CN100494380C - A nucleodite sequence of anti-hepatitis virus C infection and preventing and curing hepatitis virus C and its fragment and application - Google Patents
A nucleodite sequence of anti-hepatitis virus C infection and preventing and curing hepatitis virus C and its fragment and application Download PDFInfo
- Publication number
- CN100494380C CN100494380C CNB2003101213914A CN200310121391A CN100494380C CN 100494380 C CN100494380 C CN 100494380C CN B2003101213914 A CNB2003101213914 A CN B2003101213914A CN 200310121391 A CN200310121391 A CN 200310121391A CN 100494380 C CN100494380 C CN 100494380C
- Authority
- CN
- China
- Prior art keywords
- sequence
- rna
- hepatitis
- fragment
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
- 241000700605 Viruses Species 0.000 title claims abstract description 37
- 208000006454 hepatitis Diseases 0.000 title claims abstract description 24
- 239000012634 fragment Substances 0.000 title claims description 56
- 208000015181 infectious disease Diseases 0.000 title abstract description 3
- 231100000283 hepatitis Toxicity 0.000 title abstract 2
- 108091032973 (ribonucleotides)n+m Proteins 0.000 claims abstract description 84
- 108020004414 DNA Proteins 0.000 claims abstract description 19
- 238000009396 hybridization Methods 0.000 claims abstract description 7
- 239000002773 nucleotide Substances 0.000 claims description 27
- 125000003729 nucleotide group Chemical group 0.000 claims description 27
- 208000005176 Hepatitis C Diseases 0.000 claims description 22
- 102000040650 (ribonucleotides)n+m Human genes 0.000 claims description 17
- 108020004394 Complementary RNA Proteins 0.000 claims description 11
- 239000003184 complementary RNA Substances 0.000 claims description 11
- 239000013604 expression vector Substances 0.000 claims description 11
- 239000002502 liposome Substances 0.000 claims description 8
- 230000015572 biosynthetic process Effects 0.000 claims description 7
- 230000000295 complement effect Effects 0.000 claims description 7
- 239000013598 vector Substances 0.000 claims description 6
- 238000012986 modification Methods 0.000 claims description 5
- 230000004048 modification Effects 0.000 claims description 5
- 239000003814 drug Substances 0.000 claims description 4
- 238000003745 diagnosis Methods 0.000 claims description 2
- 230000010354 integration Effects 0.000 claims description 2
- 230000002265 prevention Effects 0.000 claims description 2
- 108091028043 Nucleic acid sequence Proteins 0.000 abstract description 42
- 230000014509 gene expression Effects 0.000 abstract description 34
- 239000013612 plasmid Substances 0.000 abstract description 27
- 108090000623 proteins and genes Proteins 0.000 abstract description 27
- 241000701161 unidentified adenovirus Species 0.000 abstract 1
- 210000004027 cell Anatomy 0.000 description 19
- 239000005090 green fluorescent protein Substances 0.000 description 11
- 230000002452 interceptive effect Effects 0.000 description 9
- 101150013191 E gene Proteins 0.000 description 8
- 238000000034 method Methods 0.000 description 8
- 238000012360 testing method Methods 0.000 description 8
- 230000004927 fusion Effects 0.000 description 7
- 102000004190 Enzymes Human genes 0.000 description 6
- 108090000790 Enzymes Proteins 0.000 description 6
- 241000711557 Hepacivirus Species 0.000 description 6
- 206010019799 Hepatitis viral Diseases 0.000 description 6
- 238000000137 annealing Methods 0.000 description 6
- 238000013467 fragmentation Methods 0.000 description 6
- 238000006062 fragmentation reaction Methods 0.000 description 6
- 108020001507 fusion proteins Proteins 0.000 description 5
- 230000003321 amplification Effects 0.000 description 4
- 238000013461 design Methods 0.000 description 4
- 238000003199 nucleic acid amplification method Methods 0.000 description 4
- 239000006144 Dulbecco’s modified Eagle's medium Substances 0.000 description 3
- 230000000694 effects Effects 0.000 description 3
- 238000002474 experimental method Methods 0.000 description 3
- 238000009413 insulation Methods 0.000 description 3
- 108020004999 messenger RNA Proteins 0.000 description 3
- 239000013600 plasmid vector Substances 0.000 description 3
- 239000000047 product Substances 0.000 description 3
- 102000004169 proteins and genes Human genes 0.000 description 3
- 238000001890 transfection Methods 0.000 description 3
- 241000702421 Dependoparvovirus Species 0.000 description 2
- 241000588724 Escherichia coli Species 0.000 description 2
- 241000711549 Hepacivirus C Species 0.000 description 2
- 102000006382 Ribonucleases Human genes 0.000 description 2
- 108010083644 Ribonucleases Proteins 0.000 description 2
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 2
- 101710172711 Structural protein Proteins 0.000 description 2
- 238000006243 chemical reaction Methods 0.000 description 2
- 108091036078 conserved sequence Proteins 0.000 description 2
- 238000000605 extraction Methods 0.000 description 2
- 230000008676 import Effects 0.000 description 2
- 230000003834 intracellular effect Effects 0.000 description 2
- 239000007788 liquid Substances 0.000 description 2
- 238000002360 preparation method Methods 0.000 description 2
- 230000008521 reorganization Effects 0.000 description 2
- 238000010839 reverse transcription Methods 0.000 description 2
