CN101063101A - Cattle lactoferrin engineering bacterium and preparation method for antibiotic peptide cattle lactoferrin - Google Patents
Cattle lactoferrin engineering bacterium and preparation method for antibiotic peptide cattle lactoferrin Download PDFInfo
- Publication number
- CN101063101A CN101063101A CNA2006101665366A CN200610166536A CN101063101A CN 101063101 A CN101063101 A CN 101063101A CN A2006101665366 A CNA2006101665366 A CN A2006101665366A CN 200610166536 A CN200610166536 A CN 200610166536A CN 101063101 A CN101063101 A CN 101063101A
- Authority
- CN
- China
- Prior art keywords
- cipb
- bovinelactoferrin
- blfcin
- ampin
- tzr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a cow milk ferroprotein engineering bacterium CCTCC NO: M206132 and a preparing method of antibiotic peptide cow milk ferroprotein element, which comprises the following steps: resuscitating engineering bacterium photorhabdus luminescens TZR+ expressing plasmid pBAD-CipB-BLfcin-Ampin on LB flat; choosing monoclonal from LB medium; seeding medium photorhabdus luminescens TZR+ pBAD-CipB-BLfcin-Ampin in LB medium; inducing; centrifuging; collecting cell; hanging load the cell with solution I; transferring into new centrifuge tube; eccentric-collecting cell; cryolysis-splitting cell; property-separating CipB blend lactoferrin element; adding into parenzyme; enzymolyzing CipB blend cow milk lactoferrin element; delivering pure cow milk ferroprotein element; getting the product. This invention possesses highly effective expression and cheap cost.
Description
Technical field
The present invention relates to biological technical field, more specifically relate to a kind of Bovinelactoferrin engineering bacteria, also relate to the method that the Bovinelactoferrin engineering bacteria prepares antibacterial peptide cow's milk protein element simultaneously, this antibacterial peptide is widely used in the animal-feed.
Background technology
Horoaki etc. (1991) are at research deferrization Bovinelactoferrin (lactoferrin, during LfB) thermostability, degraded has obviously taken place in discovery LfB under acidic conditions, yet its anti-microbial activity increases on the contrary to some extent, so infer among the Lf and have heat-stable Antimicrobially active polypeptides, it is activity stabilized under the acidic conditions, but unstable in neutrality or the alkaline environment.Tomita etc. (1991) have studied the antibacterial effect of the hydrolyzate of protease of LfB, and the result shows that the micromolecule polypeptide that the pig trypsin hydrolyzing obtains has stronger anti-microbial effect, its anti-microbial activity be before not degrading more than 20 times.After this, Bellamy etc. (1992) are separated to a near polypeptide lactoferrin N-end, have the anti-microbial activity stronger more than 400 times than Lf, are named as Bovinelactoferrin element (BLactoferricin, LfcinB), another active centre of lactoferrin is Ampin.Owing to from natural cow's milk, separate the plain cost height of Bovinelactoferrin, can't realize that it commercially produces, and the basic restraining factors of utilizing genetic engineering technique to produce the Bovinelactoferrin element at present are that expression product is strong to host's suicide effect, expression level is low.There are research report photorhabdus luminescensin gene C ipA and the coded crystallin of CipB to account for 40% (Bowen and Ensign of total cell protein, 2001), the easy cracking of photorhabdus luminescensin simultaneously, the coded crystallin of CipA and CipB does not dissolve under pH 5-11, but under pH 2-3, dissolve, therefore utilize the more easily separated purifying of this property.Therefore this research is imagined by two Bovinelactoferrin active centre LfcinB and Ampin and CipB amalgamation and expression and is solved LfcinB to this difficult problem of host's suicide effect.
Summary of the invention
The object of the present invention is to provide a kind of Bovinelactoferrin engineering bacteria, the easy cracking of this project bacterium, the novel antibacterial peptide Bovinelactoferrin element of production is the expression amount height not only, has efficient, broad-spectrum antimicrobial, antiviral, anti-oxidant and regulate biologic activity such as immunity.
Another object of the present invention is to provide a kind of Bovinelactoferrin engineering bacteria to prepare the method for antibacterial peptide Bovinelactoferrin element, and is easy to implement the method, easy and simple to handle, efficiently expresses, with low cost, and this antibacterial peptide Bovinelactoferrin element has the high-efficiency broad spectrum anti-microbial activity.
In order to achieve the above object, the present invention adopts following technical measures:
A kind of preparation method of Bovinelactoferrin engineering bacteria is as follows:
Material requested is:
Wild-type photorhabdus luminescens subsp.akhurstii: available from German biomaterial resource center (is the German Resource Centre for Biological Material, DSMZwww.dsmz.de).TOPO TA clones test kit: available from Invitrogen company (www.invitrogen.com).Red/ET test kit, pBAD24, Gentamycin and Apramycin resistant gene template are provided by German gene brigdes company (www.genebrigdes.com).
Photorhabdus luminescens subsp.Akhurstii and intestinal bacteria GB2005 substratum are the LB substratum, and its moiety is: yeast extract 5g; Peptone 10g; NaCl 5g; Add water 900ml, the pH value is adjusted to 7.0, be settled to 1L with 1M NaOH.The LB solid medium: adding agar powder in the LB liquid nutrient medium, to make its final concentration be 1.5%.
(L+) pectinose, Ampcillin are purchased the company in Sigma.
