CN100365009C - Anti HBV infection and hepatitis B-preventing nucleotide sequence and its use - Google Patents
Anti HBV infection and hepatitis B-preventing nucleotide sequence and its use Download PDFInfo
- Publication number
- CN100365009C CN100365009C CNB031496970A CN03149697A CN100365009C CN 100365009 C CN100365009 C CN 100365009C CN B031496970 A CNB031496970 A CN B031496970A CN 03149697 A CN03149697 A CN 03149697A CN 100365009 C CN100365009 C CN 100365009C
- Authority
- CN
- China
- Prior art keywords
- sequence
- dna
- rna
- nucleotide
- fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicinal Preparation (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention discloses a set of DNA sequences for resisting HBV infection and preventing and treating hepatitis b, and fragments thereof shown as the sequence table, RNA sequences and fragments thereof, modified nucleotide sequences and double-chain nucleotide sequences corresponding to the sequences, expression vectors comprising the nucleotide sequences, liposomes, a method for leading the nucleotide sequences, the expression vectors and the liposomes in eukaryotic cell series, animals or human bodies in an in vivo mode or an in vitro mode, and the application of the content for preparing anti-HBV infection medicines and hepatitis b diagnosis, treating and preventing medicines. The present invention has the advantages that a series of DNA sequence fragments high isogenous with the reported HBV sequences are obtained through isogenous comparison; double-chain RNA sequences derived by the fragments can effectively inhibit the expression of HBV genes; the RNA fragments using plasmid transcription can also inhibit the expression of HBV genes in cells; adenovirus associated viruses carrying the DNA fragments can transcribe corresponding double-chain RNA and inhibit the expression of HBV genes after infecting cells.
Description
Technical field
The present invention relates to one group of anti HBV infecting and prevent and treat the nucleotide sequence and the application thereof of hepatitis B.
Background technology
Chronic viral hepatitis B (" hepatitis B ") is the liver inflammatory lesion that hepatitis B virus causes.China is the district occurred frequently of " hepatitis B ", and about 1.2 hundred million people's hepatitis B surface antigen presents the positive.Hepatitis B popular, the serious harm human health.
Discovering in recent years exists " RNA interference " mechanism in the various kinds of cell." RNA interference " is a kind of by double-stranded RNA (RNA interfering) inductive gene silencing, in this process, has the messenger RNA(mRNA) of homologous sequence to be degraded with double-stranded RNA, thereby suppressed this expression of gene.By this approach also degradable virogene, suppress virogene in intracellular expression.Therefore, special " RNA interfering " sequence of seeking at hepatitis B virus provides new thinking for diagnosing and treating hepatitis B.
Summary of the invention
The purpose of this invention is to provide one group of anti HBV infecting and prevent and treat the nucleotide sequence and the fragment thereof of hepatitis B, comprise thymus nucleic acid (DNA) and Yeast Nucleic Acid (RNA).
Another object of the present invention provides the application of above-mentioned nucleotide sequence.
For achieving the above object, the present invention adopts following design:
One group of anti HBV infecting and prevent and treat the dna sequence dna and the fragment thereof of hepatitis B, this group dna sequence dna is as follows:
1)catcctgctgctatgcctcat
2)aaggtatgttgcccgtttgtcc
3)cctattgattggaaagtatgtcaaa
4)tcgccaacttacaaggcctttct
5)tgtgctgccaactggatcct
6)ccgtgtgcacttcgcttcacct
7)ggaggctgtaggcataaattggtctgt
8)ggagtgtggattcgcactcct
9)agaccaccaaatgcccctatc
10)gaggcaggtcccctagaagaagaactccctcgc
11)tattcttgggaacaagagctacag
12)ttcaagcctccaagctgtgccttgggtggcttt。
Described dna sequence dna and fragment thereof and the double chain DNA sequence that forms with its reverse complementary sequence.This doubly-linked sequence is mainly used in and is cloned into expression vector, to express RNA interfering.
Described dna sequence dna and fragment thereof are modified the dna sequence dna that forms at its 5 ' end or 3 ' end plus nucleotide.Its purposes is as adding restriction enzyme site at the DNA two ends.
