CN1536077A - High-yield recombinant influenza B virus strain and its application - Google Patents

Abstract

The present invention relates to a kind of new influenza B virus complete gene sequence with mammalian cell high-yield characteristics and carrier containing said equence and strain. Said invention also relates to the influenza B vaccine prepared by using the described strain.

Description

Reorganization Influenza B virus strain of high yield and uses thereof

Technical field

The present invention relates to reorganization Influenza B virus strain of a kind of high yield and uses thereof, and the nucleic acid of this virus stain of recombinating and primer, particularly the second type influenza virus vaccine for preparing via this strain.

Background technology

Influenza is a kind of respiratory tract disease that is caused by influenza virus.According to " science " magazine, in influenza season occurred frequently, because the labor force reduces and the medical expense increase, the financial loss of bringing to the U.S. is above 12,000,000,000 dollars.In addition, annual all have the American more than 20,000 to die because of influenza.

The influenza storm that have swept the globe in 1918 causes 2,000 ten thousand-4,000 ten thousand people's death altogether, surpasses the summation of death toll in the World War I.The influenza that the last time is swept away the whole world occurs in nineteen sixty-eight, has seized nearly 500,000 people's in the whole world life, and wherein the overwhelming majority is the elderly, and still, also having many once was the healthy young people.Flu outbreak is because fatal virus variant occurred.And Britain's " nature " magazine claims, such deadly virus variation occurred once in average per 30 years to 40 years.This danger was shown indications of a new development in 1997.That year, there are 18 people in Hong Kong by a kind of avian influenza, and 6 people die.In May calendar year 2001, avian influenza virus has been found in Hong Kong again, although virus this time is considered to can not infect the mankind, the Hongkong government still do not stint the loss 2.45 hundred million Hongkong dollars, put to death about 1,300 ten thousand poultry.

Avoid influenza to break out again, the most important thing is, in time discover viral fatal variation and prepare corresponding vaccine.WHO has started global influenza monitoring network from 1948.In every year, WHO will gather the popularity of various countries' influenza virus strain, analyzes next year possibility popular Virus Type then, and announces conclusion in 6 months in advance, and each producer then produces vaccine on this basis.Although many people think that this network is effective, working efficiency that it is present and research level can not guarantee to make when in a single day viral fatal mutation occurs accurately and rapidly reaction.

Influenza virus worldwide causes people and animals' morbidity and death.The popular Chang Youjia and the Influenza B virus of influenza cause, the surface antigen of influenza virus is important component part (the Jackson D of influenza vaccines, CadmanA, Zurcher T, Barclay WS.A reverse genetics approach for recovery ofrecombinant influenza B viruses entirely from cDNA.J Virol.2002Nov; 76 (22): 11744-7).But, influenza virus is because antigen conversion or antigenic drift often cause the appearance of new variant antigens, therefore vaccine strain need often be replaced (Hoffmann E, Mahmood K, Yang CF, Webster RG, Greenberg HB, Kemble G.Rescue of influenza B virus from eightplasmids.Proc Natl Acad Sci U S is Aug 20 A.2002; 99 (17): 11411-6).Currently get the Green Light that what produce is the inactivated vaccine in chicken embryo source,, still exist many deficiencies although take effective viral purification technology.Not only need a large amount of chicken embryos, and the production cycle is long.The vaccine that produces in tissue culture has been obtained reasonable protectiveness (Govorkova EA in animal model, Murti G, Meignier B, de Taisne C, Webster RG.African green monkey kidney (Vero) cells provide an alternative host cell system for influenza A and B viruses.J Virol.1996 Aug; 70 (8): 5519-24).At present, the mammalian cell mdck cell is considered to cultivate first type and the only clone of Influenza B virus (Robertson JS.Related Articles, Links An overview of host cell selection.Dev Biol Stand.1999; 98:7-11; Discussion 73-4), this clone has the back of infection and produces influenza virus rapidly, obtains the characteristics of high titre at short notice.The virus in MDCK source is through after the continuous passage in addition, kept antigenic stability (Govorkova EA, Kodihalli S, Alymova IV, Fanget B, Webster RG.RelatedArticles, Links Growth and immunogenicity of influenza viruses cultivatedin Vero or MDCK cells and in embryonated chicken eggs.Dev Biol Stand.1999; 98:39-51; Discussion 73-4).

Yet not every virus all is adapted in some cell growth and can becomes vaccine strain, and for example some viruses output in chicken embryo and/or mammalian cell is very low.Therefore, the problem that solves is the reassortant that obtains high yield, the method that adopts is that the HA and the NA fragment of breadboard high yield strain that has obtained and epidemic isolates are carried out reprovision at present, make vaccine strain both keep the characteristic of high yield, has the antigenic characteristics of epidemic isolates (Hoffmann E again, Mahmood K, Yang CF, Webster RG, Greenberg HB, Kemble G.Rescueof influenza B virus from eight plasmids.Proc Natl Acad Sci U S A.2002Aug 20; 99 (17): 11411-6).

The development of reverse genetic technology makes quick acquisition influenza vaccines become possibility.On the basis of the female strain of high yield of recombinating out, obtain vaccine strain and only need simple clone, and rotaring dyeing technology, the time that approximately needed for two weeks, need 2 months time and obtain recombinant virus, therefore obtain the production time that vaccine strain has greatly shortened vaccine with the reverse genetic method with classical reallocating method.Neuman (Gabriele Neumann and Yoshihiro Kawaoka, 1Virology 287,243 ± 250 (2001)) is defined as the process that is produced strand RNA by cDNA with the antisense genetic technique, be participated in by the RNP mixture.A plurality of stages have been experienced in the development of this technology.1989, help viral system to produce.Palse research group has set up the system of first research minus-stranded rna virus, has started from the clone _cDNA produces reorganization _vIn new era of RNA, created the RNP transfection method.Hobom and Colleagues (Neumann, G., Zobel, A., and Hobom, G. (1994) .RNA polymerase I-mediated expression of influenza viral RNAmolecules.Virology 202,477 ± 479.) push away and go a step further, first Application RNA Polymerse1 and Helper virus system.

The characteristics of Polymerse1 show as:

1, Polymerse1 transcribes rRNA and does not comprise 5 ' cap and 3 ' stern construction, utilizes this point can transcribe out viral genome.

2, can not prolong transcriptional domain with the promotor and the terminator of length-specific, guarantee that the advantage of virus genomic integrity Polymerse1 system is more convenient than RNP transfection method, do not need in-vitro transcription, the assembling of protein purification and RNP.

But it should be noted that above two systems all exist shortcoming: promptly yield poorly, generation be defective virus mostly.Help viral background height, need a large amount of screening operations.Make the practicality of this technology seem not enough.So in 1994, people such as Conzelmann (Schnell, M.J., Mebatsion, T., and Conzelmann, K.K. (1994) .Infectious rabies viruses from cloned cDNA.EMBO J.13,4195 ± 4203.) with the t7 rna polymerase systems produce rabies virus.Neuman (Neumann, G., Watanabe in 1999, T., Ito, H., Watanabe, S., Goto, H., Gao, P., Hughes, M., Perez, D., Donis, R., Hoffmann, E., Hobom, G., and Kawaoka, Y. (1999) .Generationof influenza A viruses entirely from cloned cDNAs.Proc.Natl.Acad.Sci.96,9345 ± 9350.) etc. the people has successfully cloned influenza virus, and they have adopted the method for 12 plasmid co-transfections, wherein 8 plasmids are transcribed out viral genome segment respectively, 4 albumen that plasmid expression is relevant with virus replication with these 12 plasmid co-transfection mammalian cells, have obtained recombinant virus particle.The shortcoming of this system is that 12 plasmid co-transfections have increased the difficulty of transfection, have limited the use of clone.After this Hoffmann (HoffmannE, Stech J, Guan Y, Webster RG, Perez DR.Universal primer set for thefull-length amplification of all influenza.A viruses.Arch Virol2001; 146:2275-89.) invented 8 pUC pUCs on this basis, can not only transcribe out the full gene group of virus, can also give expression to all viral proteins, utilize this system, successfully packed out influenza virus.