The concrete operations step
A, utilize the Red/ET homologous recombination technique to modify wild-type photorhabdus luminescens subsp.akhurstii crystal protein gene CipA and CipB, obtain photorhabdus luminescens subsp.akhurstii mutant strain, its detailed process of called after photorhabdus luminescens TZR is: with photorhabdusluminescens subsp.akhurstii genomic dna is template, with GGA TCC ACA CAT ACAACA TCT CAT TTG C and CAG CTG GAT CCT GTT GCA TAA CCT GAGGAT GGC is primer, obtains the CipA gene by pcr amplification; With photorhabdus luminescens subsp.akhurstii genomic dna is template, with GAA TTC TAT TAT AAT AGA TGA ATGGGA TG and AAT TCT AAC AAC TGT ATT AAT TGC GAC primer, obtain the CipB gene by pcr amplification.Adopt TOPO TA clone test kit to carry out plasmid construction and obtain plasmid pTA-CipA and pTOPO-CipB by TOPO TA clone test kit specification sheets.Adopt Red/ET homologous recombination method respectively Gentamycin and Apramycin resistant gene to be replaced partial sequence among the CipA of photorhabdus luminescens subsp.akhurstii and the CipB and obtain plasmid pTA-GentaInCipA and pTA-CipB-Apra.With BamHI pTA-GentaInCipA being carried out enzyme cuts and obtains GentaInCipA, adopt electroporation (1200V/cm) that enzyme is cut product C ipA-Genta and be transformed among the photorhabdus luminescens subsp.akhursti+pASK-α β γ A, obtain knocking out CipA gene photorhabdus luminescenssubsp.akhurstii mutant strain+pASK-α β γ A by screening.With EcoRI pTA-ApraIncipB being carried out enzyme cuts and obtains ApraInCipB, adopting electroporation (1200V/cm) that enzyme is cut product C ipA-Genta is transformed among the photorhabdus luminescens subsp.akhursti+pASK-α β γ A, obtain knocking out CipA and CipB gene photorhabdus luminescens subsp.akhurstii TZR+pASK-α β γ A by screening, plasmid pASK-α β γ A is removed in 42 ℃ of heat shocks.Obtain knocking out CipA and CipB gene photorhabdusluminescens subsp.akhurstii TZR by screening, use clone PCR and SDS-PAGE electrophoresis and identify.(whole process is seen accompanying drawing 1)
B, utilize Red/ET homologous recombination technique construction expression plasmid pBAD-CipB-BLfcin-Ampin, the detailed process that makes up plasmid is: with photorhabdus luminescens subsp.Akhurstii genome is template, by three pcr amplifications Bovinelactoferrin plain gene BLfcin and Ampin are introduced, finally obtain PCR product C ipB-BLfcin-Ampin with homology arm, utilize the Red/ET homologous recombination technique, with pBAD24 is carrier, construction expression plasmid pBAD-CipB-BLfcin-Ampin is correct through restriction enzyme digestion evaluation and the constructed as can be known plasmid of sequencing result.(whole process is seen accompanying drawing 2)
C, employing electroporation (1200V/cm) will be expressed pBAD-CipB-BLfcin-Ampin and be transformed among the photorhabdus luminescens TZR, obtain the Bovinelactoferrin engineering bacteria by screening.The preservation of this bacterial strain, deposit number: CCTCC NO:M206132.
A kind of Bovinelactoferrin engineering bacteria prepares the method for antibacterial peptide Bovinelactoferrin element, the steps include:
A, material and solution preparation
Used engineering bacteria is engineering bacteria photorhabdus luminescens TZR+pBAD-CipB-BLfcin-Ampin provided by the present invention.
The engineering bacteria substratum is the LB substratum, and its moiety is: yeast extract 5g; Peptone 10g; NaCl 5g; Add water 900ml, the pH value is adjusted to 7.0, be settled to 1L with 1M NaOH.(solid medium adds the agar powder of 1.5% final concentration).Solution I: 100mM Tris-Cl (pH 8.0), 150mM NaCl, 1mM EDTA.The sodium acetate soln of solution II: 0.5M.The acetum of solution III: 0.5M.
(L+) pectinose, Ampcillin, trypsinase are purchased the company in Sigma.
The preparation method of B, recombinant antibacterial peptide Bovinelactoferrin element
1) containing recovery engineering bacteria photorhabdus luminescensTZR+ expression plasmid pBAD-CipB-BLfcin-Ampin on the LB flat board of 100ug/mlAmpcillin;
2) choose mono-clonal in the LB substratum that contains 100ug/mlAmpcillin from the flat board of recovering, 30 ℃ of joltings (240rmp/min) spend the night (about 12h);
3) with 1 volume incubated overnight bacterium photorhabdus luminescens TZR+pBAD-CipB-BLfcin-Ampin, be inoculated in 50 volumes and contain in the LB substratum of 100 μ g/ml Ampcillin, 6h (OD is about 1-1.5) is cultivated in 30 ℃ of joltings;
4) adding 10% (L+) pectinose is 0.2%, 30 ℃ to final concentration and induces 18h;
5) the centrifugal 10min of 4000rmp (4 ℃), collecting cell;
6) use the solution I re-suspended cell, transfer in the new centrifuge tube;
7) 4000rmp (4 ℃), the 10min centrifugal collecting cell is abandoned supernatant, can carry out next step lysis experiment at once or be stored in-80 ℃ standby;
8) add aseptic double-distilled water and freeze molten (3-6 time) lysing cell repeatedly;
9) add equal-volume solution II (the pH value is 7.0) in centrifuge tube, 6000rmp (4 ℃), 10min is centrifugal, abandon supernatant, add equal-volume solution III (the pH value is 3.0) in centrifuge tube, 6000rmp (4 ℃), 10min is centrifugal, collects supernatant (accounting for total tropina 20%).(utilize the coded crystallin of CipB under pHpH5-11, not dissolve, but dissolved characteristic separation of C ipB merging lactoferricin under pH 2-3);
10) add trypsin digestion CipB and merge the Bovinelactoferrin element, discharge pure Bovinelactoferrin element (accounting for total tropina 5%), just obtain a kind of antibacterial peptide Bovinelactoferrin element.