The RNA sequence and the fragment thereof of one group of described dna sequence dna correspondence.This RNA sequence may form double-stranded RNA with intracellular rna in cell.
Described RNA sequence and fragment thereof and the double-stranded RNA sequence that forms of complementary sequence hybridization with it.This RNA two strands has the RNA interferon activity, can make special mRNA degraded.
Described RNA sequence and fragment thereof and the hair clip sample double-stranded RNA sequence that the incomplementarity catenation sequence forms in the middle of the sequence of reverse complemental adds with it.In cell, can pass through vector expression hair clip sample two strands, have the RNA interfering activity, impel special mRNA degraded.
Described RNA sequence and fragment thereof are modified the RNA sequence that forms at its 5 ' end or 3 ' end plus nucleotide.This modification normally adds the UU modification at 3 ' end or the 5 ' end of synthetic RNA.
Comprise described dna sequence dna and segmental expression vector thereof.Promptly utilize carriers such as plasmid,, form RNA interfering at cell inner expression RNA.
Comprise described RNA sequence and segmental expression vector thereof.
The liposome that comprises described dna sequence dna and fragment thereof, RNA sequence and fragment and expression vector.Use liposome, but can be with the plasmid transfered cell of RNA or expressed rna, thus reach therapeutic purpose.
Utilize virus vector in vivo or the method for external importing eukaryotic cell lines, animal and human body described dna sequence dna and fragment thereof or RNA sequence and fragment thereof.Virus vector commonly used comprises dna viral vector, as rAAV and ad-5; Rna virus vector is as Lentivirus and Coronovirus.Use recombination adenopathy adjoint virus carrier, carry the above-described DNA or the RNA fragment of suitable eukaryotic promoter and coding hair clip shape double-stranded RNA, this recombinant virus-infected cell or injection give to express the formation RNA interfering behind animal and the human body, suppress the HBV expression of gene, thereby treatment HBV infects.
With described expression vector and liposome in vivo or the method for external importing eukaryotic cell lines, animal and human body.
Described dna sequence dna and fragment thereof, RNA sequence and fragment, expression vector, liposome and method are used to prepare the application of the medicine of anti HBV infecting and diagnosis of hepatitis b, treatment and prevention.
The present invention by homologous sequence has relatively obtained a series of dna sequence dnas conservative between various hepatitis B viruses (HBV).Use this sequence deutero-RNA interfering can effectively suppress the expression of hepatitis B virogene.Compare with existing gene therapy method, the present invention has the following advantages: 1. by homology relatively, obtained a series of and all hepatitis B virus sequence height homologous dna sequencing fragments of having delivered, use this series fragment deutero-RNA interfering can effectively suppress the expression of hepatitis B virogene, and action site is many, sphere of action is extensive; 2. the site of these RNA interfering effects is conserved sequences of hepatitis B virus, thereby the not due to illness sudden change of virus gene and ineffective effect; 3. these RNA interfering of using plasmid to transcribe can be answered expression of gene by inhibitory phase in cell, therefore not only are expected to be used for the treatment of hepatitis B patient, and might be used for hepatitis B infected prevention; 4. use adeno-associated virus as carrier, the dna fragmentation of purpose RNA interfering correspondence can be incorporated on the karyomit(e) of host cell, thereby might make human body produce permanent anti-HBV ability.
The present invention is further illustrated below in conjunction with the drawings and specific embodiments.
Description of drawings
Fig. 1 suppresses the efficiency diagram that HBsAg expresses for synthetic RNA interfering
Fig. 2 suppresses the efficiency diagram that HBcAg expresses for synthetic RNA interfering
Fig. 3 for the plasmid pH1-HBVS1 that expresses inner double-stranded RNA design of graphics
Fig. 4 is the structure of plasmid pAAV-HBVS1
Fig. 5 is the structure of plasmid pcDNA-HBVS
Embodiment
The method that adopts among the embodiment is this area routine operation, sees " molecular cloning " third edition (Science Press, 1998) for details.