The genomic characteristics of Influenza B virus are the member of orthomyxoviridae family as influenza A virus, are made up of 8 segmented strand RNAs.Generally speaking, the Influenza B virus encoded protein is similar to the first type, its the 6th and the 7th fragment shows specific characteristics, described the 6th sections coding NA and NB albumen, proteic function of NB and M2 protein similar, perhaps, the 7th sections coding M1 and BM2 albumen, the difference of the characteristic in these heredity help to understand the host range restriction of Influenza B virus and the difference of other character.

Influenza B virus is divided into Yamagata system and Victoria system according to the difference in HA1 district, and their common feature is the conserved regions that 9 bases are arranged at virus genomic 3 ' and 5 ' end, and 10,11 be (the seeing Table) of relative variation.(conserved regions of 3 ' and 5 ' terminal 9 bases of influenza virus shows with thick surplus matrix, HA wherein, and NA, the 6th of the segmental 5 ' end of NS is that the 6th of all the other fragment of T are A).

This shows, seek the Influenza B virus maternal plant of a high yield, the clone who obtains its whole 8 gene fragments carries out reprovision with the HA and the NA fragment of high yield strain gene and epidemic isolates then, make vaccine strain both keep the characteristic of high yield, have the antigenic characteristics of epidemic isolates again, preparing the second type influenza virus vaccine like this, will be the major transformation that influenza vaccines produce.

Summary of the invention

In order to overcome the deficiencies in the prior art part, the object of the present invention is to provide the complete genome sequence of one group of new Influenza B virus high yield strain.

The object of the present invention is to provide one group of plasmid that includes new Influenza B virus complete genome sequence of the present invention.

Another object of the present invention is to provide one group of primer, be used to amplify whole (8) fragment of Influenza B virus, i.e. the complete genome sequence of Influenza B virus.

Another object of the present invention is to provide a kind of high yield recombinant virus that contains the Influenza B virus antigen property.

Another object of the present invention is to provide a kind of high yield recombinant virus that contains Influenza B virus epidemic strain antigen property.

Another object of the present invention is to provide a kind of by the deactivation of Influenza B virus epidemic strain antigen property and/or the second type influenza virus vaccine that the attenuation recombinant virus is formed of containing of the present invention.

In order to finish purpose of the present invention, the invention provides a kind of new Influenza B virus complete genome sequence, this sequence comprises sequence 1, sequence 2, sequence 3, sequence 4, sequence 5, sequence 6, sequence 7, sequence 8.

These sequence write ups are in sequence table, and wherein sequence 1 is the NS sequence, and sequence 2 is the M sequence, and sequence 3 is the NA sequence, and sequence is 4 HA sequences, and sequence 5 is the Np sequence, and sequence 6 is the Pa sequence, and sequence 7 is the Pb2 sequence, and sequence 8 is the Pb1 sequence.

The present invention also provides one group of plasmid that includes new Influenza B virus complete genome sequence of the present invention.Described plasmid comprises: PCDNA3.1-BPB1, PCDNA3.1-BPB2, PCDNA3.1-BPA, PCDNA3.1-BNP, PCDNA3.1-BHA, PCDNA3.1-BNA, PCDNA3.1-BNS, PCDNA-3.1-BM, PHH21-BPB1, PHH21-BPB2, PHH21-PA, PHH21-NP, PHH21-HA, PHH21-NA, PHH21-NS, PHH21-BM, PIVVII-BNS, PIIVII-BM, PIVVII-BHA, PIVVII-BNA, PIVVII-BNP, PIVVII-BPA, PIVVII-BPB2, PIVVII-BPB1, preferably PIVVII-BNS, PIVVII-BMPIVVII-BHA, PIVVII-BNA, PIVV2II-BNP, PIVVII-BPB1, PIVVII-BPB2, PIVV-BPA.

The present invention also provides one group of primer, is used to amplify 8 fragments of the full sequence 1 of Influenza B virus to sequence 8, i.e. the complete genome sequence of Influenza B virus, and this primer comprises:

BM-NS-1：5’-ATCGTCTCTGGGAGCAGAAGCAGAGCA-3’

BM-NS-2：5’-GGCGTCTCGTATTAGTAGTAACAAGAG-3’

BM-U-1：5’-AACGTCTCTGGGAGCAGAAGC-3’

BM-U-2：5’-GGCGTCTCGTATTAGTAGAAAC-3’

BM-PA-1-：5-TTCGTCTCAGGGAGCAGAAGCGGT-3

BM-PB1-1：5-TTCGTCTCTGGGAGCAGAAGCGGAGCTTTAAG-3

BM-PB2-1：-5-TTGGTCTCAGGGAGCAGAAGCGGAGCGTTTTCAAG.-3

The inventor carries out analogy analysis through to the sequence at the Influenza B virus gene fragment two ends among the GENE BANK, design two cover primers, i.e. and BM-NS-1 and BM-NS-2 and BM-U-1 and BM-U-2 whole 8 gene fragments of influenza virus that increase,

With all 8 fragments of RT-PCR method amplification vRNA, with reference to the terminal conserved sequence complementary of viral RNA sequence as primer.

BM-NS-1：5’-ATCGTCTCTGGGAGCAGAAGCAGAGCA-3’

BM-NS-2：5’-GGCGTCTCGTATTAGTAGTAACAAGAG-3’

BM-U-1：5’-AACGTCTCTGGGAGCAGAAGC-3’

BM-U-2：5’-GGCGTCTCGTATTAGTAGAAAC-3’

More than two cover primers can amplify whole 8 fragments of influenza virus.But,, design primer three the big fragments that increase again respectively so be not easy to distinguish because three fragment lengths of influenza virus RNA polymerase are about 2.3Kb

BM-PA-1-：5-TTCGTCTCAGGGAGCAGAAGCGGT-3

BM-PB1-1：5-TTCGTCTCTGGGAGCAGAAGCGGAGCTTTAAG-3

BM-PB2-1：-5-TTGGTCTCAGGGAGCAGAAGCGGAGCGTTTTCAAG.-3

Primer of the present invention can amplify the full genome of high yield strain by the RT-PCR method, and the gene fragment of most Influenza B viruss that can be applied to increase.

The present invention also provides a kind of high yield recombinant virus that contains the Influenza B virus antigen property, and this virus strain contains above-mentioned nucleotide sequence 1 to sequence 8, and the particular case of its sequence is seen sequence table.

The reorganization Influenza B virus strain that obtains through the inventive method on January 15th, 2003 in China Committee for Culture Collection of Microorganisms's common micro-organisms center preservation, B/ capital section/96/2001, its preserving number is 0880.

The present invention also provides 8 plasmid co-transfection mammalian cells using the Influenza B virus gene, and then obtains the method for recombinant virus.

It is a kind of by the deactivation of popular Influenza B virus antigen property and/or the second type influenza virus vaccine that the attenuation recombinant virus is formed of containing of the present invention that the present invention also provides.

The invention still further relates to a kind of method for preparing new Influenza B virus strain of the present invention, this method may further comprise the steps:

With described primer BM-NS-1, BM-NS-2, BM-U-1, BM-U-2, BM-PA-1, BM-PB1-1, BM-PB2-1 amplify the full genomic fragment of Influenza B virus;

The genomic fragment that obtains is linked to each other with the PIVVII carrier;

With PIVVII plasmid transfection 293T that contains described genomic fragment and the MDCK co-cultured cell that obtains;

The supernatant liquor that contains influenza virus of results transfection.

And, the invention still further relates to a kind of method for preparing the second type influenza virus vaccine, this method may further comprise the steps:

On MDCK, cultivate the virus strain of reprovision; Collect this cell culture supernatant; Centrifugal removal fragment; Ultrafiltration obtains concentrating recombinant virus.Described reprovision virus strain is meant and contains sequence 1 of the present invention, sequence 2, sequence 5, sequence 6, sequence 7, the sequence 3 (NA) of sequence 8 and popular influenza virus strain, sequence 4 (HA).

According to well known to a person skilled in the art method, can be to concentrating recombinant virus district band ultracentrifugation; With the PBS washing, centrifugal again.

The present invention also provides a kind of Influenza B virus strain, it is characterized in that its gene order comprises sequence 1 of the present invention, sequence 2, sequence 5, sequence 6, sequence 7, the HA of sequence 8 and popular Influenza B virus strain, NA sequence.

Influenza vaccines of the present invention are a kind of deactivation of reprovision Influenza B virus strain strain and/or the second type influenza virus vaccine of attenuation.