- 239000000243 solution Substances 0.000 description 2
- 239000006228 supernatant Substances 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 0 CCC(*C)C(CC1)CC2C1*(*C)C2 Chemical compound CCC(*C)C(CC1)CC2C1*(*C)C2 0.000 description 1
- 102000007260 Deoxyribonuclease I Human genes 0.000 description 1
- 108010008532 Deoxyribonuclease I Proteins 0.000 description 1
- 101150066002 GFP gene Proteins 0.000 description 1
- 108700039691 Genetic Promoter Regions Proteins 0.000 description 1
- 108010043121 Green Fluorescent Proteins Proteins 0.000 description 1
- 108700008783 Hepatitis C virus E1 Proteins 0.000 description 1
- 108091027305 Heteroduplex Proteins 0.000 description 1
- 108091092195 Intron Proteins 0.000 description 1
- 108091026898 Leader sequence (mRNA) Proteins 0.000 description 1
- 208000008771 Lymphadenopathy Diseases 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 108091005804 Peptidases Proteins 0.000 description 1
- 108010076039 Polyproteins Proteins 0.000 description 1
- 239000004365 Protease Substances 0.000 description 1
- 108091030071 RNAI Proteins 0.000 description 1
- 102100037486 Reverse transcriptase/ribonuclease H Human genes 0.000 description 1
- 238000012300 Sequence Analysis Methods 0.000 description 1
- 230000009471 action Effects 0.000 description 1
- 208000013228 adenopathy Diseases 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000002155 anti-virotic effect Effects 0.000 description 1
- 238000013459 approach Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000008901 benefit Effects 0.000 description 1
- 230000033228 biological regulation Effects 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 239000007795 chemical reaction product Substances 0.000 description 1
- 239000003795 chemical substances by application Substances 0.000 description 1
- 230000004087 circulation Effects 0.000 description 1
- 238000010276 construction Methods 0.000 description 1
- 230000001276 controlling effect Effects 0.000 description 1
- 238000005336 cracking Methods 0.000 description 1
- 230000001186 cumulative effect Effects 0.000 description 1
- 238000005520 cutting process Methods 0.000 description 1
- 239000008367 deionised water Substances 0.000 description 1
- 229910021641 deionized water Inorganic materials 0.000 description 1
- 230000029087 digestion Effects 0.000 description 1
- 238000010790 dilution Methods 0.000 description 1
- 239000012895 dilution Substances 0.000 description 1
- 241001493065 dsRNA viruses Species 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 210000003527 eukaryotic cell Anatomy 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 102000037865 fusion proteins Human genes 0.000 description 1
- 230000009368 gene silencing by RNA Effects 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 238000010353 genetic engineering Methods 0.000 description 1
- 238000010438 heat treatment Methods 0.000 description 1
- 208000010710 hepatitis C virus infection Diseases 0.000 description 1
- 238000001727 in vivo Methods 0.000 description 1
- 230000005764 inhibitory process Effects 0.000 description 1
- 208000019423 liver disease Diseases 0.000 description 1
- 210000004962 mammalian cell Anatomy 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 238000010369 molecular cloning Methods 0.000 description 1
- 238000001821 nucleic acid purification Methods 0.000 description 1
- 235000015097 nutrients Nutrition 0.000 description 1
- 238000013326 plasmid cotransfection Methods 0.000 description 1
- 210000002706 plastid Anatomy 0.000 description 1
- 238000002264 polyacrylamide gel electrophoresis Methods 0.000 description 1
- 239000002243 precursor Substances 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 230000009467 reduction Effects 0.000 description 1
- 230000001105 regulatory effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 230000001177 retroviral effect Effects 0.000 description 1
- 210000002966 serum Anatomy 0.000 description 1
- 108091069025 single-strand RNA Proteins 0.000 description 1
- 239000011780 sodium chloride Substances 0.000 description 1
- 238000013518 transcription Methods 0.000 description 1
- 230000035897 transcription Effects 0.000 description 1
- 239000012096 transfection reagent Substances 0.000 description 1
- 230000003612 virological effect Effects 0.000 description 1
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a RNA sequence of anti-hepatitis virus C infection and preventing and curing hepatitis virus C and its segment. The said sequence and its segment are double chain RNA sequence formed by hybridization of single chain RNA sequence and its segment indicated in SEQ ID NO:1 -SEQ ID NO:6 in sequence list, or the said single chain RNA sequence and its segment or its complemented sequence and its segment. A series of RNA sequences high homologous with published HCV sequence are obtained by homologous comparation and the expression of HCV gene can be effectively restrained using the double chain RNA sequence derived by the said series of RNA sequences. The series of RNA transcripted by plasmid can also restrain the expression of HCV gene in cell. Adenovirus carrying the corresponding DNA of the said segment can be transcripted into the corresponding double chain RNA to restrain the expression of HCV gene after infecting cell.