Embodiment 1: the acquisition of extremely conservative HBV dna sequence dna
Select the HBV1 type sequence delivered, be divided into the fragment of each about 70 Nucleotide (nt) by functional gene; The BLAST software (BLASTN2.2.6) that each fragment provides with NIH (NIH) is analyzed it at GenBank (NCBI on internet, American National biotechnology information center), EMBL (European Molecular Bioglogy Laboratory nucleic acid sequence data storehouse), the homologous sequence in DDBJ (Japanese DNA database) and the GDB database nucleotide sequences such as (genome databases); Select the nucleotide sequence that meets following condition: (1) this fragment is more than or equal to 19 Nucleotide; (2) this fragment extremely conservative or complete homology in the HBV sequence that is compared; The sequence that is obtained sees Table 1.
Extremely conservative dna sequence dna in the HBV sequence that table 1. is relatively found by homology
| Numbering | The HBV gene | |
| 1 2 3 4 5 6 | Polymerase；S Polymerase；S Polymerase Polymerase Polymerase；X Polymerase；X | catcctgctgctatgcctcat aaggtatgttgcccgtttgtcc cctattgattggaaagtatgtcaaa tcgccaacttacaaggcctttct tgtgctgccaactggatcct ccgtgtgcacttcgcttcacct |
| Numbering | The HBV gene | Dna sequence dna |
| 7 8 9 10 11 12 | X Core Core Core Polymerase；core Polymerase | ggaggctgtaggcataaattggtctgt ttcaagcctccaagctgtgccttgggtggcttt ggagtgtggattcgcactcct agaccaccaaatgcccctatc gaggcaggtcccctagaagaagaactccctcgc tattcttgggaacaagagctacag |
According to above-mentioned env gene conservative sequence (No. 1 sequence in the table 1), the RNA fragment of 19 Nucleotide of synthetic DNA sequence correspondence, and according to the complementary RNA chain of synthetic this chain of principle of complementarity, add UU at RNA chain 3 ' end and modify:
5’uccugcugcuaugccucauuu
3’uuaggacgacgatacggagta
Each 1 μ g of above-mentioned synthetic RNA chain, add 1 μ l annealing buffer (10mmol/LTrisHCl (PH7.4), 100mmol/LNaCl), add do not contain RNase deionized water to cumulative volume 10 μ l.90 ℃ of heating, 25 ℃ of insulation 1h after 5 minutes get RNA two strands after the 2 μ g annealing, after 30 minutes, differentiate the formation situation of double-stranded RNA through the special RNase of 4IU single stranded RNA and 37 ℃ of digestion of DNase I with polyacrylamide gel electrophoresis.Found that the 20bp place has a single RNA band to occur.Illustrate that two complementary RNA strands of synthetic have hybridized into the RNA two strands.
Inoculation CHO-HBV cell (this cellular integration has the full genome of hepatitis B virus and expresses relevant albumen, and our company makes up voluntarily) overnight incubation in the culture dish of 100mm makes cell reach 90% degree of converging (confluence).The DMEM that gets the 1.5ml antibiotic-free respectively dilutes 2 μ g synthetic double-chain interference RNAs, be contrast with 2 μ g synthetic single stranded RNAs, the an amount of Oligofectamine transfection reagent (Invitrogen company product) that adds 1.5ml antibiotic-free DMEM dilution was then placed 20 minutes in the room temperature behind the slight mixing.Transfection liquid is joined in the CHO-HBV cell of being cultivated transfectional cell 6 hours.Discard transfection liquid, add the DMEM nutrient solution that contains 10%FCS, continue to cultivate 72 hours.Lysing cell, centrifugal extraction supernatant.Use HBV surface protein antigen ELISA detection reagent (Huamei Bio-Engrg Co.) to measure the expression amount of hepatitis B surface antigen, and observe the influence that RNA interfering is expressed hepatitis B surface antigen.
The result: as shown in Figure 1, the cell of transfection 2 μ g double-stranded RNAs, its HBsAg expression amount (1#) significantly reduces than the cell of transfection 2 μ g strands (as negative control), only is 1/10 of contrast.Because this albumen is for the outer membrane protein of virus and contain the ligand sequence that virus enters cell, therefore suppress this expression of gene virion capable of blocking formation, prevent virus infected cell.
