virus infection.
Coronavirus is a positive chain RNA virus, has bigger variability.At present the similarity between the viral genome of isolating different sources less than 30%.Variation at epidemic period can cause pharmacological agent and gene therapy to be lost efficacy.
The present invention by homology relatively obtains a series of RNA sequences conservative between multiple coronavirus.Use this sequence deutero-double-stranded RNA sequence can effectively suppress the coronavirus expression of gene.This sequence of using plasmid to transcribe also can be answered expression of gene by inhibitory phase in cell.Therefore may be used to also prepare that anti-SARS infects and the medicine of the treatment of atypical pneumonia.
Summary of the invention
The purpose of this invention is to provide one group of anti-coronavirus infection and prevent and treat the nucleotide sequence of atypical pneumonia.
Another object of the present invention provides the application of above-mentioned nucleotide sequence.
For achieving the above object, the present invention is by the following technical solutions:
One group of anti-coronavirus infects and prevents and treats the RNA sequence and the fragment thereof of atypical pneumonia, and this group RNA sequence is as follows:
(1)ugggauuauccaaaauguga
(2)uguuuuggaauuguaacguugau
(3)uaacucaaaugaaucuuaaguaugc
(4)uauuaucaaaauaauguguu
(5)uuuaacauuugucaagcuguu
(6)uauauuaaauggccuugguauguuuggcu
(7)ggccacgcggaguacgaucgaggguacag
One group by described RNA sequence and fragment thereof and the double-stranded RNA sequence that forms of complementary sequence hybridization with it.
One group of sequence of holding the plus nucleotide modification by described RNA sequence and segment thereof at its 5 ' end or 3 '.
One group of described RNA sequence and fragment thereof and the hair clip sample RNA two strands that the incomplementarity catenation sequence forms in the middle of the sequence of reverse complemental adds with it.
One group of described sequence corresponding DNA sequences.
The expression vector that comprises described RNA sequence.
The expression vector that comprises described dna sequence dna.
Wrap up the liposome of described RNA sequence.
Wrap up the liposome of described dna sequence dna.
Wrap up the liposome of described expression vector.
With described RNA sequence in vivo or the method for external importing eukaryotic cell lines, animal and human body.
With described dna sequence dna in vivo or the method for external importing eukaryotic cell lines, animal and human body.
With described expression vector in vivo or the method for external importing eukaryotic cell lines, animal and human body.
With described liposome in vivo or the method for external importing eukaryotic cell lines, animal and human body.
Described RNA sequence and fragment thereof are used to prepare the anti-coronavirus infection and atypical pneumonia is diagnosed, treated and the application of the medicine of prevention.
Described dna sequence dna and fragment thereof are used to prepare the anti-coronavirus infection and atypical pneumonia is diagnosed, treated and the application of the medicine of prevention.
Described expression vector is used to prepare the anti-coronavirus infection and atypical pneumonia is diagnosed, treated and the application of the medicine of prevention.
Described liposome is used to prepare the anti-coronavirus infection and atypical pneumonia is diagnosed, treated and the application of the medicine of prevention.
Described method is used to prepare the anti-coronavirus infection and atypical pneumonia is diagnosed, treated and the application of the medicine of prevention.
Advantage of the present invention is: by homology relatively, obtain a series of and all coronavirus sequence height homologous RNA sequence fragments of having delivered, use this series fragment deutero-double-stranded RNA sequence can suppress the coronavirus expression of gene effectively; This series RNA that uses plasmid to transcribe also can suppress the coronavirus expression of gene in cell; Can transcribe out corresponding double chain RNA and suppress the coronavirus expression of gene after carrying this fragment corresponding DNA adeno-associated virus cells infected.
Description of drawings
Fig. 1 is the conservative property analysis chart of different middle coronavirus
Fig. 2 is the design of graphics of reporter plasmid pSPIKE
Fig. 3 suppresses coronavirus Spike expression of gene figure for double-chain interference RNA
Fig. 4 suppresses the proteic expression figure of coronavirus nucleocapsid protein Flag-Nuc for double-stranded RNA
The double-stranded RNA that Fig. 5 expresses for AAV can suppress the vegetative map of virus
Embodiment
The method that adopts among the embodiment is this area routine operation, sees " molecular cloning " third edition for details.