This genetic engineering technique is produced novel antibacterial peptide Bovinelactoferrin element and has been solved the Bovinelactoferrin element to strong this difficult point of host bacterium suicide effect, the novel antibacterial peptide Bovinelactoferrin element of being produced is the expression amount height not only, have efficient, broad-spectrum antimicrobial, antiviral, anti-oxidant and regulate biologic activity such as immunity, and produce novel antibacterial peptide Bovinelactoferrin element with existing other genetic engineering technique and compare and possess following characteristics:
1, use this expression system to produce novel antibacterial peptide Bovinelactoferrin element and can overcome the suicide of Bovinelactoferrin element to the host bacterium, its reason is that this expression system is used photorhabdus luminescens subsp.akhurstii crystallin CipB as fusion rotein;
2, utilize the Red/ET homologous recombination technique to knock out photorhabdus luminescens subsp.akhurstii gene C ipA and CipB as the host bacterium, this host bacterium has easy cracked characteristics;
3, CipB is the high crystallin of a kind of expression amount among the photorhabdus luminescens subsp.akhurstii (reaches tropina expression amount 40%), molecular weight little (11.3kDa), solve the Bovinelactoferrin element to strong this difficult point of host bacterium suicide effect with CipB as lactoferricin amalgamation and expression albumen, and then realized efficiently express (20%) of Bovinelactoferrin element;
4, compare with the cost that obtains the Bovinelactoferrin element from natural cow's milk, it is more cheap that this genetic engineering technique is produced novel antibacterial peptide Bovinelactoferrin element.
Depositary institution: Chinese typical culture collection center, address: China. Wuhan. Wuhan University, postcode: 430072, preservation date: on November 27th, 2006, deposit number: CCTCC NO:M206132, classification name: luminous bacillus TZR photorhabdus luminescens TZR.
Description of drawings
Fig. 1 is for obtaining photorhabdus luminescens TZR whole process synoptic diagram
Fig. 2 is that the plain expression plasmid pBAD-CipB-BLfcin-Ampin of Bovinelactoferrin makes up the whole process synoptic diagram
Wherein: P1:
P2:
P3:
P4:
Embodiment
The structure of the plain expression plasmid pBAD-CipB-BLfcin-Ampin of the preparation of mutant strain photorhabdus luminescens TZR and Bovinelactoferrin
1 material
1.1 bacterial classification and carrier
Bacterial classification and vector gene type and source see Table 1.
Table 1 bacterial classification and vector gene type and source
| Bacterial classification or carrier | Genotype | The source |
| E.coli GB2005 photorhabdus luminescens subsp.akhurstii | The mutant wild-type | Germany German biomaterial resource center of gene brigdes company (www.genebrigdes.com) (is the German Resource Centre for Biological Material, www.dsmz.de) |
| photorhabdus luminescens TZR pASK-αβγA pYZP-Genta pR6k-Apra pTA-CipA pTA-CipB pTA-GentaInCipA pTA-ApraInCipB pBAD24 pBAD-CipB-BLfcin-Ampin | photorhabdus luminescens subsp. akhurstii；cipAl∷Ω -Gentar；cipBl∷Ω-Aprar Redα，Redβ，Redγ，RecA， Ap r Genta r Apra rPCR2.1 topO carrier with the CipA gene has been replaced part CipA gene, Apra with the PCR2.1 topO carrier of CipB gene with the Gentamycin resistant generPortion C ipB gene, Genta have been replaced with the Apramycin resistant gene r Ap rCipB, Bovinelactoferrin plain gene BLfcin-Ampin, Ap r | Obtaining German gene brigdes company of German gene brigdes company of German gene brigdes company (www.genebrigdes.com) (www.genebrigdes.com) (www.genebrigdes.com) by the present invention obtains to obtain obtaining to obtain German gene brigdes company (www.genebrigdes.com) by the present invention by the present invention by the present invention by the present invention and is obtained by the present invention |
Annotate: Ap
r, ampicillin resistance; Apra
r, Apramycin resistance; Genta
r, Gentamycinresistance.
1.2 toolenzyme
RNaseA, ProteinaseK, restriction enzyme are available from New England Biolabs company.Taqpolymerase is available from Eppendorf company.
1.3 test kit
The PCR purification kit is available from Inviteck company, in a small amount, middle amount and large quantity extracting plasmid test kit be QIAGEN company product.Bacterial genomes DNA extraction test kit is a TaKaRa company product.PCR2.1TOPO TA clones test kit: available from Invitrogen company (www.invitrogen.com).The Red/ET test kit is provided by German gene brigdes company (www.genebrigdes.com).
1.4 intestinal bacteria GB2005 (German gene brigdes company provide) and luminous bacillus photorhabdusluminescens subsp.akhurstii substratum
LB liquid nutrient medium: yeast extract 5g; Peptone 10g; NaCl 5g; Add water and be settled to 1L.The LB solid medium: the adding final concentration is 1.5% agar powder in the LB liquid nutrient medium.