Embodiment 3, the double-stranded inhibition of synthetic RNA core (HBcAg) genetic expression
According to the RNA fragment of synthetic 19 Nucleotide of above-mentioned core conserved sequence (No. 8 sequences in the table 1), and, add UU,, form the RNA two strands as embodiment 2 annealing at complementary RNA chain 3 ' end according to the complementary RNA chain of synthetic this chain of principle of complementarity:
5’gaguguggauucgcacuccuu
3’uucucacaccuaagcgugagg
According to the method for embodiment 2, with 2 μ g chain RNA and 2 μ g single stranded RNAs (normal chain) difference transfection CHO (HBV) cell, collecting cell after 72 hours, the expression amount (using the magnificent biotechnology HBcAg ELISA of company limited test kit) of HBcAg is measured in broken back.
The result shows, compared with the control, synthetic double-stranded RNA make the expression amount of cell HBcAg reduced by 85% (Fig. 2,8#).
With embodiment 2, No. 2, No. 9, No. 10 sequence corresponding double chain RNA among the embodiment 1 have been synthesized, the expression level of HBsAg or HBcAg behind same mensuration transfection CHO (HBV) cell, the result shows that these 3 sequences all make the expression amount of corresponding protein significantly reduce (seeing 2# among Fig. 1 respectively, 9# and 10# among Fig. 2).
The synthetic dna fragmentation of S gene conserved sequence (No. 1 sequence in the table 1) and the dna fragmentation of hybridization sequences (black italic) thereof of containing, the annealing back forms dna fragmentation, 5 ' end is the end in BamHI site, 3 ' end is the end in HindIII site, contains intervening sequence in the middle of homologous sequence and complementary sequence thereof.B is the complementary sequence of A:
1A gatcccctcctgctgctatgcctcatttcaagagaatgaggcatagcagcaggatttttggaaa
1B agcttttccaaaaatcctgctgctatgcctcattctcttgaaatgaggcatagcagcaggaggg
As shown in Figure 3, by PCR (with human gene group DNA 1 μ g is template, primer 15 '-TAATTAATACGGCTGCGGCCGCAATTCGAACGCTGACGTC-3 ' 100ng, 5 ' end contains AseI, MluI and NotI site respectively for it; Primer 25 '-GCACTAGTAAGCTTGGATCCGTGGTCTCATACAGAACTTATAAGATTCCC-3 ' 100ng, its 5 ' end contains SpeI, HindIII and BglII site, use Roche High Fidelity PCR test kit by specification, use PE company 9700 type PCR instrument, increase.Amplification condition: 94 ℃ 50 seconds; 46 ℃ 50 seconds, 72 ℃ 90 seconds, 2 circulations of increasing; 94 ℃ 50 seconds; 56 ℃ 50 seconds, 72 ℃ 90 seconds, 25 circulations of increasing; Obtain the promoter region of people H1 rna gene, plasmid pEGFPC1 (Clontech) reclaims big fragment as carrier after using AseI and XbaI enzyme cutting, and above-mentioned amplified fragments is cut the back with AseI and SpeI enzyme and reclaimed, and is connected with carrier, obtains plasmid pH1 behind the transformed into escherichia coli.(A, B) the annealing rear clone makes up plasmid pH1-HBVS1 (Fig. 3) to the BamHI and the HindIII site of pH1 plasmid with above-mentioned synthetic dna fragmentation.This plasmid under the effect of rna plymerase iii, is expressed hair clip shape RNA in cell, form the RNA two strands.
With 4 μ g pH1-HBVS1 plasmids (using in contrast) with amount pH1 plasmid, use Lipofectamine method transfection CHO (HBV) cell, compare the difference that HBsAg expresses output by method as described in embodiment 2.The HBsAg expression amount reduced about 90% (Fig. 1) after the result showed the pH1-HBVS1 transfectional cell.
Embodiment 6. uses adenopathy adjoint virus carrier, carries the dna fragmentation of the H1 promotor as described in example 5 above and the hair clip shape double-stranded RNA of encoding, and suppresses the HBVS expression of gene behind the recombinant virus-infected cell.