The homologous sequence of embodiment 1 different sources coronavirus:
With SARS complete sequence input Blast software, carry out homology relatively with all known coronavirus genes in the GeneBank storehouse, find homologous region as shown in Figure 1, its homologous sequence is as follows.
Extremely conservative RNA sequence in the coronavirus sequence that table 1. is relatively found by homology
| Numbering | The RNA sequence |
| ????1 | ?ugggauuauccaaaauguga |
| ????2 | ?uguuuuggaauuguaacguugau |
| ????3 | ?uaacucaaaugaaucuuaaguaugc |
| ????4 | ?uauuaucaaaauaauguguu |
| ????5 | ?uuuaacauuugucaagcuguu |
| ????6 | ?uauauuaaauggccuugguauguuuggcu |
| ????7 | ?ggccacgcggaguacgaucgaggguacag |
According to sequence in the claim 16, to choose the RNA fragment of long 19 Nucleotide, and according to the complementary RNA chain of synthetic this chain of principle of complementarity, and modify with UU at 3 ' end of RNA chain, the RNA two strands after the annealing is as follows:
5’uggccuugguauguuuggcuu?3’
3’uuaccggaaccauacaaaccg?5’
Plasmid pCMV-Myc (Clontech company) EcoRI (10 unit) and BglII (10 unit), 37 ℃ of enzymes were cut 2 hours, reclaimed segment as carrier; The primer of synthetic sars coronavirus membrane protein gene
PS1：cggaattcattttattttcttattatttcttactctcactagtggta；
PS2?cgggatccttatgtgtaatgtaatttgacacc?cttca。With SARS cDNA (1ng) is template, each 100ng of above-mentioned primer, Pfu high-fidelity DNA polymerase 2.5 units, dNTP 0.25mmol/L, MgCl22.5mmol/L, Tris.HCl (pH8.3) carried out PCR reaction (94 ℃ 30 seconds, 46 ℃ 30 seconds, 72 ℃ 90 seconds, use PekinElmer 9600 type PCR instrument, totally 30 circulations).PCR product QIAGEN purification kit (QIAgen 28704), cut (condition is the same) with EcoRI and BamHI enzyme then, carry out ligation together with above-mentioned carrier, connect product transformed into escherichia coli JM109 (Promega company), obtain right-on plasmid pSPIKE, can express the coronavirus S gene (Fig. 2) of band Myc label behind this plasmid transfection cell.
Above-mentioned plasmid 2 μ g with above-mentioned synthetic RNA2 μ g (or 3 kinds of uses of 2 μ g examples with the irrelevant double-stranded RNA chain of Spike gene be contrast) cotransfection HEK293 cell (ATCC, transfection method uses InvitrogenLipofectamine 2000, see its specification sheets), lysing cell after 36 hours, carry out immunoblotting (method is seen the molecular cloning third edition), more proteic expression output by anti-Myc antibody.
The result and is compared as shown in Figure 3, and coronavirus Spike expression of gene output has reduced 80-90%.Because this albumen contains the recognition sequence that virus enters cell, therefore suppress the breeding that this expression of gene can stop virus.
Embodiment 3: use the double-stranded expression that suppresses capsid protein gene of synthetic RNA
According to sequence in the claim 17, to choose the RNA fragment of long 19 Nucleotide, and synthesize its complementary strand, and modify with UU at 3 ' end of RNA chain according to the principle of complementary pairing, the RNA two strands after the annealing is as follows:
5’gaguacgaucgaggguacauu?3’
3’uucucaugcuagcucccaugu?5’
Plasmid pCMV-cMyc (Clontech company) EcoRI (10 unit) and BglII (10 unit), 37 ℃ of enzymes were cut 2 hours, reclaimed segment as carrier; Synthetic sars coronavirus nucleocapsid protein gene (N gene)
Primer PN1:cggaattccatatgtctgataatggaccccaatcaaa;
PN2：cggaattcggatccttatgcctgagttgaatcagcagaagc。With SARS cDNA (1ng) is template, and each 100ng of above-mentioned primer carries out pcr amplification and is cloned into above-mentioned carrier by condition as described in embodiment 2, obtains correct plasmid pNUC, can express the nucleocapsid protein of band Myc label behind this plasmid transfect cell.