(1) with reference to the accompanying drawings shown in 1 operating process, the specific implementation method of preparation mutant strain photorhabdus luminescens TZR is as follows:
The acquisition of A, CipA and CipB gene
With photorhabdus luminescens subsp.akhurstii genomic dna is template, with GGA TCCACA CAT ACA ACA TCT CAT TTG C and CAG CTG GAT CCT GTT GCATAA CCT GAG GAT GGC is primer, by 50 μ l reaction system (ddH
2O:38 μ l; DNTP (5mM): 2.0 μ l; 10*Taq buffer:5.0 μ l; Oligo up (50pmol/l): 1.5 μ l; 0ligo down (50pmol/l): 1.5 μ l; Template (100ng): 1.0 μ l; Taq polymarase:1.0 μ l.) and response procedures (95 ℃ of pre-sex change, 3min; 32 circulations (95 ℃ of sex change, 40sec; Anneal 50 ℃ 40sec; Extend 72 ℃, 2min50sec); Extend 72 ℃ at last, 10min) carry out pcr amplification and obtain the CipA gene.With photorhabdus luminescens subsp.akhurstii genomic dna is template, with GAA TTCTAT TAT AAT AGA TGA ATG GGA TG and AAT TCT AAC AAC TGT AT TAAT TGC GAC primer, by 50 μ l reaction system (ddH
2O:38 μ l; DNTP (5mM): 2.0 μ l; 10*Taqbuffer:5.0 μ l; Oligo up (50pmol/l): 1.5 μ l; Oligo down (50pmol/l): 1.5 μ l; Template (100ng): 1.0 μ l; Taq polymarase:1.0 μ l.) and response procedures (95 ℃ of pre-sex change, 3min; 32 circulations (95 ℃ of sex change, 45sec; Anneal 50 ℃ 40sec; Extend 72 ℃, 1min50sec); Extend 72 ℃ at last, 10min ℃) carry out the pcr amplification acquisition with the CipB gene.
B, be used to modify the plasmid construction of CipA and CipB gene
1) structure of plasmid pTA-CipA and pTA-CipB
Adopt the PCR purification kit CipA and CipB gene PCR product to be carried out purifying, operate, obtain plasmid pTA-CipA and pTA-CipB by TOPO TA clone test kit specification sheets by operation instructions.
2) acquisition of GentaInCipA and ApraInCipB gene
With pYZP-Genta is template, with
CTTATTTATC AATTAATTAC ATTATATTTT GGAGTTTACA TTGAA TTC TGA AGG CAC GAA CCC AGT TGA C and
TAAGGAATTA GGTGGAGCTA TTTAACAATT TATGACTTTATC GAA TTC GGC TTG AAC GAA TTG TTA GG (wherein being with the underscore base is homology arm, and all the other bases are primer) is a primer, by 50 μ l reaction system (ddH
2O:38 μ l; DNTP (5mM): 2.0 μ l; 10*Taq buffer:5.0 μ l; Oligo up (50pmol/l): 1.5 μ l; Oligo down (50pmol/l): 1.5 μ l; Template (100ng): 1.0 μ l; Taq polymarase, 1.0 μ l.) and response procedures (95 ℃ of pre-sex change, 3min; 32 circulations (95 ℃ of sex change, 40sec; Anneal 50 ℃ 40sec; Extend 72 ℃, 2min50sec); Extend 72 ℃ at last, 10min) carry out the Gentamycin gene that pcr amplification obtains the band homology arm.With pR6k-Apra is template, with
TATTTATCAA TCGGTTAGAT TAAATTTTGG AGTTTATGTC GGATCCGGT TCA TGT GCA GCT CCA TCA G (wherein being with the underscore base is homology arm, and all the other bases are primer) and
TATTTTAATT CACGCACCCA TTTAGAAATT TAACAAATAC TTCGGATCCTCA GCC AAT CGA CTG GCG AGC (wherein being with the underscore base is homology arm, and all the other bases are primer) is a primer, by 50 μ l reaction system (ddH
2O:38 μ l; DNTP (5mM): 2.0 μ l; 10*Taqbuffer:5.0 μ l; Oligo up (50pmol/l): 1.5 μ l; Oligo down (50pmol/l): 1.5 μ l; Template (100ng): 1.0 μ l; Taq polymarase:1.0 μ l.) and response procedures (95 ℃ of pre-sex change, 3min; 32 circulations (95 ℃ of sex change, 45sec; Anneal 50 ℃ 40sec; Extend 72 ℃, 1min50sec); Extend 72 ℃ at last, 10min.) carry out the Apramycin gene that pcr amplification obtains the band homology arm.
3) structure of pTA-GentaInCipA and pTA-ApraInCipB
Adopt the operation of Red/ET test kit by specification to make up plasmid pTA-GentaInCipA and pTA-ApraInCipB.
C, CipA gene knockout
1) with BamHI pTA-GentaInCipA is carried out enzyme and cut and obtain GentaInCipA, adopt the PCR purification kit to cut product GentaInCipA by the operation instructions purifying enzyme;
2) 40 μ l are spent the night bacterium photorhabdus luminescens subsp.akhurstii+pASK-α β γ A is inoculated in 1.4ml and contains in the LB substratum of 100 μ g/ml Apramycin, and 2h are cultivated in 30 ℃ of joltings;
3) add 2 μ l 2mg/ml hydrolysis tsiklomitsins, 30 ℃ of inducing culture 1h;
4) adopting electric method (1200V/cm) of changeing that enzyme is cut product GentaInCipA is transformed among the photorhabdusluminescens subsp.akhurstii+pASK-α β γ A;
5) 30 ℃ are recovered to cultivate 1h;
6) it is layered on the LB flat board that contains 3 μ g/ml Gentamycin 30 ℃ of incubated overnight.