As shown in Figure 5, plasmid pAAV-MCS (purchasing in Stratagene) cuts with MluI and HindIII enzyme; The dna fragmentation that contains H1 promotor and coding HBVS1 hair clip shape RNA is cut acquisition with MluI and HindIII enzyme from plasmid pH1-HBVS1, and be cloned into the corresponding site of pAAV-MCS. make up plasmid pAAV-HBVS1 (Fig. 4), with this plasmid (4 μ g) (contrast virus vector pAAV-MCS) and helper plasmid pHelper (1 μ g, Stratagene) and plasmid pAAV-RC (2 μ g Stratagene) reinstate LIPOFECTamine method cotransfection HEK 293FT cell (seeing specification sheets), transfection is collecting cell and nutrient solution supernatant after 72 hours, multigelation 4 times, centrifugal 10 minutes of 12000rpm, get supernatant and be stored in-20 ℃ standby, this supernatant is AAV-RNA interfering virus supernatant.
Genomic dna 1ng is a template with hepatitis B virus (adr hypotype), add primer HBV S5 (cggatccatgcagtggaactccacaaca) and HBV S3 (cgaattctcaaatgtatacccaaagac), with each 100ng of HBV S3, use the Roche HighFidelity PCR of company test kit (method is seen specification sheets), use PE company 9700 type PCR instrument, 94 ℃ 50 seconds; 46 ℃ 50 seconds, 72 ℃ 90 seconds, 25 circulations of increasing obtain the S gene (containing PreS1 and PreS2) of HBV.This fragment is cut the corresponding site of rear clone to pcDNA3.1 with the BamHI+EcoRI enzyme, obtains plasmid pcDNA-HBVS (Fig. 5).
Use contains about DMEM culture medium culturing HEK 293 cells to 50% of 10% foetal calf serum, adds above-mentioned viral supernatant, continues to cultivate 12h.Plasmid pcDNA-HBS 5 μ g, 293 cells of the above-mentioned infective virus of use Lipofectamine method transfection continue cultivation and are subjected to cell after 72 hours, use the ELISA method to analyze the expression level of HBsAg.
The result: compare with contrast (carrying the AAV of galactosidase gene) virus, the recombinant adeno-associated virus of expressing RNA interfering can significantly suppress the expression (Fig. 2) of HBsAg.
Sequence table
＜110〉Beijing three Bioisystech Co., Ltd of Nuo Jia city
＜120〉one group of anti HBV infecting and prevent and treat the nucleotide sequence and the application thereof of hepatitis B
<130>
<160>12
<170>PatentIn version 3.2
<210>1
<211>21
<212>DNA
＜213〉positive hepadnavirus belongs to (orthohepadnaviridae)
<400>1
catcctgctg ctatgcctca t 21
<210>2
<211>22
<212>DNA
＜213〉positive hepadnavirus belongs to (orthohepadnaviridae)
<400>2
aaggtatgtt gcccgtttgt cc 22
<210>3
<211>25
<212>DNA
＜213〉positive hepadnavirus belongs to (orthohepadnaviridae)
<400>3
cctattgatt ggaaagtatg tcaaa 25
<210>4
<211>23
<212>DNA
＜213〉positive hepadnavirus belongs to (orthohepadnaviridae)
<400>4
tcgccaactt acaaggcctt tct 23
<210>5
<211>20
<212>DNA
＜213〉positive hepadnavirus belongs to (orthohepadnaviridae)
<400>5
<210>6
<211>22
<212>DNA
＜213〉positive hepadnavirus belongs to (orthohepadnaviridae)
<400>6
ccgtgtgcac ttcgcttcac ct 22
<210>7
<211>27
<212>DNA
＜213〉positive hepadnavirus belongs to (orthohepadnaviridae)
<400>7
ggaggctgta ggcataaatt ggtctgt 27
<210>8
<211>21
<212>DNA
＜213〉positive hepadnavirus belongs to (orthohepadnaviridae)
<400>8
ggagtgtgga ttcgcactcc t 21
<210>9
<211>21
<212>DNA
＜213〉positive hepadnavirus belongs to (orthohepadnaviridae)
<400>9
agaccaccaa atgcccctat c 21
<210>10
<211>33
<212>DNA
＜213〉positive hepadnavirus belongs to (orthohepadnaviridae)
<400>10