In fact, according to the present invention, the second type influenza virus strain that the contriver obtains has the characteristic of high yield on mammalian cell, and it can overcome the deficiency of producing vaccine with the chicken embryo.This mammalian cell, particularly mdck cell strain can be used as the clone of production of vaccine, and therefore recombinant virus of the present invention has high using value.

In addition, the sequence of six gene fragments of recombinant strain except that HA and NA fragment has played the keying action of decision high yield characteristics, and the advantage of the strain that the inventor packs out is that the time that produces virus after the transfection is fast, only just can produce a large amount of (8 * 10 at 30 hours ⁴PFU/ML) virus.

Should be noted that reorganization Influenza B virus strain of the present invention equal high yield on chicken embryo and mammalian cell, be particularly suitable for becoming the maternal plant of production of vaccine.

The present invention also provides a kind of Influenza B virus strain, and its gene order comprises sequence 1 of the present invention, sequence 2, sequence 5, sequence 6, sequence 7, the HA of sequence 8 and popular Influenza B virus strain, NA sequence.

Description of drawings

I.8Kb, Fig. 1 has band with the 2.3Kb place for using the BM-U primer respectively at 1.1Kb, and sequencing result is respectively the M fragment, NP fragment and 3 big fragments.

Fig. 2 uses the result of NS primer amplification at 1.1Kb, 1.5Kb, and there is band at the 1.8Kb place,, sequencing result confirms to be respectively NS, HA, NA fragment.

Fig. 3 is that the result of 3 big segmental primer amplified can see band respectively at the 2.3KB place.

Fig. 4, enzyme cut the NS fragment.

Fig. 5, right 1NA-PIVV2Nco1 enzyme is cut, and right 2HA-PIVV2Hind3 enzyme is cut, a left side 1,2,3, PB2 Sca1 enzyme is cut.

Fig. 6 SCA1 enzyme is cut the M fragment.

Fig. 7, the NDE1 enzyme is cut PB2.

Fig. 8, Pvu2 and HIind3 enzyme are cut PA.

Fig. 9, left 1PB2 (PB1) SCA1 enzyme is cut the Sca1 quantity not sufficient.A left side 2, the 3Nco1 enzyme is cut, NP-PIVV2.The right side 1, the 2Hind3 enzyme is cut HA-PIVV2.

Figure 10 is plasmid construction figure.

Figure 11 is experimental principle figure.

Figure 12 is epidemic isolates and high yield strain reprovision schematic diagram.

Embodiment

The acquisition of embodiment 1 Influenza B virus full gene group

Strain: B/ capital section/96/01 derives from national influenza center, and B/ Sichuan/379/99 and B/HongKong/330/01 derive from U.S. CDC.

RT-PCR: doubling dilution is carried out in strain B/ capital section/96/01 that screens, the inoculation mdck cell, results virus after 72 hours uses Rneasy KIT (Qiagen) to extract viral RNA, is dissolved in the dilution of 30ul water.

The RT-PCR reaction system was 94 ℃ of sex change 3 minutes, and 55 ℃ were extended 1 hour, and reversed transcriptive enzyme provides for Invitrogen company, and the PCR system is 72 ℃ of 420Sec of 50 ℃ of 45Sec of 94 ℃ of 45Sec then, and the PFU enzyme is available from (Promega) company.

The full gene group of amplification B/ capital section/96/01 uses BM-NS-1 BM-NS-2 primer amplification to go out the HA and the NA fragment of epidemic isolates, and the PCR product is connected on the PGEM-T carrier (Promega company).

The result who obtains through method of the present invention is: referring to Fig. 1, with the result of NS primer amplification at 1.1Kb, 1.5Kb, there is band at 1.8Kb place, the sequencing result confirmation is respectively NS, HA, NA fragment.Referring to Fig. 2, for using the BM-U primer, I.8Kb band is arranged with the 2.3Kb place respectively at 1.1Kb, sequencing result is respectively the M fragment, NP fragment and 3 big fragments.Referring to Fig. 3, be that the result of 3 big segmental primer amplified can see band respectively at the 2.3KB place.Its sequencing result is seen sequence table.

This shows several groups of primers that adopt the present invention's design, be cloned into Influenza B virus B/

Whole 8 the complete gene fragments of capital section/96/01 strain, and be cloned on the PGEM-T carrier, use fluorescent marker method and measured all _cDna sequence dna.Thereby obtain following 8 gene fragments.

The non-coding region of the Influenza B virus that the present invention obtains and and clip size

The reverse conserved regions of gene forward conserved regions

Size

PB1 BM-PB1-1 BM-PB12397

AGCAGAAGCGGAGCTTTAAG AGTAGAAACACG

PB2 BM-PB2-2381 BM-PB2-2381

AGCAGAAGCGGAGCGTTTTC AGTAGAAACACG

PA BM-PA-1 BM-PB2-2381

2309

AGCAGAAGCGGTGCGTTTG AGTAGAAACACG

BM-NS-1 BM-NS-1099

1885

AGCAGAAGCAGA(GTT) AGTAGTAACAAG

NP BM-NS-1 BM-NP-1844

1844

AGCAGAAGCAGA(ACA) AGTAGAAACAGC

BM-NS-1 BM-NS-1099

1559

AGCAGAAGCAGA(GCC) AGTAGTAACAAG

M BM-M-1 BM-M-1191

1191

AGCAGAAGCAGGC(ACGG) AGTAGAAACAAC

NS BM-NS-1 BM-NS-1099

1099

AGCAGAAGCAGA AGTAGTAACAAG

In the present invention, used 8 pUC pUCs, preferred plasmid is respectively PIVVII-BPB1, PIVVII-BNS, PIVVII-BM, PIVVII-BHA, PIVVII-BNA, PIVVII-BNP, PIVVII-BPB2, pack out a strain Influenza B virus behind the PIVVII-BPA cotransfection mammalian cell, and the strain of packing out has been carried out the virulence detection, obtained the virus strain of equal high yield on mammalian cell and chicken embryo.

The structure of embodiment 2 PIVVII plasmids

One: the structure of PIVVII plasmid:

Referring to plasmid figure and the experimental principle shown in Figure 10 and Figure 11.

The characteristics of 1:PIVVII plasmid: the contriver has made up the PIVVII plasmid.The characteristics of this plasmid are promotor and the terminator sequences that has polysaccharase I and polymerase II simultaneously, and the promotor direction of polysaccharase I and polymerase II is opposite.Viral genome is inserted between the BSMB1 site of the promotor of polysaccharase 1 and terminator sequence, under the effect of polysaccharase 1 promotor, transcribe out the genome of virus, under the effect of polymerase II promotor, transcribe out the mRNA of virus, translate the albumen of virus

The construction process of 2:PIVVII plasmid:, use primer with the promotor and the terminator sequence amplification of PHH21 plasmid (Neumann G present):

Upstream: 5 ' ATCCCTAGGGCGGCCGGGAGGGCGTCCCCGGCC3 '

Downstream: 5 ' GTGAAGCTTCGGAGTACCGGTCGACCTCCGAAG3 '

After using AvuII and HindHI double digestion then, be connected to P _cOn the DNA3.1, confirm that through order-checking the sequence of inserting is a target sequence then.

Embodiment 3 virus genomic fragments link to each other with the PIVVII carrier respectively

PIVVII plasmid vector BSMB1 linearization for enzyme restriction with embodiment 2 obtains reclaims the PIVVII fragment that test kit reclaims linearization with Qiagen then.Equally, the target fragment that is connected to the PGEM-T carrier is cut with the BSMB1 enzyme, then, reclaim target fragment.The described fragment of sequence 1-8 is connected respectively on the PIVVII carrier, and system is the 3ul target fragment, 1ul carrier, 1ulT ₄Dna ligase (Promega) 15ulddH ₂O, thus obtain connecting product P IVVII-BX.

Embodiment 4 transforms

The connection product that embodiment 3 is obtained is transformed in the competence bacteria (Sure bacterium), 42 ℃ of heat-shockeds 60 seconds, ice bath 5 minutes, again 37 ℃ of concussions 45 minutes, centrifugal, get precipitation and be coated with flat board, spend the night in 37 ℃ of incubators, choose single colony inoculation next day in the 5mlLB substratum, little upgrading grain after 37 ℃ of concussions are spent the night.

Embodiment 5 enzymes are cut evaluation

With well known to a person skilled in the art method accordingly restriction endonuclease is identified whether target sequence links to each other with carrier.PIVVII-BNS Nde1 Pst1 double digestion wherein, clip size is 1.1Kb 3.5Kb 1.5Kb.