Above-mentioned plasmid (pNUC) 2 μ g with above-mentioned synthetic RNA 2 μ g (or use among the 2 μ g embodiment 2 with the irrelevant double-stranded RNA of N albumen be contrast), as embodiment 2 cotransfection HEK293 cells, lysing cell after 36 hours, carry out immunoblotting (method is seen the molecular cloning third edition), more proteic expression output by anti-Myc antibody.
The result and is compared as shown in Figure 4, and coronavirus N expression of gene output has reduced 80-90%.Because this albumen is the coat protein of virus, losing this proteic virus can not increase, and therefore can effectively stop virus amplification.
Embodiment 4 uses double-stranded other coronavirus expression of gene that suppress of synthetic RNA
According to embodiment 2 described methods, the reporter plasmid that uses the RNA polymerase that synthetic 1,3,4,5 pairing RNA two strandss and expressed rna rely on behind the transfection HEK293 cell, can effectively suppress the expression of rna polymerase gene together.It suppresses efficient and sees Table 2.
Table 2 new ds Yeast Nucleic Acid suppresses the efficient that the coronavirus rna polymerase gene is expressed
| Numbering | Double-stranded RNA | Coronavirus is gene | Suppress efficient |
| 1 | 5′gggauuauccaaaaugugauu?3′ 3′uucccuaauagguuuuacacu?5′ | RNA polymerase | ????++++ |
| 3 | 5′ucaaaugaaucuuaaguauguu?3′ 3′uuaguuuacuuagaauucauac | RNA polymerase | ????++++ |
| 4 | 5′auuaucaaaauaauguguuuu?3′ 3′uuuaauaguuuuauuacacaa?5′ | RNA polymerase | ????++ |
| 5 | 5′uuaacauuugucaagcuguuu?3′ 3′uuaauuguaaacaguucgaca?5′ | RNA polymerase | ????+++ |
Annotate: ++ suppress efficient 25-50%; +++suppress efficient 50-75%; ++ ++ suppress efficient) 75%
The double-stranded coronavirus expression of gene that suppresses of the RNA that embodiment 5. eukaryotic vectors are expressed
The dna segment of conserved sequence 6 corresponding DNA sequences and complementary sequence thereof (black italic) among the synthetic embodiment 1, the sticking end of BamHI and HindIII is contained at two ends, and the intervening sequence of 9 Nucleotide is contained in the centre.Composition sequence is as follows: the annealing back forms the double-stranded DNA segment.
A：5’gatcccctggccttggtatgtttggcttcaagagagccaaacataccaaggccatttttggaaa；
B：5’agcttttccaaaaatggccttggtatgtttggctctcttgaagccaaacataccaaggccaggg
Segment A, B annealing back forms the double-stranded DNA segment.(BrummelkampTR et al, Science 296:550.2002) are cloned into expression vector pSUPER, obtain plasmid pSUPER-S to press the described method of document.
Plasmid pSUPER-S with plasmid pSPIKE (seeing embodiment 2) transfection HEK293 cell (with the negative contrast of plasmid pSUPER, transfection method is seen embodiment 2), 36 hours lysing cell after the transfection, carry out immunoblotting with anti-Myc antibody, as shown in Figure 3, the result shows that the proteic expression amount of SPIKE significantly reduces.
Embodiment 6. uses adenopathy adjoint virus carrier to express to such an extent that RNAi can suppress virus replication.
Example 5 plasmid pSUPER-S are cut (the enzyme tangent condition as described above) with the EcoRI+HindIII enzyme, be cloned into EcoRI and HindIII site (Fig. 2 is seen in method of attachment) of gland relevant viral vector pAAV-MCS (Stratagen company).Make up plasmid pAAV-Si, this plasmid (4 μ g) is reinstated Lipofectamine method cotransfection HEK293FT cell with helper plasmid pHelper 1 μ g (Stratagen company) and plasmid pAAV-RC 2 μ g (Stragagen company), get supernatant preparation reorganization AAV virus after 48 hours; Vero cell DMEM substratum (Invitrogen company, contain 10% foetal calf serum) be cultured to 50% density, with above-mentioned 108 recombinant adeno-associated virus vero cells infections (is contrast with pAAV-MCS), infect with SARS virus simultaneously, inhaled in 24 hours and remove supernatant, carry out the SDS-PAGE electrophoresis after the lysis, and shift (the half-dried electrophoretic blotting of BioRad company) to nitrocellulose filter, after the sealing of 5% skim-milk, the decubation SARS patients serum who adds 10ml 1: 50 dilution is hatched and is given a baby a bath on the third day after its birth inferiorly after 1 hour with PBST (pH7.4), adds anti-human IgG-HRP, hatch usefulness after 1 hour, PBST washs as above.Develop the color as embodiment 2.Coronavirus SPIKE albumen has significantly painted as a result.After using the reorganization AAV that expresses double-stranded RNA (RNAi) to infect, SPIKE antigen significantly reduces (as shown in Figure 5) in the cell, illustrates that coronavirus quantity reduces greatly in the cell.