D, CipB gene knockout
1) with EcoRI pTA-ApraInCipB is carried out enzyme and cut, adopt the PCR purification kit to cut product A praInCipB by the operation instructions purifying enzyme;
2) 40 μ l the are spent the night photorhabdus luminescens subsp.akhursti+pASK-gba that bacterium knocks out the CipA gene is inoculated in the LB that contains 100 μ g/ml Ampicillin, and 2h are cultivated in 30 ℃ of joltings;
3) add 2 μ l 2mg/ml hydrolysis tsiklomitsins, 30 ℃ of inducing culture 1h;
4) adopting electric method (1200V/cm) of changeing that enzyme is cut product A praInCipB importing knocks out among the photorhabdus luminescens subsp.akhursti+pASK-α β γ A of CipA gene;
5) 30 ℃ are recovered to cultivate 1h;
6) it is layered on the LB flat board that contains 25 μ g/ml Apramycin 30 ℃ of incubated overnight.
Plasmid pASK-α β γ A is removed in E, 42 ℃ of heat shocks
1) 40ul is spent the night bacterium photorhabdus luminescens subsp.akhursti+pASK-α β γ A is inoculated on the LB flat board of 1.0ml 3 μ g/ml Gentamycin and 25 μ g/ml Apramycin 42 ℃ of jolting overnight incubation;
2) 30 ℃ are recovered to cultivate 1h;
3) it is layered on the LB flat board that contains 3 μ g/ml Gentamycin and 25 μ g/ml Apramycin 30 ℃ of overnight incubation;
4) choose mono-clonal LB flat board dull and stereotyped at the LB that contains 100ug/ml Ampcillin respectively and that contain 3 μ g/ml Gentamycin and 25 μ g/mlApramycin from the LB flat board that contains 3 μ g/ml Gentamycin and 25 μ g/ml Apramycin and carry out two line;
5) will be not long at the LB flat board that contains 100 μ g/mlAmpcillin, but 30 ℃ of jolting overnight incubation can be contained among 3 μ g/mlGentamycin and the 25 μ g/ml Apramycin LB at the colony inoculation of growing on the LB flat board that contains 3 μ g/ml Gentamycin and 25 μ g/ml Apramycin in 1.0ml;
6) carry out restriction enzyme digestion with EcoRI, detect plasmid and whether exist and preserve the clone who does not have plasmid.
(2) press shown in accompanying drawing 2 operating processes, it is as follows to make up the plain expression plasmid pBAD-cipB-BLfcin-Ampin of Bovinelactoferrin specific implementation method:
A, expression plasmid pBAD-CipB-BLfcin-Ampin make up
1) acquisition of the CipB-BLfcin-Ampin PCR product of band homology arm
With photorhabdus luminescens subsp.akhurstii genomic dna is template, with P1 (
TCCATACCCG TTTTTTTGGG CTAAGCTTAG GAGATTACAT TATG ATA ATT AAG AAA GATATT) and P2 (CAGCATACGG CGCACACAGG TGATAGACGG AGCACCCAGT TTTTTCCAACGCCACTGCCA GCGACGACAT TTAAA CAT AAT TTC AAC ACC AAC TAT) (wherein being with the underscore base is homology arm, the italic base is the BLfcin gene, all the other bases are primer) be primer, press 50l reaction system (ddH
2O:38ul; DNTP (5mM): 2.0 μ l; 10*Taq buffer:5.0 μ l; Oligo up (50pmol/l): 1.5 μ l; Oligo down (50pmol/l): 1.5 μ l; Template (100ng): 1.0 μ l; Taq polymarase:1.0 μ l.) and response procedures (95 ℃ of pre-sex change, 3min; 32 circulations (95 ℃ of sex change, 55sec; Anneal 54 ℃ 55sec; Extend 72 ℃, 50sec); Extend 72 ℃ at last, 10min), obtain the cipB-BLfcin gene by pcr amplification.
With CipB-BLfcin gene PCR product is template, with P1 (
TCCATACCCG TTTTTTTGGG CTAAGCTTAG GAGATTACAT TATG ATA ATT AAG AAA GAT ATT) and P3 (ACGAGA TTTATTTTTACCAAA TTTTTCTTG AGCTTTAGAC AGCAGTTTCC AAAT CAG CAT ACG GCG CAC ACAGGT) (wherein being with the underscore base is homology arm, the italic base is the Ampin gene, all the other bases are primer) be primer, by 50 μ l reaction system (ddH
2O:38 μ l; DNTP (5mM): 2.0 μ l; 10*Taq buffer:5.0 μ l; Oligo up (50pmol/l): 1.5 μ l; Oligo down (50pmol/l): 1.5 μ l; Template (100ng): 1.0 μ l; Taq polymarase:1.0 μ l.) and response procedures (95 ℃ of pre-sex change, 3min; 32 circulations (95 ℃ of sex change, 55sec; Anneal 54 ℃ 55sec; Extend 72 ℃, 50sec); Extend 72 ℃ at last, 10min), obtain the CipB-BLfcin-Ampin gene by pcr amplification.
With CipB-BLfcin-Ampin gene PCR product is template, with P1 (
TCCATACCCG TTTTTTTGGG CTAAGCTTAG GAGATTACAT TATG ATA ATT AAG AAA GAT ATT) and P4 (
TCCGCCAAAA CAGCCAAGCT TTCCTTTCGG GCTTTGTTAG CAGCCGGATC CCCTTAACG AGA TTT ATT TTTACC AAA) (wherein being with the underscore base is homology arm, and all the other bases are primer) is primer, by 50 μ l reaction system (ddH
2O:38 μ l; DNTP (5mM): 2.0 μ l; 10*Taq buffer:5.0 μ l; Oligo up (50pmol/l): 1.5 μ l; Oligo down (50pmol/l): 1.5 μ l; Template (100ng): 1.0 μ l; Taq polymarase:1.0 μ l) and response procedures (95 ℃ of pre-sex change, 3min; 32 circulations (95 ℃ of sex change, 55sec; Anneal 54 ℃ 55sec; Extend 72 ℃, 50sec); Extend 72 ℃ at last, 10min), obtain the CipB-BLfcin-Ampin gene of band homology arm by pcr amplification.