gaggcaggtc ccctagaaga agaactccct cgc 33
<210>11
<211>24
<212>DNA
＜213〉positive hepadnavirus belongs to (orthohepadnaviridae)
<400>11
tattcttggg aacaagagct acag 24
<210>12
<211>33
<212>DNA
＜213〉positive hepadnavirus belongs to (orthohepadnaviridae)
<400>12
ttcaagcctc caagctgtgc cttgggtggc ttt 33
Claims (17)
1. one group of anti HBV infecting and prevent and treat the dna sequence dna of hepatitis B and have the sequence fragment of 19 Nucleotide, this group dna sequence dna is as follows:
1)catcctgctgctatgcctcat
2)aaggtatgttgcccgtttgtcc
3)cctattgattggaaagtatgtcaaa
4)tcgccaacttacaaggcctttct
5)tgtgctgccaactggatcct
6)ccgtgtgcacttcgcttcacct
7)ggaggctgtaggcataaattggtctgt
8)ggagtgtggattcgcactcct
9)agaccaccaaatgcccctatc
10)gaggcaggtcccctagaagaagaactccctcgc
11)tattcttgggaacaagagctacag
12)ttcaagcctccaagctgtgccttgggtggcttt。
2. the described dna sequence dna of claim 1 and have the sequence fragment of 19 Nucleotide and the double chain DNA sequence that forms with its reverse complementary sequence.
3. the described dna sequence dna of claim 1 and have the sequence fragment of 19 Nucleotide and the incomplementarity catenation sequence forms in the middle of the sequence of reverse complemental adds with it hair clip sample double chain DNA sequence.
4. claim 1 or 2 described dna sequence dnas and sequence fragment with 19 Nucleotide thereof add UU at its 5 ' end or 3 ' end and modify the dna sequence dna that forms.
5. the RNA sequence of one group of described dna sequence dna correspondence of claim 1 and have the sequence fragment of 19 Nucleotide.
6. the described RNA sequence of claim 5 and have the sequence fragment of 19 Nucleotide and the double-stranded RNA sequence that forms of complementary sequence hybridization with it.
7. the described RNA sequence of claim 5 and have the sequence fragment of 19 Nucleotide and the incomplementarity catenation sequence forms in the middle of the sequence of reverse complemental adds with it hair clip sample double-stranded RNA sequence.
8. claim 5 or 6 described RNA sequences and sequence fragment with 19 Nucleotide thereof add UU at its 5 ' end or 3 ' end and modify the dna sequence dna that forms.
9. comprise any one described dna sequence dna in the claim 1 to 4 and have the expression vector of the sequence fragment of 19 Nucleotide.
10. comprise any one described RNA sequence in the claim 5 to 8 and have the expression vector of the sequence fragment of 19 Nucleotide.
11. comprise any one described dna sequence dna in the claim 1 to 4 and have the liposome of the sequence fragment of 19 Nucleotide.
12. comprise any one described RNA sequence in the claim 5 to 8 and have the liposome of the sequence fragment of 19 Nucleotide.
13. comprise the liposome of claim 9 or 10 described expression vectors.
14. any one described dna sequence dna and sequence fragment with 19 Nucleotide thereof are used to prepare the application of the medicine of anti HBV infecting and diagnosis of hepatitis b, treatment and prevention in the claim 1 to 4.
15. any one described RNA sequence and sequence fragment with 19 Nucleotide thereof are used to prepare the application of the medicine of anti HBV infecting and diagnosis of hepatitis b, treatment and prevention in the claim 5 to 8.
16. claim 9 or 10 described expression vectors are used to prepare the application of the medicine of anti HBV infecting and diagnosis of hepatitis b, treatment and prevention.