Sequence table
＜110〉Beijing Sannuojiayi Biotechnology Co., Ltd
＜120〉one group of anti-coronavirus infects and prevents and treats the nucleotide sequence and the application thereof of atypical pneumonia
<130>
<160>7
<170>PatentIn?version?3.1
<210>1
<211>20
<212>RNA
＜213〉coronavirus genus (coronavirus genera)
<400>1
ugggauuauc?caaaauguga???????????????????????????????????????20
<210>2
<211>23
<212>RNA
＜213〉coronavirus genus (coronavirus genera)
<400>2
uguuuuggaa?uuguaacguu?gau???????????????????????????????????23
<210>3
<211>25
<212>RNA
＜213〉coronavirus genus (coronavirus genera)
<400>3
uaacucaaau?gaaucuuaag?uaugc?????????????????????????????????25
<210>4
<211>20
<212>RNA
＜213〉coronavirus genus (coronavirus genera)
<400>4
uauuaucaaa?auaauguguu????????????????????????????????????20
<210>5
<211>21
<212>RNA
＜213〉coronavirus genus (coronavirus genera)
<400>5
uuuaacauuu?gucaagcugu?u??????????????????????????????????21
<210>6
<211>29
<212>RNA
＜213〉coronavirus genus (coronavirus genera)
<400>6
uauauuaaau?ggccuuggua?uguuuggcu??????????????????????????29
<210>7
<211>29
<212>RNA
＜213〉coronavirus genus (coronavirus genera)
<400>7
ggccacgcgg?aguacgaucg?aggguacag??????????????????????????29
Claims (49)
1, one group of anti-coronavirus infects and prevents and treats the RNA sequence and the fragment thereof of atypical pneumonia, and this group RNA sequence is as follows:
(1)ugggauuauccaaaauguga
(2)uguuuuggaauuguaacguugau
(3)uaacucaaaugaaucuuaaguaugc
(4)uauuaucaaaauaauguguu
(5)uuuaacauuugucaagcuguu
(6)uauauuaaauggccuugguauguuuggcu
(7)ggccacgcggaguacgaucgaggguacag。
2, one group by the described RNA sequence of claim 1 and fragment thereof and the double-stranded RNA sequence that forms of complementary sequence hybridization with it.
3, one group of sequence of modifying at its 5 ' end or 3 ' end plus nucleotide by claim 1 or 2 described RNA sequences and segment thereof.
4, one group by claim 1 or 2 described RNA sequences and fragment thereof with the hair clip sample RNA two strands that the incomplementarity catenation sequence formed in the middle of the sequence of reverse complemental added with it.
5, one group of claim 1 or 2 described sequence corresponding DNA sequences.
6, one group of described sequence corresponding DNA sequences of claim 3.
7, one group of described sequence corresponding DNA sequences of claim 4.
8, the expression vector that comprises claim 1 or 2 described RNA sequences.
9, the expression vector that comprises the described RNA sequence of claim 3.
10, the expression vector that comprises the described RNA sequence of claim 4.
11, the expression vector that comprises the described dna sequence dna of claim 5.
12, the expression vector that comprises claim 6 or 7 described dna sequence dnas.
13, the liposome of parcel claim 1 or 2 described RNA sequences.
14, the liposome of the described RNA sequence of parcel claim 3.
15, the liposome of the described RNA sequence of parcel claim 4.
16, the liposome of the described dna sequence dna of parcel claim 5.
17, the liposome of parcel claim 6 or 7 described dna sequence dnas.