PIVVII-BNP Nco1 enzyme is cut, 500bp 700bp 900bp 1.8Kb.

PIVVII-BM Sca1 enzyme is cut, and clip size is 500bp 300bp 1.1Kb 1.7Kb 3.4Kb.

PIVVII-BHA Nco1 enzyme is cut, and clip size is 1.7Kb 1.5Kb 700bp.

PIVVII-BNA Nco1 enzyme is cut, and clip size is 1.6Kb (2) 700bp.

PIVVII-BPB2 Nde1 enzyme is cut, and clip size is 1.3Kb 900bp 6.7Kb.

PIVVII-BPB1 Nde1 enzyme is cut, and clip size is 500bp, 700bp, 900bp, 1.5Kb, 3.7Kb.

PIVVII PA enzyme is cut, and clip size is 1.0Kb, 1.6Kb, 4.7Kb.

Wherein: the result that enzyme is cut is: referring to following each the description of the drawings.

Fig. 4, enzyme cut the NS fragment.

Fig. 5, right 1NA-PIVV2Nco1 enzyme is cut, and right 2HA-PIVV2Hind3 enzyme is cut, a left side 1,2,3, PB2 Sca1 enzyme is cut.

Fig. 6 SCA1 enzyme is cut the M fragment.

Fig. 7, the NDE1 enzyme is cut PB2.

Fig. 8, Pvu2 and HIind3 enzyme are cut PA.

Fig. 9, left 1PB2 (PB1) SCA1 enzyme is cut the Sca1 quantity not sufficient.A left side 2, the 3Nco1 enzyme is cut, NP-PIVV2.The right side 1, the 2Hind3 enzyme is cut HA-PIVV2.

Embodiment 6 transfections

293T and mdck cell are cultivated altogether at 12.5CM ²Tissue Culture Flask in treat that cell 80% in flakes after, 1ug/DNA Per and 2ulLF2000 are blended in room temperature placement 45 minutes, join then in the cell bottle, after 6 hours, keeping liquid with optim-MEM continues to hatch in 33 ℃ of incubators, add TPCK-Trypsin to final concentration 1ug/ml behind 30 hours of transfection, gathered in the crops respectively 24 hours, the viral suspension of 48 hours and 72 hours is inoculated mdck cell.

The continuous passage of embodiment 7 recombinant viruses

The inoculation recombinant virus the day before yesterday with cell inoculation in culturing bottle, second angel's cell count reaches 3-4 * 10 ⁶, the MOI value of virus inoculation is 1 * 10 ^-4TCID50/, 1 * 10 ^-5The every cell of CID50/ is kept liquid and is comprised TPCK-Trypsin, adds respectively at metainfective 24,48 hours to make the final concentration of TPCK-Trypsin reach 1ug/ml again, cultivates 72 or 96 hours results virus at 33 ℃.

The detection of embodiment 8 recombinant virus output

Recombinant virus is inoculated the first-generation behind the mdck cell, and in the 5th generation, in the tenth generation and the 15 generation, done the detection of TCID50 and PFU respectively.

TCID50 detects: cell is cultivated into individual layer on 24 orifice plates, virus is carried out doubling dilution, inoculating cell is to 24 orifice plates, 4 holes of the parallel adding of each extent of dilution, every hole adds 200UL, hatches after 1 hour for 33 ℃ and uses HANK ' S to wash, and adds the liquid of keeping that comprises TPCK-Trypsin then.Added TPCK-Trypsin respectively at metainfective 24,48,72 hours, frozen in metainfective 72 hours results virus in-70 ℃ of refrigerator overnight, calculated TCID50 according to HAU in second day.

PFU detects: virus is carried out doubling dilution, be inoculated in little square vase, every little square vase adds 500UL viral dilution liquid, 33 ℃ hatch 1 hour after, with the flushing of HANKS liquid, add the first layer covering liquid then, hatch adding second layer covering liquid after 72 hours, count plaque after 24 hours for 33 ℃.

Order-checking: the metainfective first-generation and the 15 generation viral suspension extraction viral RNA are measured the segmental dna sequence dna of HA.

The result shows the feature of recombinant virus: use reverse genetics with 8 plasmid co-transfection eukaryotic cells after, obtained recombinant virus, strain for high yield on mdck cell, at the also very high evidence of output on the chicken embryo be: recombinant virus goes down to posterity on the chicken embryo, wherein the HAU that the suspension of 24 hours supernatants inoculation mdck cells after 1 generation inoculates the chicken embryo after the transfection is up to 1280, uploads for 15 generations at mdck cell.First-generation HAU is 1: 40 to the 15th generation 1: 640 on mdck cell, and the titre of infective virus is from 8 * 10 of the first-generation ⁴PFU, 6.5Log ₁₀ ^TCID50To 2 * 10 of the 15 generation ⁹PFU, 8.5Log ₁₀ ^TCID50, the virulence of virus has the trend of increase after 15 generations as can be seen, and high yield characteristics is maintained and improves.HA is checked order after the sequence of the HA of the sequence of the HA of comparison the 15th generation virus and 24 hours results virus of transfection is in full accord.

Embodiment 9 makes up the second type influenza virus recombinant virus that contains the epidemic isolates antigen property

Referring to Figure 12, the HA of epidemic isolates, remaining sequence 1 of the present invention of NA fragment and high yield strain, sequence 2, sequence 5, sequence 6, sequence 7, mammalian cell such as 6 fragment cotransfections such as sequence 8 grades can obtain reprovision virus as vaccine strain.

Make up recombinant virus (the Eight-plasmid system for rapid generation of influenza virus vaccines.Vaccine.2002 Aug 19 that contains the epidemic isolates antigen property with reference to the method that well known to a person skilled in the art; 20 (25-26): 3165-70.).

In other words, experimental technique is with embodiment 6, and different is with V system is the HA of B/HongKong/330/01 B/ Sichuan/379/99 and the PB2 of NA fragment and B/ capital section/96/01 with Y, PB1, PA, M, NS, NP reprovision, produce the reprovision virus of 6+2, behind transfection mdck cell and the inoculated into chick embryo, still keep the characteristic of high yield, consequent reprovision virus can be used as vaccine strain.

Embodiment 10 preparation second type influenza virus vaccines

On Rotary Machine, cultivate the mdck cell of the virus strain that contains reprovision; 33 degrees centigrade of culture temperature 72-96 hour, are collected this cell culture supernatant then; Centrifugal 12000-15000RPM removes fragment; Ultrafiltration obtains concentrating recombinant virus, and wherein said reprovision virus strain is meant and contains sequence 1 of the present invention, sequence 2, sequence 5, sequence 6, sequence 7, the HA of sequence 8 and popular influenza virus strain, NA sequence.

To the virus that obtains adopt well known to a person skilled in the art the method deactivation after, add suitable adjuvant and make operable Influenza B virus vaccine.

Sequence table

＜110〉CDC virus disease control institute

＜120〉reorganization Influenza B virus strain of high yield and uses thereof

<130>

<160>8

<170>PatentIn?version?3.1

<210>1

<211>1099

<212>DNA

＜213〉Influenza B virus (influenza B virus)