The structure of B, pBAD-CipB-BLfcin-Ampin
Utilize the PCR purification kit CipB-BLfcin-Ampin PCR product of being with homology arm to be carried out purifying by operation instructions.Adopt the method for Red/ET homologous recombination to make up pBAD-CipB-BLfcin-Ampin.
The acquisition of C, engineering bacteria
1) 40ul incubated overnight bacterium photorhabdus luminescens subsp.akhursti TZR is inoculated in 1.4ml and contains in the LB substratum of 3 μ g/ml Gentamycin and 25 μ g/ml Apramycin 30 ℃ of jolting 3h:
2) method (1200V/cm) that adopts electricity to change is transformed into pBAD-CipB-BLfcin-Ampin respectively among the photorhabdus luminescens subsp.akhursti TZR;
3) 30 ℃ are recovered to cultivate 1h;
4) it is layered on contains on the 100 μ g/ml Apramycin LB flat boards 30 ℃ of incubated overnight;
5) choose mono-clonal and contain the LB of Amp100 μ g/ml in 1.8ml from the 100 μ g/ml Apramycin LB flat boards that contain of incubated overnight, jolting is spent the night;
6) prepare plasmid DNA on a small quantity, be dissolved in 8ulddH
2O gets 4 μ l plasmid DNA and carries out the restriction enzyme digestion evaluation and preserve correct clone with BamHI and HindIII.
7) with the clone of correct more than 1 volume and incubated overnight, be inoculated in 50 volumes and contain in the LB substratum of 100 μ g/mlAmpcillin, 6h (OD is about 1-1.5) is cultivated in 30 ℃ of joltings;
4) adding 10% (L+) pectinose to final concentration is 0.2%, 30 ℃ of inducing culture 18h;
5) the centrifugal 10min of 4000rmp (4 ℃), collecting cell is got 10 μ l and is carried out the SDS-PAGE evaluation, and preserves the clone of energy express recombinant Bovinelactoferrin.
(3), a kind of preparation method of antibacterial peptide Bovinelactoferrin element is as follows:
A, material and solution preparation
Used engineering bacteria is engineering bacteria photorhabdus luminescens TZR+pBAD-CipB-BLfcin-Ampin provided by the present invention.
The engineering bacteria substratum is the LB substratum, and its moiety is: yeast extract 5g; Peptone 10g; NaCl 5g; Add water 900ml, the pH value is adjusted to 7.0, be settled to 1L with 1M NaOH.(solid medium adds the agar powder of 1.5% final concentration).Solution I: 100mM Tris-Cl (pH 8.0), 150mM NaCl, 1mM EDTA.The sodium acetate soln of solution II: 0.5M.The acetum of solution III: 0.5M.
(L+) pectinose, Ampcillin, trypsinase are purchased the company in Sigma.
The preparation method of B, recombinant antibacterial peptide Bovinelactoferrin element
1) recovery engineering bacteria photorhabdus luminescensTZR+ expression plasmid pBAD-CipB-BLfcin-Ampin on the LB flat board that contains 100 μ g/mlAmpcillin;
2) choose mono-clonal in the LB substratum that contains 100 μ g/mlAmpcillin from the flat board of recovering, 30 ℃ of joltings (240rmp/min) spend the night (about 12h);
3) with 1 volume incubated overnight bacterium photorhabdus luminescens TZR+pBAD-CipB-BLfcin-Ampin, be inoculated in 50 volumes and contain in the LB substratum of 100 μ g/ml Ampcillin, 6h (OD is about 1-1.5) is cultivated in 30 ℃ of joltings;
4) adding 10% (L+) pectinose is 0.2%, 30 ℃ to final concentration and induces 18h;
5) the centrifugal 10min of 4000rmp (4 ℃), collecting cell;
6) use the solution I re-suspended cell, transfer in the new centrifuge tube;
7) 4000rmp (4 ℃), the 10min centrifugal collecting cell is abandoned supernatant, can carry out next step lysis experiment at once or be stored in-80 ℃ standby;
8) add aseptic double-distilled water and freeze molten 3-6 cracking cell repeatedly;
9) add equal-volume solution II (the pH value is 7.0) in centrifuge tube, 6000rmp (4 ℃), 10min is centrifugal, abandon supernatant, add equal-volume solution III (the pH value is 3.0) in centrifuge tube, 6000rmp (4 ℃), 10min is centrifugal, collects supernatant (accounting for total tropina 20%).(utilize the coded crystallin of CipB under pHpH5-11, not dissolve, but dissolved characteristic separation of C ipB merging lactoferricin under pH2-3);
10) add trypsin digestion CipB and merge the Bovinelactoferrin element, discharge pure Bovinelactoferrin element (accounting for total tropina 5%), just obtain a kind of antibacterial peptide Bovinelactoferrin element.
11) show that by extracorporeal bacteria inhibitor test reorganization Bovinelactoferrin element has fabulous anti-microbial property (the results are shown in Table 2) to Gram-negative bacteria intestinal bacteria and Salmonellas.Show that by the weanling pig test reorganization Bovinelactoferrin element can reduce diarrhea rate, also can improve weanling pig growth performance and immunologic function (the results are shown in Table 3,4).