Description
Technical field
The present invention relates to nucleotide sequence, its fragment and application thereof that one group of anti-hepatitis c virus (HCV) infects and prevent and treat hepatitis C, belong to the viral genetic engineering field.
Background technology
Nearly 2 years result of study confirms that short double-stranded RNA has the RNA interfering function in multiple mammalian cell, can special inhibition specific gene in intracellular expression.Also can suppress virus (comprising HCV virus) gene in intracellular expression by this approach.But because HCV virus has great variability, present employed sequence all only with minority HCV strain sequence homology, therefore can not use as general efficient gene medicine.
Summary of the invention
The purpose of this invention is to provide one group of anti-HCV infection and prevent and treat the nucleotide sequence of hepatitis C.
Another object of the present invention provides the application of above-mentioned nucleotide sequence.
For achieving the above object, the present invention is by the following technical solutions:
One group of anti-hepatitis c virus infects and prevents and treats the RNA sequence and the fragment thereof of hepatitis C, and this sequence and fragment thereof are the double-stranded RNA sequence of the described single stranded RNA sequence of SEQ ID NO:1-SEQ ID NO:6 and fragment thereof or this single stranded RNA sequence and fragment thereof and its complementary sequence and fragment hybridization formation thereof in the sequence table.The present invention by homology relatively obtains a series ofly to have delivered nucleotide sequence conservative especially between the hepatitis C virus strain at all, behind this RNA sequence transfered cell, can cause special mRNA degraded, thereby reduce HCV genetic expression and cause genome to be degraded.The resistance problem that the medicine that uses this sequence to develop can avoid due to illness virus gene sudden change to bring.
This single stranded RNA sequence is as follows:
1)CCCCCCCUCCCGGGAGAGCCAUAGU；
2)CGGAACCGGUGAGUACACCG；
3)GCGAAAGGCCUUGUGGUACUGCCUGAUAGG；
4)GCUUGCGAGUGCCCCGGGAGGUCUCGUAGACCGUG；
5)UGGGUAARGUCAUCGAYACCCU；
Wherein R is G or A, and Y is U or C;
6)AUGGCWUGGGAYAUGAUGAUGAAYUGGU
Wherein W is U or A, and Y is U or C.
Fragment is meant any part that is not less than 19bp of described sequence.
Described RNA sequence and fragment thereof are added with nucleotide modification at its 5 ' end or 3 ' end.Common modification adds UU as 3 ends at synthetic RNA, is beneficial to correct pairing.
One group of anti-hepatitis c virus infects and prevents and treats the RNA sequence of hepatitis C, and this sequence is the described single stranded RNA sequence of SEQ ID NO:1-SEQ ID NO:6 and fragment thereof and form complementary double-stranded of complementary RNA sequence and fragment thereof or for the described single stranded RNA sequence of SEQ ID NO:1-SEQ ID NO:6 in the sequence table and fragment thereof with complementary RNA sequence and fragment thereof add the hair clip sample RNA sequence of middle incomplementarity catenation sequence formation with it with it in the sequence table.Hair clip sample two strands has the identical activity of RNA interfering, owing to be that a RNA chain pairing forms, therefore is particularly useful for the cell inner expression RNA interfering.