<400>1

agcagaagca?gagcatttgt?ttagtcactg?gcaaacgaaa?aaatggagga?caacatgatc 60

acaacacaaa?ttgaggtggg?tccgggagca?accaatgcca?ccataaactt?tgaagcagga 120

attttggagt?gctatgaaag?gctttcatgg?caaagagccc?ttgactaccc?tggtcaagac 180

cgcctaaaca?ggctaaagag?aaaattggaa?tcaagaataa?agactcacaa?caaaagtgag 240

cctgaaagta?aaaggatgtc?tcttgaagag?agaaaagcta?ttggggtaaa?aatgatgaaa 300

gtgctcctat?ttatgaaccc?atctgctgga?gttgaagggt?ttgagccata?ttgtacgaaa 360

aatccctcca?atagcaactg?tccgaactgc?aattggtctg?attaccctcc?aacaccagga 420

aagtaccttg?atgacataga?agaagaagaa?ccggagaatg?ttggtgaccc?aactgaaata 480

gtattaaggg?acatgaacaa?cagagatgca?aggcaaaaga?taaaagagga?agtaaacact 540

cagaaagaag?ggaaattccg?tttaacgata?aaaagggata?tacgtaatgt?gttgtccttg 600

agagtgttgg?taaacggaac?attcatcaag?caccctaatg?gatacaagtc?cttatcaact 660

ctgcatagat?tgaatgcata?tgaccagagt?ggaagacttg?ttgctaaact?tgttgctact 720

gatgatctta?cagtggagga?tgaagaagat?ggccatcgga?tcctcaactc?actcttcgag 780

cgttttaatg?aaggacattc?aaagccaatt?cgagcagctg?aaactgcggt?gggagtctta 840

tcccaatttg?gtcaagagca?ccgattatca?ccagaagaga?gagacaatta?gactggttac 900

ggaagaactt?tatcttttaa?gtaaaagaat?tgatgataac?atattgttcc?acaaaacagt 960

aatagccaac?agctccataa?tagctgacat?gattgtatca?ttatcattat?tggaaacatt 1020

gtatgaaatg?aaggatgtgg?ttgaagtgta?cagcaggcag?tgcttgtgaa?tttaaaataa 1080

aaatcctctt?gttactact 1099

<210>2

<211>1190

<212>DNA

＜213〉Influenza B virus (influenza B virus)

<400>2

agcagaagca?ggcactttct?taaaatgtcg?ctgtttggag?acacaattgc?ctacctgctt 60

tcattgacag?aagatggaga?aggcaaagca?gaactagcag?aaaaattaca?ctgttggttc 120

ggtgggaaag?aatttgacct?agactctgcc?ttggaatgga?taaaaaacaa?aagatgctta 180

actgatatac?agaaagcact?aattggtgcc?tctatctgct?ttttaaaacc?caaagaccag 240

gaaagaaaaa?gaagattcat?cacagagccc?ctatcaggaa?tgggaacaac?agcaacaaaa 300

aagaagggcc?tgattctagc?tgagagaaaa?atgagaagat?gtgtgagctt?ccatgaagca 360

tttgaaatag?cagaaggcca?tgaaagctca?gcgttactat?attgtctcat?ggtcatgtac 420

ctgaatcctg?gaaattattc?aatgcaagta?aaactaggaa?cgctctgtgc?tttgtgcgaa 480

aaacaagcat?cacattcaca?cagggctcat?agcagagcag?cgagatcttc?agtgcccgga 540

gtgagacgag?aaatgcagat?ggtctcagct?atgaacacag?caaaaacaat?gaatggaatg 600

ggaaaaggag?aagacgtcca?aaaactggca?gaagagctgc?aaagcaacat?tggagtattg 660

agatctcttg?gggcaagtca?aaagaatggg?gaaggaattg?caaaggatgt?aatggaagtg 720

ctaaagcaga?gctctatggg?aaattcagct?cttgtgaaga?aatacctata?atgctcgaac 780

catttcagat?tctttcaatt?tgttctttta?ttttatcagc?tctccatttc?atggcttgga 840

caataggaca?tttgaatcaa?ataaaaagag?gagtaaacat?gaaaatacga?ataaagggac 900

caaataaaga?gacaataaac?agagaggtat?caattttgag?acacagttac?caaaaagaaa 960

tccaggccaa?agaaacaatg?aaggaagtac?tctctgacaa?catggaggta?ttgagtgacc 1020

acatagtaat?tgaggggctt?tctgctgaag?agataataaa?aatgggtgaa?acagttttgg 1080

aggtagaaga?attgcattaa?attcaatttt?tactgtactt?cttactatgc?atttaagcaa 1140

attgtaatca?atgtcagcaa?ataaactgga?aaaagtgcgt?tgtttctact 1190

<210>3

<211>1558

<212>DNA

＜213〉Influenza B virus (influenza B virus)

<400>3

agcagaagca?gagcatcttc?tcaaaaactg?aggcaaatag?gccaaaaatg?aacaatgcta 60

ccttcaacta?tacaaacgtt?aaccctattt?ctcacatcag?ggggagtgtt?attatcacta 120

tatgtgtcag?cttcactgtc?atacttacta?tattcggata?tattgctaaa?attttcacaa 180

acagaaataa?ctgcaccaac?aatgccattg?gattgtgcaa?acgcatcaaa?tgttcaggct 240

gtgaaccgtt?ctgcaacaaa?aggagtgaca?cttcttcccc?cagaaccgga?gtggacgtac 300

cctcgtttat?cttgcccggg?ctcaaccttt?cagaaagcac?tcctaattag?ccctcataga 360

ttcggagaaa?ccaaaggaaa?ctcagctccc?ttgataataa?gggaaccttt?tattgcttgt 420

ggaccaaagg?aatgcaaaca?ctttgctcta?acccattatg?cagctcaacc?agggggatac 480

tacaatggaa?caagagaaga?cagaaacaag?ctgaggcatc?taatttcagt?caaattgggc 540

aaaatcccaa?cagtagaaaa?ctctattttc?cacatggcag?cttggagcgg?gtccgcatgc 600

catgatggta?gagaatggac?atatatcgga?gttgatggcc?ctgacagtaa?tgcattgctc 660

aaaataaaat?atggagaagc?atatactgac?acataccatt?cctatgcaaa?aaacatccta 720

aggacacaag?aaagtgcctg?caattgcatc?gggggagatt?gttatcttat?gataactgat 780

ggctcagctt?cagggattag?tgaatgcaga?ttccttaaga?ttcgagaggg?ccgaataata 840

aaagaaatat?ttccaacagg?aagagtaaaa?catactgaag?aatgcacatg?cggatttgcc 900

agcaataaaa?ccatagaatg?tgcctgtaga?gataacagtt?acacagcaaa?aagacccttt 960

gtcaaattaa?atgtggagac?tgatacagcg?gaaataagat?tgatgtgcac?agagacttat 1020

ttagacaccc?ccagaccaga?tgatggaagc?ataacagggc?cttgcgaatc?taatgggaac 1080

aaagggagtg?gaggcatcaa?gggaggattt?gttcatcaaa?gaatggcatc?caagattgga 1140

aggtggtact?ctcgaacgat?gtctaaaact?aaaagaatgg?ggatgggact?gtatgtcaag 1200

tatgatggag?acccatggac?tgacagtgaa?gcccttgctc?ttagtggagt?aatggtttca 1260

atggaagaac?ctggttggta?ttcctttggc?ttcgaaataa?aagataagaa?atgtgatgtc 1320

ccctgtattg?ggatagaaat?ggtacatgat?ggtgggaaaa?cgacttggca?ctcagcagca 1380

acagccattt?actgtttaat?gggctcagga?caactactgt?gggacactgt?cacaggtgtt 1440

gatatggctc?tgtaatggag?gaatggttga?gtctgttcta?aaccctttgt?tcctattttg 1500

tttgaacaat?tgtccttact?gaacttaatt?gtttctgaaa?aatgctcttg?ttactact 1558

<210>4

<211>1882

<212>DNA

＜213〉Influenza B virus (influenza B virus)