18, the liposome of the described expression vector of parcel claim 8.
19, the liposome of parcel claim 9 or 10 or 11 described expression vectors.
20, the liposome of the described expression vector of parcel claim 12.
21, in vivo or the method for external importing eukaryotic cell lines, animal and human body with claim 1 or 2 described RNA sequences.
22, in vivo or the method for external importing eukaryotic cell lines, animal and human body with the described RNA sequence of claim 3.
23, in vivo or the method for external importing eukaryotic cell lines, animal and human body with the described RNA sequence of claim 4.
24, in vivo or the method for external importing eukaryotic cell lines, animal and human body with the described dna sequence dna of claim 5.
25, in vivo or the method for external importing eukaryotic cell lines, animal and human body with claim 6 or 7 described dna sequence dnas.
26, in vivo or the method for external importing eukaryotic cell lines, animal and human body with the described expression vector of claim 8.
27, in vivo or the method for external importing eukaryotic cell lines, animal and human body with claim 9 or 10 or 11 described expression vectors.
28, in vivo or the method for external importing eukaryotic cell lines, animal and human body with the described expression vector of claim 12.
29, in vivo or the method for external importing eukaryotic cell lines, animal and human body with the described liposome of claim 13.
30, in vivo or the method for external importing eukaryotic cell lines, animal and human body with claim 14 or 15 or 16 or 18 or 20 described liposomes.
31, in vivo or the method for external importing eukaryotic cell lines, animal and human body with the described liposome of claim 17.
32, in vivo or the method for external importing eukaryotic cell lines, animal and human body with the described liposome of claim 19.
33, claim 1 or 2 described RNA sequences and fragment thereof are used to prepare the anti-coronavirus infection and the application of the medicine that atypical pneumonia is diagnosed, treated and prevents.
34, described RNA sequence of claim 3 and fragment thereof are used to prepare the anti-coronavirus infection and the application of the medicine that atypical pneumonia is diagnosed, treated and prevents.
35, described RNA sequence of claim 4 and fragment thereof are used to prepare the anti-coronavirus infection and the application of the medicine that atypical pneumonia is diagnosed, treated and prevents.
36, described dna sequence dna of claim 5 and fragment thereof are used to prepare the anti-coronavirus infection and the application of the medicine that atypical pneumonia is diagnosed, treated and prevents.
37, claim 6 or 7 described dna sequence dnas and fragment thereof are used to prepare the anti-coronavirus infection and the application of the medicine that atypical pneumonia is diagnosed, treated and prevents.
38, the described expression vector of claim 8 is used to prepare the anti-coronavirus infection and the application of the medicine that atypical pneumonia is diagnosed, treated and prevents.
39, claim 9 or 10 or 11 described expression vectors are used to prepare the anti-coronavirus infection and the application of the medicine that atypical pneumonia is diagnosed, treated and prevents.
40, the described expression vector of claim 12 is used to prepare the anti-coronavirus infection and the application of the medicine that atypical pneumonia is diagnosed, treated and prevents.
41, the described liposome of claim 13 is used to prepare the anti-coronavirus infection and the application of the medicine that atypical pneumonia is diagnosed, treated and prevents.
42, claim 14 or 15 or 16 or 18 or 20 described liposomes are used to prepare the anti-coronavirus infection and the application of the medicine that atypical pneumonia is diagnosed, treated and prevents.
43, the described liposome of claim 17 is used to prepare the anti-coronavirus infection and the application of the medicine that atypical pneumonia is diagnosed, treated and prevents.
44, the described liposome of claim 19 is used to prepare the anti-coronavirus infection and the application of the medicine that atypical pneumonia is diagnosed, treated and prevents.
45, the described method of claim 21 is used to prepare the anti-coronavirus infection and the application of the medicine that atypical pneumonia is diagnosed, treated and prevents.
46, claim 22 or 23 or 24 or 26 or 28 or 29 or 31 or 32 described methods are used to prepare the anti-coronavirus infection and the application of the medicine that atypical pneumonia is diagnosed, treated and prevents.
47, the described method of claim 25 is used to prepare the anti-coronavirus infection and the application of the medicine that atypical pneumonia is diagnosed, treated and prevents.
48, the described method of claim 27 is used to prepare the anti-coronavirus infection and the application of the medicine that atypical pneumonia is diagnosed, treated and prevents.