One group of anti-hepatitis c virus infects and prevents and treats the dna sequence dna and the fragment thereof of hepatitis C:
1) described single stranded RNA sequence of SEQ ID NO:1-6 and fragment thereof or this single stranded RNA sequence and fragment thereof are corresponding with the double-stranded RNA sequence that its complementary sequence and fragment thereof form in this dna sequence dna and fragment thereof and the sequence table; Or
2) this dna sequence dna and fragment thereof and 1) described RNA sequence and fragment thereof be corresponding in the sequence that its 5 ' end or 3 ' end are added with nucleotide modification; Or
3) in this dna sequence dna and fragment thereof and the sequence table described single stranded RNA sequence of SEQ ID NO:1-SEQ ID NO:6 and fragment thereof and with it in the heteroduplex RNA sequence that forms of complementary RNA sequence and fragment thereof or the sequence table described single stranded RNA sequence of SEQ ID NO:1-SEQ ID NO:6 and fragment thereof and in the middle of complementary RNA sequence and fragment thereof add with it the hair clip sample RNA sequence of incomplementarity catenation sequence formation corresponding.
A kind of anti-hepatitis c virus infects and prevents and treats the expression vector of hepatitis C, and this vector integration has above-described RNA or dna sequence dna and fragment thereof.Can express RNA interfering behind regulating and controlling sequence that these sequences and fragment thereof are building up in the suitable expression vector, adding is suitable and the transfered cell.Expression vector comprises rna expression carrier and DNA expression vector.Rna expression carrier such as retroviral vector, DNA expression vector are meant the plasmid vector that carries described dna sequence dna and other expression regulation sequences, virus vector etc., as adeno-associated virus (AAV).
A kind of anti-hepatitis c virus infects and prevents and treats the liposome of hepatitis C, and this liposome has above-described RNA or dna sequence dna and fragment thereof or is enclosed with above-mentioned anti-hepatitis c virus infection and prevents and treats the expression vector of hepatitis C.Use this lipoid plastid RNA interfering maybe can be able to be expressed the plasmid vector transfered cell of RNA interfering.
A kind of anti-hepatitis c virus infects and prevents and treats the method for hepatitis C, is with above-described RNA or dna sequence dna and fragment thereof or expression vector or liposome in vivo or external importing eukaryotic cell lines, zooblast and human body.The for example method that imports by liposome, the method that imports by virus vector.
A kind of anti-hepatitis c virus infects and prevents and treats the application of the nucleotide sequence of hepatitis C, and above-described RNA or dna sequence dna and fragment thereof or expression vector or liposome or method are applied to prepare the medicine that anti-hepatitis c virus infects and prevent and treat diagnosis, treatment and the prevention of hepatitis C.
Advantage of the present invention is: by homology relatively, obtain a series of and all HCV sequence height homologous RNA sequence fragments of having delivered, use this series fragment deutero-double-stranded RNA sequence can suppress the HCV expression of gene effectively; This series RNA that uses plasmid to transcribe also can suppress the HCV expression of gene in cell; Can transcribe out corresponding double chain RNA and suppress the HCV expression of gene after carrying the adeno-associated virus cells infected of this fragment corresponding DNA.
The present invention is further illustrated below in conjunction with the drawings and specific embodiments.
Description of drawings
Fig. 1 is the design of graphics of reporter plasmid pHCV-GFP.
Fig. 2 is the design of graphics of the plasmid pH1-HCV-E1 of the inner double-stranded RNA of expression.
Fig. 3 is the design of graphics of plasmid pAAV-HCVE1.
Fig. 4 detects by fluorescent microscope, shows that RNAi can effectively reduce the proteic expression of hepatitis C virus E.
Embodiment
The method that adopts among the embodiment is this area routine operation, sees " molecular cloning " third edition for details.
Embodiment 1: the acquisition of extremely conservative HCV RNA sequence
All HCV whole genome sequences that selection has been delivered use 1.83 editions softwares of Clustal X to compare one by one, obtain the highest sequence of homology between sequences.Select the nucleotide sequence that meets following condition: (1) this fragment is more than or equal to 19 Nucleotide; (2) this fragment complete homology in the HCV sequence that is compared, or wherein only have the 1-2 base that a kind of variant form is arranged; The sequence that is obtained sees Table 1, wherein No. 3 fragments and the complete homology of all sequences of delivering.