<400>4

agcagaagca?gagcattttc?taatatccac?aaaatgaagg?caataattgt?actactcatg 60

gtagtaacat?ccaatgcaga?tcgaatctgc?actgggataa?catcttcaaa?ctcacctcat 120

gtggtcaaaa?cagctactca?aggggaggtc?aatgtgactg?gtgtgatacc?actgacaaca 180

acaccaacaa?aatctcattt?tgcaaatctc?aaaggaacaa?ggaccagagg?gaaactatgc 240

ccagactgtc?tcaactgcac?agatctggat?gtggccttgg?gcagaccaat?gtgtgtgggg 300

accacacctt?cggcaaaagc?ttcaatactc?cacgaagtca?gacctgttac?atccgggtgc 360

tttcctataa?tgcacgacag?aacaaaaatc?agacaactac?ccaatcttct?cagaggatat 420

gaaaatatca?ggttatcaac?ccaaaacgtt?atcgatgcag?aaaaggcacc?aggaggaccc 480

tacagacttg?gaacctcagg?atcttgccct?aacgctacca?gtaaaagcgg?atttttcgca 540

acaatggctt?gggctgtccc?aaaggacaac?aacaaaaatg?caacgaaccc?actaacagta 600

gaagtaccac?acgtttgtac?agaaggggaa?gaccaaatta?ctgtttgggg?gttccattca 660

gataacaaaa?ctcaaatgaa?aaacctctat?ggagactcaa?atcctcaaaa?gttcacctca 720

tctgctaatg?gagtaaccac?acattatgtt?tctcagattg?gcggcttccc?agatcaaaca 780

gaagacggag?gactaccaca?aagcggcaga?attgttgttg?attacatggt?gcaaaaacct 840

gggaaaacag?gaacaattgt?ctatcaaaga?ggtgttttgt?tgcctcaaaa?ggtgtggtgc 900

gcgagtggca?ggagcaaagt?aataaaaggg?tccttgcctt?taattggtga?agcagattgc 960

cttcatgaaa?aatacggtgg?attaaacaaa?agcaagcctt?actacacagg?agaacatgca 1020

aaagccatag?gaaattgccc?aatatgggtg?aaaacacctt?tgaagcttgc?caatggaacc 1080

aaatatagac?ctcctgcaaa?actattaaag?gaaaggggtt?tcttcggagc?tattgctggt 1140

ttcctagaag?gaggatggga?aggaatgatt?gcaggttggc?acggatacac?atctcacgga 1200

gcacatggag?tggcagtggc?ggcagacctt?aagagtacgc?aagaagctat?aaacaagata 1260

acaaaaaatc?tcaattcttt?gagtgagcta?gaagtaaaga?atcttcaaag?actaagtggt 1320

gccatggatg?aactccacaa?cgaaatactc?gagctggatg?agaaagtgga?tgatctcaga 1380

gctgacacta?taagctcgca?aatagaactt?gcagtcttgc?tttccaacga?aggaataata 1440

aacagtgaag?atgagcatct?attggcactt?gagagaaaac?taaagaaaat?gctgggtccc 1500

tctgctgtag?acataggaaa?tggatgcttc?gaaaccaaac?acaagtgcaa?ccagacctgc 1560

ttagacagga?tagctgctgg?cacctttaat?gcaggagaat?tttctctccc?cacttttgat 1620

tcactgaaca?ttactgctgc?atctttaaat?gatgatggat?tggataacca?tactatactg 1680

ctctattact?caactgctgc?ttctagtttg?gctgtaacat?tgatgctagc?tatttttatt 1740

gtttatatgg?tctccagaga?caacgtttca?tgctccatct?gtctataagg?aagattaagc 1800

cttgtatttt?cctttattgc?agtgcttgtt?tgcttgtcat?cattacaaag?aaacgttatt 1860

gaaaaatgct?cttgttacta?ct 1882

<210>5

<211>1844

<212>DNA

＜213〉Influenza B virus (influenza B virus)

<400>5

agcagaagca?cagcattttc?ttgtgaactt?caagcaccaa?taaaagaact?gaaaatcaaa 60

atgtccaaca?tggatattga?cggtatcaac?actgggacaa?ttgacaaaac?accggaggaa 120

ataacttctg?gaaccagtgg?gacaaccaga?ccaatcatca?gaccagcaac?ccttgcccca 180

ccaagcaaca?aacgaacccg?gaacccatcc?ccggaaagag?caaccacaag?cagtgaagct 240

gatgtcggaa?ggaaaaccca?aaagaaacag?accccgacag?agataaagaa?gagcgtctac 300

aatatggtag?tgaaactggg?cgaattctat?aaccagatga?tggttaaagc?tggactcaac 360

gatgacatgg?agagaaatct?aatccaaaat?gcgcatgctg?tggaaagaat?tctattggct 420

gccactgatg?acaagaaaac?tgaattccag?aagaaaagaa?atgccagaga?tgtcaaagaa 480

gggaaagaag?aaatagacca?caacaaaaca?ggaggcacct?tttacaagat?ggtaagagat 540

gataaaacca?tctacttcag?ccctataaga?attacctttt?taaaagaaga?ggtgaaaaca 600

atgtacaaaa?ccaccatggg?gagtgatggc?ttcagtggac?taaatcacat?aatgattggg 660

cattcacaga?tgaatgatgt?ctgtttccaa?agatcaaagg?cactaaaaag?agttggactt 720

gacccttcat?taatcagtac?ctttgcagga?agcacaatcc?ccagaagatc?aggtgcaact 780

ggtgttgcga?tcaaaggagg?tggaacttta?gtggctgaag?ccattcgatt?tataggaaga 840

gcaatggcag?acagaggact?attgagagac?atcaaagcca?agactgccta?tgaaaagatt 900

cttctgaatc?taaaaaacaa?atgctctgcg?ccccaacaaa?aggctctagt?tgatcaagtg 960

atcggaagta?gaaatccagg?gattgcagac?attgaagatc?taaccctgct?tgctcgtagt 1020

atggtcgttg?ttaggccctc?tgtggcgagc?aaagtagtgc?ttcccataag?catttacgcc 1080

aaaatacctc?aactagggtt?caatgttgaa?gagtactcca?tggttggcta?cgaagccatg 1140

gctctttaca?atatggcaac?acctgtttcc?atattaagaa?tgggggatga?tgcaaaagat 1200

aaatcgcaat?tattcttcat?gtcttgcttc?ggggctgcct?atgaagacct?gagagttttg 1260

tctgcattaa?caggcacaga?attcaagcct?agatcagcat?taaaatgcaa?gggtttccat 1320

gttccagcaa?aggaacaggt?ggaaggaatg?ggggcagctc?tgatgtccat?caagctccag 1380

ttttgggctc?caatgaccag?atctggggga?aacgaagtag?gtggagacgg?agggtctggc 1440

caaataagtt?gcagcccagt?gtttgcagtg?gaaagaccta?ttgctctaag?caagcaagtt 1500

gtaagaagaa?tgctgtcgat?gaatattgag?ggacgtgatg?cagatgtcaa?aggaaatcta 1560

ctcaagatga?tgaatgactc?aatggctaag?aaaaccagtg?gaaatgcttt?cattgggaag 1620

aaaatgtttc?aaatatcaga?caaaaacaaa?accaatccag?ttgaaattcc?aattaagcag 1680

accatcccca?atttcttctt?tgggagggac?acagcagagg?attacgatga?cctcgattat 1740

taaagcaaca?aaatagacac?tatgactgtg?attgtttcaa?tacgtttgga?atgtgggtgt 1800

ttactcttat?taaaataaat?ataaaaaatg?ctgttgtttc?tact 1844

<210>6

<211>2305

<212>DNA

＜213〉Influenza B virus (influenza B virus)