Table 2 reorganization Bovinelactoferrin element and the minimal inhibitory concentration of different microbiotic to various pathogenic bacterias
Concentration unit: μ g/ml
| Bacillus subtillis (G +)K3-2 | Sarcina lutea (G +)T3-2 | Golden staphylococci (G +)J3-3 | Cray uncle pneumobacillus (G +)K3-4 | Intestinal bacteria (G -)D3-3 | Salmonellas (G -)S2-1 | |
| LFc | 3.12 | ＞50 | ＞50 | ＞50 | 6.25 | 6.25 |
| Roxarsone is imitated U.S. plain terramycin aureomycin arsanilic acid allicin olaquindox origanum oil salinomycin Bacitracin Zinc colistin sulfate kitasamycin | 3.12 0.78 0.78 3.12 6.25 6.25 3.12 0.39 3.12 25 6.25 0.78 | 25 12.5 0.78 6.25 50 3.12 6.25 1.56 25 25 25 0.1 | ＞50 6.25 0.78 3.12 ＞50 3.12 50 1.56 6.25 6.25 12.5 0.39 | 25 25 1.56 ＞50 ＞50 25 12.5 3.12 25 ＞50 3.12 3.12 | ＞50 50 ＞50 ＞50 ＞50 25 25 12.5 50 ＞50 6.25 50 | ＞50 25 ＞50 ＞50 ＞50 50 50 12.5 ＞50 ＞50 12.5 ＞50 |
Table 3 reorganization Bovinelactoferrin element is to the influence of weanling pig growth performance
| Project | Control group | The microbiotic group | Reorganization Bovinelactoferrin element |
| Diarrhea rate (%) initial weight Initial weight, kg average daily gain ADG, g feedstuff-meat ratio F/G | 50 a 8.03 556.1 b 1.69 a | 20 c 8.04 645.6 a 1.50 c | 24 c 8.05 631.0 a 1.56 c |
Colleague's shoulder motes same letter is represented difference not remarkable (P＞0.05) in the table, and adjacent letters is represented significant difference (P＜0.05), and is alternate
aLetter representation difference is (P＜0.01) extremely significantly.
Table 4 reorganization Bovinelactoferrin element is to the influence of weanling pig serum immune globulin concentration
| Project | Control group | The microbiotic group | Reorganization Bovinelactoferrin element |
| IgG(mg/dL) IgA(mg/dL) IgM(mg/dL) | 1.24 c 1.32 b 6.74 c | 1.85 b 1.34 b 5.82 c | 3.24 a 2.14 a 10.01 a |
Colleague's shoulder motes same letter is represented difference not remarkable (P＞0.05) in the table, and adjacent letters is represented significant difference (P＜0.05), and alternate letter representation difference is (P＜0.01) extremely significantly.
Claims (2)
1, a kind of Bovinelactoferrin engineering bacteria is characterized in that: Bovinelactoferrin engineering bacteria (photorhabdusluminescens TZR), CCTCC NO:M206132.
2, a kind ofly be used to realize that the described Bovinelactoferrin engineering bacteria of claim 1 prepares the method for antibacterial peptide Bovinelactoferrin element, it comprises the following steps:
A, on the LB flat board that contains 100 μ g/mlAmpcillin recovery engineering bacteria photorhabdusluminescens TZR+ expression plasmid pBAD-CipB-BLfcin-Ampin;
B, choose mono-clonal in the LB substratum that contains 100 μ g/mlAmpcillin from the flat board of recovering, 30 ℃ of jolting/240rmp/min spend the night;
C, with 1 volume incubated overnight bacterium photorhabdus luminescens TZR+pBAD-CipB-BLfcin-Ampin, be inoculated in 50 volumes and contain in the LB substratum of 100 μ g/ml Ampcillin, 30 ℃ of joltings are cultivated 6h/OD and are about 1-1.5;
D, add 10%/L+ pectinose to final concentration and be 0.2%, 30 ℃ and induce 18h;
E, 4000rmp, 4 ℃ of centrifugal 10min, collecting cell;
F, use the solution I re-suspended cell, transfer in the new centrifuge tube;
G, 4000rmp, 4 ℃, the 10min centrifugal collecting cell is abandoned supernatant, carry out lysis or be stored in one 80 ℃ standby;
H, add aseptic double-distilled water and freeze molten 3-6 cracking cell repeatedly;
I, add the equal-volume solution II, the pH value is 7.0 in centrifuge tube, 6000rmp, and 4 ℃, 10min is centrifugal, abandon supernatant, add the equal-volume solution III, the pH value is 3.0 in centrifuge tube, 6000rmp, 4 ℃, 10min is centrifugal, collects supernatant, and dissolved characteristic separation of C ipB merges lactoferricin under pH2-3;
J, add trypsin digestion CipB and merge the Bovinelactoferrin element, discharge pure Bovinelactoferrin element, account for total tropina 5%, just obtain a kind of antibacterial peptide Bovinelactoferrin element.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006101665366A CN100516199C (en) | 2006-12-28 | 2006-12-28 | Cattle lactoferrin engineering bacterium and preparation method for antibiotic peptide cattle lactoferrin |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006101665366A CN100516199C (en) | 2006-12-28 | 2006-12-28 | Cattle lactoferrin engineering bacterium and preparation method for antibiotic peptide cattle lactoferrin |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101063101A true CN101063101A (en) | 2007-10-31 |
| CN100516199C CN100516199C (en) | 2009-07-22 |
Family
ID=38964386
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2006101665366A Expired - Fee Related CN100516199C (en) | 2006-12-28 | 2006-12-28 | Cattle lactoferrin engineering bacterium and preparation method for antibiotic peptide cattle lactoferrin |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100516199C (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101628941B (en) * | 2008-07-18 | 2012-07-25 | 中国农业大学 | Bovine lactoferrin antibacterial peptide fusion protein, coding gene and application thereof |