17. any one described liposome is used to prepare the application of the medicine of anti HBV infecting and diagnosis of hepatitis b, treatment and prevention in the claim 11 to 13.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031496970A CN100365009C (en) | 2003-08-06 | 2003-08-06 | Anti HBV infection and hepatitis B-preventing nucleotide sequence and its use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031496970A CN100365009C (en) | 2003-08-06 | 2003-08-06 | Anti HBV infection and hepatitis B-preventing nucleotide sequence and its use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1580070A CN1580070A (en) | 2005-02-16 |
| CN100365009C true CN100365009C (en) | 2008-01-30 |
Family
ID=34579634
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB031496970A Expired - Lifetime CN100365009C (en) | 2003-08-06 | 2003-08-06 | Anti HBV infection and hepatitis B-preventing nucleotide sequence and its use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100365009C (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2019120163A (en) * | 2016-12-13 | 2021-01-15 | Ам Сиенсес Инк | Pharmaceutical composition for the prevention or treatment of hepatitis B |
| SG11201909136PA (en) * | 2017-03-31 | 2019-10-30 | Staidson Beijing Biopharmaceuticals Co Ltd | Shrna expression cassette, polynucleotide sequence carrying the same, and use thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1218056A (en) * | 1997-08-27 | 1999-06-02 | 中国科学院上海生物化学研究所 | Transdeoxyoilnucleotide for inhibiting replication of hepatitis B virus |
-
2003
- 2003-08-06 CN CNB031496970A patent/CN100365009C/en not_active Expired - Lifetime
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1218056A (en) * | 1997-08-27 | 1999-06-02 | 中国科学院上海生物化学研究所 | Transdeoxyoilnucleotide for inhibiting replication of hepatitis B virus |
Non-Patent Citations (1)
| Title |
|---|
| 基因治疗中外源基因的导入. 郭晓红等.生物技术通讯，第14卷第3期. 2003 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1580070A (en) | 2005-02-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5593279B2 (en) | Conserved HBV and HCV sequences useful for gene silencing | |
| Wu et al. | RNA interference-mediated control of hepatitis B virus and emergence of resistant mutant | |
| JP4709545B2 (en) | Modified small interfering RNA molecules and methods of use | |
| JP5934310B2 (en) | HBV and HCV conserved sequences useful for gene silencing | |
| US10982212B2 (en) | Conserved HBV and HCV sequences useful for gene silencing | |
| JP4330797B2 (en) | Ribozyme capable of inhibiting expression of CCR5 receptor | |
| US20040147476A1 (en) | Methods and compositions for inhibiting the function of polynucleotide sequences | |
| Chang et al. | Inhibition of the Epstein–Barr virus lytic cycle by Zta-targeted RNA interference | |
| Maepa et al. | Sustained inhibition of HBV replication in vivo after systemic injection of AAVs encoding artificial antiviral primary microRNAs | |
| US20050043267A1 (en) | Methods and compositions for inhibiting the function of polynucleotide sequences | |
| EP2071030A2 (en) | Oligoribonucleotide or peptide nucleic acid which inhibits action of hepatitis C virus | |
| CN100365009C (en) | Anti HBV infection and hepatitis B-preventing nucleotide sequence and its use | |
| JP2011036250A (en) | One pair of nucleotide sequences for anti-hiv infection and for preventing and treating aids, and application thereof | |
| Feng et al. | Inhibition of hepatitis B virus by hammerhead ribozyme targeted to the poly (A) signal sequence in cultured cells | |
| US20110008885A1 (en) | Linear double-stranded rna molecule interfering with different target genes | |
| Li et al. | Inhibition of murine cytomegalovirus infection in animals by RNase P-associated external guide sequences | |
| Zenke et al. | Development of siRNA expression vector utilizing rock bream β-actin promoter: a potential therapeutic tool against viral infection in fish | |
| Ren et al. | Changes in innate and permissive immune responses after HBV transgenic mouse vaccination and llong-term-siRNA treatment | |
| CN100494380C (en) | A nucleodite sequence of anti-hepatitis virus C infection and preventing and curing hepatitis virus C and its fragment and application | |
| AU2018200873B2 (en) | Conserved HBV and HCV sequences useful for gene silencing | |
| CN116463345A (en) | dsRNA of sodium potassium ATPase alpha gene of litopenaeus vannamei and application thereof | |
| CN115678985A (en) | Application of MARCH5 in identifying susceptibility of pigs to porcine reproductive and respiratory syndrome virus and preparing medicines | |
| Cao et al. | Computer-based siRNA design to hepatitis B virus and its expression vector construction | |
| AU2012202085A1 (en) | Conserved HBV and HCV sequences useful for gene silencing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CX01 | Expiry of patent term |
Granted publication date: 20080130 |
|
| CX01 | Expiry of patent term |