<400>6

agcagaagcg?gtgcgtttga?tttgccataa?tggatacttt?tatcacaaga?aacttccaga 60

ctacaataat?acaaaaggcc?aaaaacacaa?tggcagaatt?tagtgaagat?cctgaactac 120

aaccagcaat?gctattcaac?atctgcgtcc?atctagaggt?ttgctatgta?ataagtgaca 180

tgaatttcct?tgatgaagaa?ggaaaagcat?atacagcatt?agaaggacaa?gggaaagaac 240

aaaacttgag?accacaatat?gaagtaattg?agggaatgcc?aagaactata?gcatggatgg 300

tccaaagatc?cttagctcaa?gagcatggaa?tagagactcc?aaagtatctg?gctgatttgt 360

ttgattataa?aaccaagaga?tttatagaag?tcggaataac?aaaaggattg?gctgatgatt 420

acttttggaa?aaagaaagaa?aaactgggaa?atagcatgga?actgatgata?ttcagctaca 480

atcaagacta?ttcgttaagt?aatgaatcct?cattggatga?ggaagggaaa?gggagagtgc 540

taagcagact?cacagaactt?caggccgaat?taagtctaaa?aaacctatgg?caagttctca 600

taggagaaga?agatgttgaa?aagggaattg?actttaaact?tggacaaaca?atatctagac 660

taagggatat?atctgttcca?gctggtttct?ccaattttga?aggaatgagg?agctacatag 720

acaatataga?tcctaaagga?gcaatagaga?gaaatctagc?aaggatgtct?cccttagtat 780

cagccacacc?taaaaagttg?aaatgggagg?acctaagacc?aatagggcct?cacatttaca 840

accatgagct?accagaagtt?ccatacaatg?cctttcttct?aatgtctgat?gaattggggc 900

tggccaatat?gactgaggga?aggtccaaaa?aaccgaagac?attagccaaa?gaatgtctag 960

aaaagtactc?aacactaagg?gatcaaactg?acccaatatt?aataatgaaa?agcgaaaaag 1020

ctaacgaaaa?tttcctatgg?aaactttgga?gggactgtgt?aaatacaata?agtaatgagg 1080

aaatgagtaa?cgagttacag?aaaaccaatt?atgccaaatg?ggccacaggg?gatggattga 1140

cataccagaa?aataatgaaa?gaagtagcaa?tagacgacga?aacaatgtgc?caagaagagc 1200

ctaaaatccc?taacaaatgt?agagtggcag?cttgggttca?aacagagatg?aatctattga 1260

gcactctgac?aagtaaaaga?gctctggact?tgccagaaat?agggccagac?gtggcccccg 1320

tggagcatat?agggagtgaa?agaaggaaat?actttgttaa?tgaaatcaac?tattgtaagg 1380

cctctacagt?tatgatgaag?tatgtgcttt?tccacacttc?attattgaat?gaaagcaatg 1440

ccagcatggg?aaagtacaaa?gtaataccaa?taaccaatag?agtagtaaat?gaaaaaggag 1500

aaagtttcga?catgctttat?ggtctggcgg?ttaaaggaca?atctcatctg?aggggagata 1560

ctgatgtcgt?aacagttgta?actttcgaat?ttagtagtac?agatcccaga?gtggactcag 1620

gaaagtggcc?aaaatatact?gtgtttagga?ttggctccct?atttgtgagt?gggagggaaa 1680

aatctgtgta?cctatattgc?cgagtaaatg?gcacaaataa?gatccaaatg?aaatggggaa 1740

tggaagctag?aagatgtctg?cttcaatcaa?tgcaacaaat?ggaagcaatt?gttgaacaag 1800

aatcatcggt?acaaggatat?gacatgacca?aagcttgttt?caagggagac?agaataaata 1860

gccccaaaac?tttcagtatt?gggactcaag?aaggaaaact?agtaaaagga?tcctttggaa 1920

aagcactaag?agtaatattt?actaaatgtt?tgatgcacta?tgtatttgga?aatgcccaat 1980

tggaggggtt?tagtgccgag?tctagaagac?ttctactgtt?gattcaagca?ttaaaggaca 2040

gaaagggccc?ttgggtgttc?gacttagagg?gaatgtattc?tggaatagaa?gaatgtatta 2100

gtaacaaccc?ttgggtaata?cagagtgcat?actggttcaa?tgaatggttg?ggctttgaaa 2160

aggaggggag?taaagtatta?gaatcagtag?atgaaataat?ggatgaataa?aaggacatag 2220

tactcaattt?agtactattt?tgttcattat?gtatctaaac?atccaataaa?aagaatcaag 2280

aatcaaaaat?gcacgtgttt?ctact 2305

<210>7

<211>2397

<212>DNA

＜213〉Influenza B virus (influenza B virus)

<400>7

agcagaagcg?gagcgttttc?aagatgacat?tggctaaaat?tgaattgtta?aaacaactgt 60

taagggacaa?tgaagccaaa?acagtattga?aacaaacaac?ggtagaccaa?tacaacataa 120

taagaaaatt?caatacatca?agaattgaaa?agaatccttc?attaaggatg?aagtgggcaa 180

tgtgttccaa?ttttcccttg?gctctgacca?agggtgacat?ggcaaacaga?atccccttgg 240

aatacaaggg?aatacaactt?aaaacaaatg?ctgaagacat?aggaactaaa?ggccaaatgt 300

gctcaatagc?agcagttacc?tggtggaata?catatggacc?aataggagat?actgaaggtt 360

ttgaaaaggt?ctatgaaagc?tttttcctca?gaaagatgag?acttgacaat?gccacttggg 420

gccgaataac?ttttggccca?gttgaaagag?taagaaaaag?ggtactgcta?aaccctctaa 480

ccaaggaaat?gcctccagat?gaagcaagta?atgtgataat?ggaaatattg?ttccctaagg 540

aagcaggaat?accaagagaa?tctacttgga?tacataggga?actgataaaa?gaaaaaagag 600

aaaaattgaa?aggaacgatg?ataactccca?ttgtactggc?atacatgctt?gagagggaat 660

tggttgccag?aagaaggttc?ctgccggtgg?caggagcaac?atcagctgag?ttcatagaaa 720

tgctacactg?cttacaaggt?gaaaattgga?gacaaatata?tcacccagga?gggaataaac 780

ttactgaatc?taggtctcaa?ttgatgattg?tggcttgtag?aaagataatc?agaagatcaa 840

tagtcgcatc?aaacccattg?gagctagctg?tggaaattgc?aaacaagact?gtaatagata 900

ctgaaccttt?gaaatcatgt?ctgacagcca?tagacggagg?tgatgtagcc?tgtgacataa 960

taagagctgc?attagggcta?aagatcagac?aaagacaaag?atttggacga?cttgaactaa 1020

agagaatatc?aggaagagga?ttcaaaaatg?atgaagaaat?attaatcgga?aacggaacaa 1080

tacagaagat?tggaatatgg?gacggagaag?aggagttcca?tgtaagatgt?ggtgaatgca 1140

ggggaatatt?aaaaaagagc?aaaatgagaa?tggaaaaact?actgataaat?tcagctaaaa 1200

aggaggacat?gaaagattta?ataatcttgt?gcatggtatt?ttctcaagac?actaggatgt 1260

tccaaggagt?gaggggagaa?ataaattttc?ttaatagagc?aggccaactt?ttatctccaa 1320

tgtaccaact?ccaaagatat?tttttgaaca?gaagtaacga?tctctttgat?caatgggggt 1380

atgaggaatc?acccaaagca?agcgagctac?atgggataaa?tgaattaatg?aatgcatctg 1440

actacacttt?gaaaggggtt?gtagtaacaa?aaaatgtgat?tgatgatttt?agttctactg 1500

aaacagaaaa?agtatctata?acaaaaaatc?ttagtttgat?aaaaaggact?ggggaagtca 1560

taatgggggc?caatgacgta?agtgaattag?aatcacaagc?tcagctaatg?ataacatatg 1620

atacacctaa?gatgtgggag?atgggaacaa?ccaaagaact?ggtgcaaaac?acctatcaat 1680

gggtgctaaa?aaatttggta?acactgaagg?ctcagtttct?tctaggaaaa?gaagacatgt 1740

tccaatggga?tgcatttgaa?gcatttgaaa?gcataattcc?ccagaaaatg?gctggccagt 1800

acagtggatt?tgcaagagca?gtgctcaaac?aaatgagaga?ccaagaggtc?atgaaaactg 1860

accagttcat?aaagttgttg?cccttttgtt?tctcaccacc?aaaattaagg?agcaatgggg 1920

agccttatca?gtttttgagg?cttgtattga?agggaggagg?agaaaatttc?atcgaagtaa 1980

ggaaagggtc?tcctctattc?tcttacaatc?cacaaacaga?agtcctaact?atatgcggca 2040

gaatgatgtc?attaaaggga?aaaattgaag?atgaagaaag?aaatagatca?atggggaatg 2100

cagtactggc?gggctttctt?gttagtggca?agtatgaccc?ggatcttgga?gatttcaaaa 2160

ctattgaaga?acttgaaaag?ctaaaaccgg?gggagaaagc?aaacatctta?ctttatcaag 2220

gaaaacccgt?taaagtagtt?aaaaggaaaa?gatatagtgc?tttatccaat?gacatttcac 2280

agggaattaa?gagacaaaga?atgacagttg?agtccatggg?gtgggccttg?agctaatata 2340

aatttatcca?ttaattcaat?aaacacaatt?gattgaaaaa?atgctcgtgt?ttctact 2397

<210>8

<211>2369

<212>DNA

＜213〉Influenza B virus (influenza B virus)