| CN103146733A (en) * | 2013-02-05 | 2013-06-12 | 苗青青 | Antibacterial recombination polypeptide and expression vector thereof |
| CN104017086A (en) * | 2014-06-24 | 2014-09-03 | 任建廷 | Fusion antimicrobial peptide and preparation method thereof |
| EP3330282A1 (en) | 2016-12-02 | 2018-06-06 | Ludwig-Maximilians-Universität München | Cipa, cipb and pixa as scaffolds to organize proteins into crystalline inclusions |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1407108A (en) * | 2001-09-06 | 2003-04-02 | 胡放 | Genetic engineering recombination strain expression of lactoferritin and use thereof |
| CN1718726B (en) * | 2004-07-07 | 2011-04-13 | 北京三元食品股份有限公司 | Reconstitution bacteria strain for expressing human lactoferro protein and its culturing method |
-
2006
- 2006-12-28 CN CNB2006101665366A patent/CN100516199C/en not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101628941B (en) * | 2008-07-18 | 2012-07-25 | 中国农业大学 | Bovine lactoferrin antibacterial peptide fusion protein, coding gene and application thereof |
| CN103146733A (en) * | 2013-02-05 | 2013-06-12 | 苗青青 | Antibacterial recombination polypeptide and expression vector thereof |
| CN104017086A (en) * | 2014-06-24 | 2014-09-03 | 任建廷 | Fusion antimicrobial peptide and preparation method thereof |
| EP3330282A1 (en) | 2016-12-02 | 2018-06-06 | Ludwig-Maximilians-Universität München | Cipa, cipb and pixa as scaffolds to organize proteins into crystalline inclusions |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100516199C (en) | 2009-07-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106540240B (en) | Preparation and application of antibacterial peptide fusion cell factor CAMPILs co-expression biological agent | |
| CN101717737B (en) | Antibiotic peptide buforin II and porcine INF-alpha fusion expression pichia pastoris, and preparation method and applications thereof | |
| CN1202934A (en) | Delivery of biologically active polypeptides | |
| CN101063101A (en) | Cattle lactoferrin engineering bacterium and preparation method for antibiotic peptide cattle lactoferrin | |
| CN105801707A (en) | Oral vaccine for treating grass carp hemorrage as well as preparation and application thereof | |
| CN1763175A (en) | Glycerol channel protein gene deleted brewing microzyme strain capable of reducing glycerol output and increasing ethanol output and construction method thereof | |
| CN1604960A (en) | Expression system | |
| CN1654656A (en) | FenneropenaeusChinensis Crustin gene and coded protein and cloning method therefor | |
| CN1693466A (en) | Engineering bacteria for producing 5-amino acetyl propionic acid and its constructing method | |
| CN1142280C (en) | Improved prokaryotic expression of protein | |
| CN105483034A (en) | Saccharomyces cerevisiae mating type conversion method | |
| CN102827289A (en) | Porcine circovirus type 2 Cap protein and thymosin alpha1 fusion protein and application | |
| CN1810976A (en) | Pesticidal gene and its use | |
| CN102827259A (en) | Porcine circovirus type 2 (PCV2) Cap protein gene and application thereof | |
| CN102121025B (en) | Multi-copy integrated expression vector and preparation method and application thereof in expression of bovine lactoferrin | |
| CN1171998C (en) | Antibacterial peptide gene of Chinese prawn and its colon technique | |
| CN1294258C (en) | Method for separating antibiotic peptide and separated antibiotic peptide | |
| CN1760203A (en) | Antibacterial tripeptides and modified chemicals, and application | |
| CN1831109A (en) | Recombinant bacteria of coding macrotherm phytase gene, synthesis, cloning and expression of said gene | |
| CN1405303A (en) | Broad-spectrum, high-temperatur-resistant, high-specific-activity phytase, and its coding gene and expression | |
| CN1880461A (en) | Escherichia coli self-cracking method and its dedicated carrier and application | |
| CN1752210A (en) | Chicken interferon gamma, preparing process and use thereof | |
| CN1818068A (en) | Construction of recombinant human leucocyte medium-2(125ser) expression carrier | |
| CN1236059C (en) | Grouper insulin-like growth factor II gene, carrier and recombinant strain containing the gene and application thereof | |
| CN104789515A (en) | Bacillus subtilis genetically engineered bacterium generated by regulable spore, and construction method thereof and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Assignee: Hunan Liuyanghe Feed Co., Ltd. Assignor: Institute of Subtropical Agriculture, Chinese Academy of Sciences Contract fulfillment period: 2009.11.30 to 2026.12.27 contract change Contract record no.: 2009430000227 Denomination of invention: Cattle lactoferrin engineering bacterium and preparation method for antibiotic peptide cattle lactoferrin Granted publication date: 20090722 License type: Exclusive license Record date: 2009.12.9 |
|
| LIC | Patent licence contract for exploitation submitted for record |
Free format text: EXCLUSIVE LICENSE; TIME LIMIT OF IMPLEMENTING CONTACT: 2009.11.30 TO 2026.12.27; CHANGE OF CONTRACT Name of requester: HUNAN LIUYANGHE FEED CO., LTD. Effective date: 20091209 |
|
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20090722 Termination date: 20100128 |