Extremely conservative RNA sequence in the HCV sequence that table 1. is relatively found by homology
| Numbering | The HCV gene | The RNA sequence |
| 1 | UTR | CCCCCCCUCCCGGGAGAGCCAUAGU |
| 2 | UTR | CGGAACCGGUGAGUACACCG |
| 3 | UTR | GCGAAAGGCCUUGUGGUACUGCCUGAUAGG |
| 4 | UTR | GCUUGCGAGUGCCCCGGGAGGUCUCGUAGACCGUG |
| 5 | C | UGGGUAARGUCAUCGAYACCCU; Wherein R is G or A, and Y is U or C |
| 6 | E1 | AUGGCWUGGGAYAUGAUGAUGAAYUGGU wherein W is U or A, and Y is U or C |
The RNA two strands that embodiment 2. uses synthetic E gene pairs to answer reduces the expression of HCV polyprotein
HCV is a single strand RNA virus, and its genome is about 9000 Nucleotide, and the poly precursor protein of only encoding, this albumen form structural protein and the Nonstructural Protein of HCV through protease cracking.Therefore as long as mRNA degrades, all structural protein and the expression level of Nonstructural Protein all can reduce.In order to clone conveniently, we have made up and have contained HCV N end group because of (5 ' UTR, c gene, E gene) and GFP gene Fusion gene, can be in cell the fusion rotein of expression of HCV gene green fluorescent protein, as the reporter plasmid of the present invention's research, construction process is as follows:
1. design of primers: according to HCV (NC_004102) gene order, designed two groups of primers, first group of primer amplification HCV5 ' end structure gene and nonstructural gene, second group of primer be used to increase non-structural area gene of HCV3 ' end.
HCV5A：GCGACACTCCACCATAGATCAC
HCV5B：TGGGATATGATGATGAACTGGT
Get the third hepatopathy human serum 5ml, with the RNA of QIAgen company extraction agent box extracting RNA (seeing the test kit specification sheets), add each 100ng of HCV5B primer, carry out reverse transcription with Promega Sensiscript reverse transcription test kit, each 5 μ l of negate transcription product, add primer HCV5A100ng, use the Roche Expand of company long segment PCR test kit at the enterprising performing PCR amplification of PE company 9700 type PCR instrument (amplification condition: 94 ℃ of 40s, 50 ℃ of 40s, 72 ℃ of 2min), the back 72 ℃ of insulations of amplification 35 circulations 20 minutes add Taq enzyme (2.5 units, QIAGEN company product) and continue insulation 30 minutes.Amplified production shows through electrophoresis and has obtained the 1.2kbDNA segment.Standby behind the nucleic acid purification test kit purifying with QIAGEN company.
Get the pcDNA3.1/CT-GFP-TOPO carrier of 100ng Invitrogen company, add above-mentioned fragment 200ng, reaction is 5 minutes in the reaction system that TOPO test kit (Invitrogen company) provides, get 5 μ l reaction product, add in the 50 μ l One Shot TOP10 competent escherichia coli cells, ice bath 30 minutes, 42 ℃ are activated 45 seconds, add 1ml SOC substratum, 37 ℃ of 250rpm cultivate after 45 minutes and are coated with the amicillin resistance flat board, extracting plasmid (QIAGEN test kit) behind the acquisition transformant, enzyme is cut evaluation and correct through dna sequence analysis, obtains reporter plasmid pHCV-GFP.Use the MAXIPrep plasmid extraction test kit extracting capacity plasmid standby (Fig. 1) of QIAGEN company.
According to the RNA fragment of above-mentioned HCV E gene conservative sequence (No. 6 sequences in the table 1) 19 Nucleotide complementary RNA chain, add UU at RNA chain 3 ' end and modify according to synthetic this chain of principle of complementarity:
5’ ggauaugaugaugaacugguu
3’uuccuauacuacuacuugacc
Each 1 μ g of above-mentioned synthetic RNA chain adds 1 μ l annealing buffer (10mmol/LTrisHCl (PH7.4), 100mmol/L NaCl), add do not contain RNase deionized water to cumulative volume 10 μ l.90 ℃ of heating, 25 ℃ of insulation 1h after 5 minutes get RNA two strands after the 2 μ g annealing, after 30 minutes, differentiate the formation situation of double-stranded RNA through the special RNase of 4 IU single stranded RNAs and 37 ℃ of digestion of DNase I with polyacrylamide gel electrophoresis.Found that the 20bp place has a single RNA band to occur.Illustrate that two complementary RNA strands of synthetic have hybridized into the RNA two strands.
Get two test tubes respectively, the DMEM substratum that all adds the 1.5ml antibiotic-free in every arm, 2 μ g plasmid pHCV-GFP, add 2 μ g synthetic double-stranded RNAs and 2 μ g synthetic single stranded RNAs then respectively and be contrast, the an amount of Oligofectamine transfection reagent (Invitrogen company product) that respectively adds 1.5ml antibiotic-free DMEM dilution was then placed 20 minutes in the room temperature behind the slight mixing.Transfection liquid is joined in the HEK293 cell that is cultured to 80% density transfectional cell 6 hours.Discard transfection liquid, add the DMEM nutrient solution that contains 10%FCS, continue to cultivate 72 hours.Under fluorescent microscope, observe the expression amount of GFP.
The result: as shown in Figure 4, and compare, the double-stranded RNA of E gene specific significantly reduces the expression output of total GFP of fusion rotein; Repeat this experiment twice, the result is all consistent.
The RNA two strands that embodiment 3. uses synthetic c gene pairs to answer reduces Expression of Fusion Protein in the reporter plasmid.
According to the RNA segment of above-mentioned HCV c gene conservative sequence (No. 5 sequences in the table 1) 19 Nucleotide, and, add UU at RNA chain 3 ' end and modify according to the complementary RNA chain of synthetic this chain of principle of complementarity:
5’ uggguaaggucaucgauacuu
3’uuacccauuccaguagcuaug
Each 1 μ g of above-mentioned synthetic RNA chain, as embodiment 2 annealing, rotaring redyeing 293 cell was cultivated 72 hours.Under fluorescent microscope, observe the expression amount of GFP.
The result: with compare, the double-stranded RNA of E gene specific significantly reduces the expression output of total GFP of fusion rotein; Repeat this experiment twice, the result is all consistent.
Embodiment 4. uses the RNA two strands of synthetic UTR correspondence, reduces Expression of Fusion Protein in the reporter plasmid.
Because the RNA interfering of UTR correspondence can cause the degraded of virus genome RNA and mRNA, thereby has antivirus action.In the system of embodiment 2, can cause the expression amount of the fusion gene in its downstream to reduce, thereby checking is at the effect of the RNA interfering of non-translational region for another example.
According to the RNA segment of above-mentioned HCV c gene conservative sequence (No. 4 sequences in the table 1) 19 Nucleotide, and, add UU at RNA chain 3 ' end and modify according to the complementary RNA chain of synthetic this chain of principle of complementarity:
5’ ggaggucucguagaccguguu
3’uuccuccagagcaucuggcac
Each 1 μ g of above-mentioned synthetic RNA chain, as embodiment 2 annealing, rotaring redyeing 293 cell was cultivated 72 hours.Under fluorescent microscope, observe the expression amount of GFP.
The result: with compare, the double-stranded RNA of E gene specific significantly reduces the expression output of total GFP of fusion rotein; Repeat this experiment twice, the result is all consistent.
Embodiment 5, synthetic dna fragmentation and the hybridization sequences thereof that contains E gene conserved sequence correspondence are cloned into carrier for expression of eukaryon, in the cell inner expression RNA interfering, suppress the expression of HCV membranin
The synthetic dna segment that contains corresponding dna fragmentation of E gene conserved sequence (No. 6 sequences in the table 1) and hybridization sequences (black italic) thereof, the annealing back forms dna fragmentation, 5 ' end is the end in BamHI site, 3 ' end is the end in HindIII site, contains intervening sequence in the middle of homologous sequence and complementary sequence thereof.B is the complementary sequence of A:
A：5’gatccccggatatgatgatgaactggttcaagagaccagttcatcatcatatcctttttggaaa
B：5’agcttttccaaaaaggatatgatgatgaactggtctcttgaaccagttcatcatcatatccggg
As shown in Figure 2, (with human gene group DNA 1 μ g is template by PCR, primer 15 '-TAATTAATGCGGCCGCAATTCGAACGCTGACGTC-3 ', primer 25 '-GCACTAGTAAGCTTGGATCCGTGGTCTCATACAGAACTTATAAGATTCCC-3 ', amplification condition is with embodiment 2) obtain the promoter region of people H1RNA gene, plasmid pEGFPC1 (Clontech) reclaims big fragment as carrier after using AseI and XbaI enzyme cutting, above-mentioned amplified fragments is cut the back with AseI and SpeI enzyme and is reclaimed, be connected with carrier, obtain plasmid pH1 behind the transformed into escherichia coli.(A, B) the annealing rear clone makes up plasmid pH1-HCVE1 to the BamHI and the HindIII site of pH1 plasmid with above-mentioned synthetic dna fragmentation.This plasmid under the effect of rna plymerase iii, is expressed hair clip shape RNA in cell, form the RNA two strands.
With 4 μ g pH1-HCVE1 plasmids (using in contrast) and the plasmid co-transfection HEK293 cell of expressing GFP-HCV5 ' fusion rotein with amount pH1 plasmid, by the difference of the comparison of method as described in embodiment 2 Expression of Fusion Protein output, the result shows that GFP-HCV Expression of Fusion Protein output has remarkable reduction; The dna sequence dna that this presentation of results uses plasmid vector to carry the above-mentioned RNA of coding can effectively suppress the HCV target gene expression.
Embodiment 6. uses adenopathy adjoint virus carrier, carries the dna fragmentation of the H1 promotor as described in example 3 above and the hair clip shape double-stranded RNA of encoding, and suppresses HCV E expression of gene behind the recombinant virus-infected cell.
As shown in Figure 3, plasmid pAAV-MCS (purchasing in Stratagene) cuts with NotI and HindIII enzyme; The dna fragmentation that contains the hair clip shape RNA of H1 promotor and coding HCV E1 is cut acquisition with NotI and HindII enzyme from plasmid pHI-HCVE1, and be cloned into the corresponding site of pAAV-MCS. make up plasmid pAAV-HCVE1, with this plasmid (4 μ g) (contrast virus vector pAAV-MCS) and helper plasmid pHelper (1 μ g, Stratagene) and plasmid pAAV-RC (2 μ g Stratagene) reinstate LIPOFECTamine method cotransfection HEK293FT cell, get supernatant preparation " reorganization A A V virus " and contrast virus after 48 hours; With the plasmid transfection HEK293 cell of pHCV-GFP (1 μ g), add the above-mentioned preparation supernatant that contains recombinant virus then, use GFP luminous intensity in the fluorescent microscope analysis of cells after 24 hours.
The result shows that carrying the reorganization AAV virus that can transcribe HCV HCVE1 hair clip sample double-stranded RNA can make GFP-HCV-5 expressing fusion protein level significantly reduce as shown in Figure 4.
Sequence table
＜110〉Beijing Sannuojiayi Biotechnology Co., Ltd
＜120〉one group of anti-hepatitis c virus infects and prevents and treats nucleotide sequence, its fragment and the application thereof of hepatitis C
<130>
<160>6
<170>Patent In version 3.1
<210>1
<211>25
<212>RNA
＜213〉Hepacivirus (virus hepatitis C)
<400>1
<210>2
<211>20
<212>RNA
＜213〉Hepacivirus (virus hepatitis C)
<400>2
<210>3
<211>30
<212>RNA
＜213〉Hepacivirus (virus hepatitis C)
<400>3
<210>4
<211>35
<212>RNA
＜213〉Hepacivirus (virus hepatitis C)
<400>4
<210>5
<211>22
<212>RNA
＜213〉Hepacivirus (virus hepatitis C)
<220>
<221>misc_RNA
<222>(8)
＜223〉R=G or A
<220>
<221>misc_RNA
<222>(17)
＜223〉Y=U or C
<400>5
<210>6
<211>28
<212>RNA
＜213〉Hepacivirus (virus hepatitis C)
<220>
<221>misc_RNA
<222>(6)
＜223〉W=U or A
<220>
<221>misc_RNA
<222>(12，24)
＜223〉Y=U or C
<400>6
Claims (7)
1. one group of anti-hepatitis c virus infects and prevents and treats the RNA of hepatitis C, it is characterized in that: this RNA is that one of described single stranded RNA of SEQ ID No:1 one SEQ ID No:6 or its have one of the sequence fragment of 19 Nucleotide or this single stranded RNA or it has the sequence fragment of 19 Nucleotide and the double-stranded RNA of its complementary sequence or its fragment hybridization formation in the sequence table.
2. one group of anti-hepatitis c virus according to claim 1 infects and prevents and treats the RNA of hepatitis C, it is characterized in that: the sequence fragment that one of described single stranded RNA or its have 19 Nucleotide is added with nucleotide modification at its 5 ' end or 3 ' end.
3. one group of anti-hepatitis c virus infects and prevents and treats the RNA of hepatitis C, it is characterized in that: this RNA is that one of described single stranded RNA of SEQ ID No:1 one SEQ ID No:6 or its have the sequence fragment of 19 Nucleotide and the hair clip sample RNA of incomplementarity catenation sequence formation in the middle of complementary RNA or its fragment add with it in the sequence table.
4. one group of anti-hepatitis c virus infects and prevents and treats the DNA of hepatitis C, it is characterized in that:
1) this DNA transcribes out one of SEQ ID No:1 one 6 described single stranded RNAs in the sequence table or its and has the double-stranded RNA sequence that sequence fragment that one of the sequence fragment of 19 Nucleotide or this single stranded RNA or its have 19 Nucleotide and its complementary sequence or the hybridization of its fragment form: or
2) this DNA can transcribe out 1) one of described single stranded RNA or its sequence fragment with 19 Nucleotide be added with the sequence of nucleotide modification at its 5 ' end or 3 ' end; Or
3) this DNA transcribes out the hair clip sample RNA of incomplementarity catenation sequence formation in the middle of one of SEQ ID No:1-described single stranded RNA of SEQ ID No:6 in the incomplementarity catenation sequence forms in the middle of one of described single stranded RNA of SEQ ID No:1 one SEQ ID No:6 in the sequence table or its have the sequence fragment of 19 nucleotides and complementary RNA or its fragment add with it hair clip sample RNA or the sequence table or its have the sequence fragment of 19 nucleotides and the double-stranded RNA that forms of complementary RNA or the hybridization of its fragment adds with it.
5. an anti-hepatitis c virus infects and prevents and treats the expression vector of hepatitis C, it is characterized in that: this vector integration have the right any one described RNA or DNA in the requirement 1 to 4.
6. an anti-hepatitis c virus infects and prevents and treats the liposome of hepatitis C, it is characterized in that: this liposome have the right in the requirement 1 to 4 any one described RNA or DNA or be enclosed with the described anti-hepatitis c virus of claim 5 and infect and prevent and treat the expression vector of hepatitis C.
7. an anti-hepatitis c virus infects and prevents and treats the application of the nucleotide sequence of hepatitis C, it is characterized in that: any one described RNA or DNA in the claim 1 to 4 or the described expression vector of claim 5 or the described liposome of claim 6 are applied to prepare anti-hepatitis c virus infect and prevent and treat application in the medicine of diagnosis, treatment and prevention of hepatitis C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2003101213914A CN100494380C (en) | 2003-09-16 | 2003-12-16 | A nucleodite sequence of anti-hepatitis virus C infection and preventing and curing hepatitis virus C and its fragment and application |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN03157149.2 | 2003-09-16 | ||
| CN03157149 | 2003-09-16 | ||
| CNB2003101213914A CN100494380C (en) | 2003-09-16 | 2003-12-16 | A nucleodite sequence of anti-hepatitis virus C infection and preventing and curing hepatitis virus C and its fragment and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1597957A CN1597957A (en) | 2005-03-23 |
| CN100494380C true CN100494380C (en) | 2009-06-03 |
Family
ID=34679661
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2003101213914A Expired - Lifetime CN100494380C (en) | 2003-09-16 | 2003-12-16 | A nucleodite sequence of anti-hepatitis virus C infection and preventing and curing hepatitis virus C and its fragment and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100494380C (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110115770B (en) * | 2019-04-09 | 2023-05-26 | 广州艾迪基因科技有限责任公司 | Novel target for preventing and treating viral hepatitis C, CRISPR-Cas9 targeting system and application thereof |
-
2003
- 2003-12-16 CN CNB2003101213914A patent/CN100494380C/en not_active Expired - Lifetime
Also Published As
| Publication number | Publication date |
|---|---|
| CN1597957A (en) | 2005-03-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2172549B1 (en) | RNAi expression constructs | |
| US20180179526A1 (en) | Method and Medicament For Inhibiting The Expression of A Given Gene | |
| US8927519B2 (en) | Methods for producing interfering RNA molecules in mammalian cells and therapeutic uses for such molecules | |
| JP4330797B2 (en) | Ribozyme capable of inhibiting expression of CCR5 receptor | |
| US7829693B2 (en) | Compositions and methods for inhibiting expression of a target gene | |
| CN102575252A (en) | Polynucleotides for multivalent RNA interference, compositions and methods of use thereof | |
| CN110959042B (en) | Novel small activating RNA | |
| EP2164965B1 (en) | A primary micro rna expression cassette | |
| ZA200601368B (en) | A self-processing RNA expression cassette | |
| JP2010532163A5 (en) | ||
| EP2071030A2 (en) | Oligoribonucleotide or peptide nucleic acid which inhibits action of hepatitis C virus | |
| RU2385939C1 (en) | Genetic makers attacking six new rna interference targets in transcripts of human immunodeficiency virus type 1 and suppressing virus reproduction in human cells | |
| CN100494380C (en) | A nucleodite sequence of anti-hepatitis virus C infection and preventing and curing hepatitis virus C and its fragment and application | |
| US20110008885A1 (en) | Linear double-stranded rna molecule interfering with different target genes | |
| EP2246357B1 (en) | Oligonucleotides against HIV infection and its application in the prevention and treatment of acquired immune deficiency syndrome | |
| JP2006500017A (en) | Adenoviral VA1 PolIII expression system for RNA expression | |
| CN100365009C (en) | Anti HBV infection and hepatitis B-preventing nucleotide sequence and its use | |
| JP4228071B2 (en) | Double-stranded oligonucleotide capable of suppressing hepatitis C virus protein synthesis and / or hepatitis C virus replication |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CX01 | Expiry of patent term | ||
| CX01 | Expiry of patent term |
Granted publication date: 20090603 |