<400>8

agcagaagcg?gagcttttaa?gatgaatata?aatccttatt?ttctcttcat?agatgtaccc 60

atacaggcag?caatttcaac?aacattccca?tacaccggtg?ttccccctta?ttcccatgga 120

acgggaacag?gccacacaat?agacaccgtg?atcagaacac?atgagtactc?gaacaaggga 180

aaacaatatg?tttctgacat?cacaggatgt?acaatggtag?atccaacaaa?tggaccatta 240

cccgaagaca?atgagccaag?tgcctatgca?caattagatt?gcgttctgga?ggctttggat 300

agaatggatg?aggaacatcc?aggtctgttt?caggcagcct?cacagaatgc?catggaggca 360

ctaatggtca?caactgtaga?caaattgacc?caggggagac?agacttttga?ttggacagta 420

tgtagaaacc?agcctgctgc?aacggcacta?aacacaacaa?taacctcctt?taggttgaat 480

gatttgaatg?gagctgacaa?gggtggattg?gtaccctttt?gccaagatat?cattgattca 540

ttggacaagc?ctgaaatgac?tttcttctca?gtaaagaata?taaagaaaaa?gttgcctgca 600

aaaaacagaa?agggtttcct?cataaagaga?ataccaatga?aagtaaaaga?caggatatcc 660

agagtggaat?acatcaaaag?agcattgtca?ttaaacacaa?tgacaaaaga?tgctgaaagg 720

ggcaaactaa?aaagaagagc?gattgcaacc?gctgggatgc?aaatcagagg?gtttgtatta 780

gtggttgaaa?acttggctaa?aaatatctgt?gaaaatctag?aacaaagtgg?tttgcccgta 840

ggtggaaatg?aaaagaaagc?caaactgtca?aatgcagtgg?ccaaaatgct?cagtaactgc 900

ccaccgggag?ggatcagcat?gacagtaaca?ggagacaata?ctaaatggaa?tgaatgctta 960

aatccaagaa?tctttttggc?tatgactgaa?agaataacca?gagacagccc?aatttggttc 1020

cgggattttt?gtagtatagc?accggtcttg?ttctccaata?aaatagccag?attgggaaaa 1080

ggatttatgg?taacaagtaa?aacaaaaaga?ctgaaggctc?aaataccttg?tcctgatctg 1140

tttagcatac?cattagaaag?atataatgaa?gaaacaaggg?caaaattaag?aaagctgaaa 1200

ccattcttca?atgaagaagg?aacggcatct?ttgtcgcctg?gaatgatgat?gggaatgttt 1260

aatatgctat?ctaccgtgtt?gggagtagcc?gcactaggta?tcaaaaacat?tggaaacaaa 1320

gaatacttat?gggatggact?gcaatcttct?gatgattttg?ctctgtttgt?taatgcaaaa 1380

gatgaagaga?catgtatgga?agggataaac?gacttttacc?gaacatgtaa?attattggga 1440

ataaatatga?gcaaaaagaa?aagttactgt?aacgaaactg?gaatgtttga?atttacaagc 1500

atgttctata?gagatggatt?tgtatctaat?tttgcaatgg?aaattccttc?atttggagtt 1560

gctggagtaa?atgaatcagc?agatatggca?ataggaatga?caataataaa?gaacaatatg 1620

attaacaatg?ggatgggccc?agcaacagca?caaacagcca?tacaattgtt?catagctgat 1680

tataggtaca?cctacaaatg?ccacagggga?gattccaaag?tggaaggaaa?aagaatgaaa 1740

attataaagg?agctatggga?aaacactaaa?ggaagagatg?gtctgttagt?ggcagatggt 1800

gggcccaaca?tttacaattt?gagaaactta?catatcccag?aaatagtgtt?gaagtacaat 1860

ctaatggacc?ctgaatacaa?agggcggtta?cttcatcctc?aaaatccctt?tgtaggacat 1920

ttgtctattg?aaggcatcaa?agaagcagat?ataaccccag?cacatggtcc?cgtgaagaaa 1980

atggattatg?atgcagtatc?tgggactcat?agttggagaa?ctaaaaggaa?cagatctata 2040

ctaaatactg?atcagaggaa?catgattctt?gaggaacaat?gctacgctaa?gtgttgcaac 2100

ctttttgagg?cctgttttag?cagtgcatca?tacaggaaac?cagtaggtca?gcacagcatg 2160

cttgaagcta?tggcccatag?attaagaatg?gatgcacgac?tagattatga?atcaggaaga 2220

atgtcaaagg?atgattttga?gaaagcaatg?gctcaccttg?gtgagattgg?gtacacataa 2280

gctccgaaga?tgtctatggg?gttattggtc?atcattggat?acatgtgata?aacaaatgat 2340

taaaatgaaa?aaaggctcgt?gtttctact 2369

Claims (13)

1, a kind of new Influenza B virus complete genome sequence with mammalian cell high yield feature is characterized in that this sequence comprises sequence 1, sequence 2, sequence 3, sequence 4, sequence 5, sequence 6, sequence 7, sequence 8.

2, a kind of plasmid that includes the described Influenza B virus gene order of claim 1.

3, plasmid according to claim 1 is characterized in that described plasmid comprises: PCDNA3.1-BPB1, PCDNA3.1-BPB2, PCDNA3.1-BPA, PCDNA3.1-BNP, PCDNA3.1-BHA, PCDNA3.1-BNA, PCDNA3.1-BNS, PCDNA-3.1-BM, PHH21-BPB1, PHH21-BPB2, PHH21-PA, PHH21-NP, PHH21-HA, PHH21-NA, PHH21-NS, PHH21-BM, PIVVII-BNS, PIIV II-BM, PIVV II-BHA, PIVV II-BNA, PIVV II-BNP, PIVV II-BPA, PIVV II-BPB2, PIVV II-BPB1.

4, plasmid according to claim 3 is characterized in that described plasmid comprises PIVV II-BNS, PIVVII-BM, PIVV II-BHA, PIVV II-BNA, PIVV2 II-BNP, PIVV II-BPB1, PIVVII-BPB2 and PIVV-BPA.

5, one group of primer, the gene fragment of the Influenza B virus that is used to increase is characterized in that this primer comprises:

BM-NS-1：?5’-ATCGTCTCTGGGAGCAGAAGCAGAGCA-3’

BM-NS-2：?5’-GGCGTCTCGTATTAGTAGTAACAAGAG-3’

BM-U-1： 5’-AACGTCTCTGGGAGCAGAAGC-3’

BM-U-2： 5’-GGCGTCTCGTATTAGTAGAAAC-3’

BM-PA-1-：5-TTCGTCTCAGGGAGCAGAAGCGGT-3

BM-PB2-1：5-TTCGTCTCTGGGAGCAGAAGCGGAGCGTTTTTCAAG-3

BM-PB1-1：-5-TTGGTCTCAGGGAGCAGAAGCGGAGCG?TTTTAAG-3

6, a kind of recombinant virus strain that contains Influenza B virus high yield strain antigen property is characterized in that this strain contains the gene order above-mentioned just like claim 1.

7, a kind of reorganization Influenza B virus strain, it is characterized in that this strain on January 15th, 2003 in China Committee for Culture Collection of Microorganisms's common micro-organisms center preservation, B/ capital section/96/2001, its preserving number is 0880.

8, a kind of reorganization Influenza B virus strain as claimed in claim 6 is characterized in that it is adapted at growing on the mammalian cell.

9, reorganization Influenza B virus strain according to claim 8 is characterized in that described mammalian cell is mdck cell and/or human embryo kidney (HEK) epithelial cell 293T cell.

10, a kind of Influenza B virus strain is characterized in that its gene order comprises the sequence 1 in the claim 1, sequence 2, sequence 5, sequence 6, sequence 7, the HA of sequence 8 and popular Influenza B virus strain, NA sequence.

11, a kind of deactivation of Influenza B virus strain as claimed in claim 10 and/or second type influenza virus vaccine of attenuation of containing.

12, a kind of method for preparing new Influenza B virus strain, this method may further comprise the steps:

Use primer BM-NS-1, BM-NS-2, BM-U-1, BM-U-2, BM-PA-1, BM-PB1-1 and BM-PB2-1 amplify the full genomic fragment of Influenza B virus;

Genomic fragment is linked to each other with PIVV II carrier;

With the PIVV II plasmid transfection 293T and the MDCK co-cultured cell that contain described genomic fragment that obtains;

The supernatant liquor that contains influenza virus of results transfection.

13, a kind of method for preparing the second type influenza virus vaccine, this method may further comprise the steps:

On MDCK, cultivate the virus strain of reprovision; Collect this cell culture supernatant; Centrifugal removal fragment; Ultrafiltration obtains concentrating recombinant virus, and wherein said reprovision virus strain is meant and contains sequence 1 of the present invention, sequence 2, sequence 5, sequence 6, sequence 7, the HA of sequence 8 and popular influenza virus strain, NA sequence.

Images