49, the described method of claim 30 is used to prepare the anti-coronavirus infection and the application of the medicine that atypical pneumonia is diagnosed, treated and prevents.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA031279015A CN1539967A (en) | 2003-04-23 | 2003-04-23 | A group of nucleotide sequence for anti infection of coronavirus and preventing SARS and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA031279015A CN1539967A (en) | 2003-04-23 | 2003-04-23 | A group of nucleotide sequence for anti infection of coronavirus and preventing SARS and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1539967A true CN1539967A (en) | 2004-10-27 |
Family
ID=34322079
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA031279015A Pending CN1539967A (en) | 2003-04-23 | 2003-04-23 | A group of nucleotide sequence for anti infection of coronavirus and preventing SARS and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1539967A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2467393A1 (en) * | 2009-08-19 | 2012-06-27 | Blood Systems, Inc. | New astrovirus species |
-
2003
- 2003-04-23 CN CNA031279015A patent/CN1539967A/en active Pending
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2467393A1 (en) * | 2009-08-19 | 2012-06-27 | Blood Systems, Inc. | New astrovirus species |
| EP2467393A4 (en) * | 2009-08-19 | 2013-01-23 | Blood Systems Inc | New astrovirus species |
| US8614090B2 (en) | 2009-08-19 | 2013-12-24 | Blood Systems, Inc. | Astrovirus species |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Golden et al. | An inside job for siRNAs | |
| CN1276082C (en) | Method for synthesizing C DNA | |
| JP2002272489A5 (en) | ||
| Hussain et al. | An Ascovirus-encoded RNase III autoregulates its expression and suppresses RNA interference-mediated gene silencing | |
| Figueroa et al. | Hyperediting by ADAR1 of a new herpesvirus lncRNA during the lytic phase of the oncogenic Marek’s disease virus | |
| Xue et al. | Role of chymotrypsin-like serine proteinase in white spot syndrome virus infection in Fenneropenaeus chinensis | |
| CN1301263C (en) | Nucleotide sequence for anti HIV infection and preventing AIDS and use thereof | |
| CN1539967A (en) | A group of nucleotide sequence for anti infection of coronavirus and preventing SARS and application | |
| CN1284850C (en) | Method for the recombinant production of polypeptides | |
| WO2023098787A1 (en) | Nucleic acid combination product, detection kit and method for amplifying target nucleic acid | |
| CN101063101A (en) | Cattle lactoferrin engineering bacterium and preparation method for antibiotic peptide cattle lactoferrin | |
| Farfán et al. | Antisense noncoding mitochondrial RNA-2 gives rise to miR-4485-3p by Dicer processing in vitro | |
| CN1249243C (en) | Targetted liver cancer AFP gene siRNAs expression carrier and its constructing method and use | |
| CN102965372A (en) | SiRNA interfering GDF9 gene expression and application thereof | |
| CN1597957A (en) | A group nucleodite sequence of anti-hepatitis virus C infection and preventing and curing hepatitis virus C and its segment and application | |
| CN1388248A (en) | Adenovirus proliferated specifically inside tumor cell to express interferon in high efficiency and its construction method | |
| CN1884526A (en) | RNA interference method for specificly and high effectively treating CSFV infection and biological formulation | |
| CN116426527B (en) | IBDV siRNA enrichment region gene fragment, recombinant plasmid, siRNA produced by recombinant plasmid, construction method and application | |
| CN105754957B (en) | Preparation method of recombinant baculovirus vaccine for preventing and treating avian influenza H5N1 | |
| CN100365009C (en) | Anti HBV infection and hepatitis B-preventing nucleotide sequence and its use | |
| Kim et al. | Expression analysis of interferon-stimulated gene 15 in the rock bream Oplegnathus fasciatus against rock bream iridovirus (RSIV) challenge | |
| WO2017214940A1 (en) | Lentiviral expression vector for specifically promoting high expression of cplx2 gene, and applications thereof | |
| CN1324136C (en) | SiRNA double chain for inhibiting bc 1-2 gen expression and use | |
| CN101063132A (en) | Lateolabrax interleukins 8 gene order | |
| CN100351384C (en) | Eucaryon expression system using jiadi flagllate virus as gene expression carrier |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |