CN101044238A - Method for producing highly sensitive endonucleases, novel preparations of endonucleases and uses thereof - Google Patents

Abstract

The present invention pertains to methods for producing recombinant endonucleases having a high sensitivity, as well as to endonucleases preparations obtained by said methods, and uses thereof, especially for the detection of mismatches.

Description

The production method of the endonuclease of high sensitivity, new product of endonuclease and uses thereof

Technical field

The present invention relates to identify and prepare the special endonuclease of mispairing with high reactivity and susceptibility and wide substrate specificity.

Background technology

At the beginning of the eighties of last century, to gene function has brought sizable hope in order to understand in vivo in the discovery of the possibility of the inner induced mutation of DNA by radiation or chemical.Since then, mutagenesis and natural sequence change be widely used in identifying new function, corresponding to the gene of exceptional function and the avtive spot of a specific protein inside.

Implement a critical aspects of this method, particularly under the situation of point mutation, be the selection to the sudden change detection method, these methods are designed to big section DNA is screened and do not reduce diagnostic sensitivity or specificity, and the information in relevant mutational site can be provided simultaneously.Method based on the DNA of incomplete pairing is arranged in the middle of the most frequently used instrument, and this DNA can in vitro produce by the sex change and the renaturation of two dna moleculars.Use as chemical such as ditch wedding agent or can in these heteroduplex molecules, detect mispairing at the molecule of shearing single stranded DNA on the mispairing site specifically.Alternately, the special endonuclease of strand has been used at mispairing site shearing DNA.The most endonucleases that have been described at present belong to S1/P1 class nuclease.

Nucleases such as S1, P1 and mung-bean nuclease for example belong to and are named as: " S1/P1 family nuclease " or be: the same gang of " S1 family nuclease ", known can being used for cut DNA in the strand zone.But the acid pH optimum value that these nucleases had is in the scope of 4.0-5.0.

This detects for mispairing is disadvantageous, because low pH value helps the DNA depurination and make the DNA duplex instability causing non-specific dna degradation, and reduces susceptibility and the specificity that detects.

Several years ago, people such as OLEYKOWSKI (Nucleic Acids Res, 26,4597-4602,1998) detect the activity of a mispairing endonuclease from different plant milk extracts, it has neutral pH optimum value (approximately pH 8) and finishes a strand at the 3 ' end in mispairing site and cut.The activity that these authors have reported this mispairing endonuclease is relevant with the mannose group glycoprotein (mannosyl glycoproteins) in the extract of clover bud, asparagus, celery and tomato.Enzyme in the celery, be referred to as CEL I, be from stem of celery, to purify by successive ammonium sulfate precipitation step, be attached to a concanavalin A-agarose column and the elution of quilt [α]-d+-seminose, be attached to a phosphocellurose column and by the KCl elution of linear gradient, and use the size exclusion chromatography, fractional separation.Therefore the CEL I goods that obtain comprise the protein band of several 34-39KDa.

People such as YANG (Biochemistry, 39,3533-3541,2000) and PCT application WO 01/62974 described a kind of improved CEL I and purified, it is by using the Alpha-Methyl mannoside to overcome the aggreation of CEL I and endogenous lectin in the purification damping fluid.These files have also disclosed the clone of CEL IcDNA.Based on sequence data, CEL I is designated as a subtribe of S1/P1 family nuclease, and identifies the possible homologue that the gene of the DSA6 (GenBank Nucleotide AF082031) of the ZEN1 (GenBank Nucleotide AB003131) of several BFN1 with Arabidopis thaliana (Arabidopsis thaliana) (GenBank Nucleotide (nucleotide) AY040016), zinnia and tawny daylily is encoded.

CEL I endonuclease enzymic activity has demonstrated the mispairing of replacing for base and the mispairing that causes owing to insertion/deletion condition is high special, and is independent of the flanking sequence environment.Therefore it is of great use as the sudden change detection reagent in comprising diverse ways such as screen mutation.CEL I mispairing detection system is a simple assay method, it needs PCR amplification (pcr amplification), sex change and the annealing of target sequence, to allow between wild-type and mutant allele, generating heteroduplex, the mismatch cleavage of enzyme, and the product analysis by gel electrophoresis.Because its specificity and susceptibility when the mispairing in the big segment DNA is detected, it is more favourable than other popular mispairing detection systems, such as sex change HPLC.

Pass through embodiment, people's (above-cited publication) reports such as people such as OLEYKOWSKI and YANG are used it for the sequence change that detects the human gene (BRCA1 gene) relevant with familial breast cancer, and people such as SOKURENKO (Nucl.Acids Res., 29, e111,2001) disclosed to use it for and detected the sudden change and the polymorphism of genomic dna on a large scale.CEL I also obtains using in the high yield screening of TILLING (target inductive local lesion in the genome (Targeting Induced Local Lesions IN Genomes)), wherein after the chemomorphosis point mutation is screened, or use it for the polymorphism that detects in the natural population, also be known as " Ecotilling " (

Deng the people, Plant Journal, 37,778-786,2004).It has been used in plant (people such as COLBERT, Plant Physiology 126,480-484,2001; People such as TILL, GenomeResearch 13,524-530,2003; People such as PERRY, Plant Physiology 131,866-871,2003) and animal in, zebra fish (people such as WIENHOLDS, Genome Res., 13,2700-2707,2003) for example.PCT application WO 03/066809 proposes to reconfigure among relevant polynucleotide in a kind of method of sequence variation and uses CEL I, and this method is called " by solving the gene rearrangement row of mispairing " (" Genetic Reassortment by Mismatch Resolution " (GRAMMR)).

But the shortcoming of CEL I is the shear efficiency that is had to be changed to another mispairing by a mispairing: under the situation of dna circle with single Nucleotide insertion, and people such as OLEYKOWSKI (Nucleic Acids Res.1998 Oct15; 26 (20): 4597-602) reported that CEL I substrate preferred characteristics is G＞A＞C＞T; Under the mispairing situation that base is replaced, CEL I substrate preferred characteristics is C/C 〉=C/A～C/T 〉=G/G＞A/C～A/A～T/C＞T/G～G/T～G/A～A/G＞T/T.Its effect is at mispairing C/A, C/C, and C/T, G/G are clearly.Observe active the reduction in other mispairing, it is for mispairing T/T nearly unavailable.When needs detected a certain allelotrope in a dna library, the variation on this shearing effect may cause the low accuracy when detecting some sudden change.

Another inconvenience that restriction CEL I uses is the low-yield of available method of purification.People such as OLEYKOWSKI are from containing the CEL I that the proteinic 7 kilograms of stem of celery of about 350 grams have begun to obtain the 0.1 μ g/ μ l of 3ml; Obtain the CEL I of 5 μ g purifying by the purification process that discloses among people such as YANG and the PCT WO 01/62974, specific activity is 3.1 * 107 CEL I units/milligram protein, since 105 kilograms of stem of celery.

In order to obtain more substantial CEL I, having proposed it can produce by recombinant DNA technology.PCT application WO03/066809 has proposed one may suitable carriers and the very big inventory of host cell, comprises almost any known protokaryon or eukaryotic expression system; But the actual unique expression system that discloses is based on the carrier of tobacco mosaic virus (TMV) group in this file.Be used to infect tobacco plant by in described carrier, being fused to the structure that a cDNA who is encoded to this histidine-tagged CEL I of 6-clones.Recombinant C EL I reclaims from the intracellular fluid of infected plant, purifies by the metal affinity chromatography method on nickel-NTA resin.PCT WO 03/066809 is for the not narration of productive rate of the enzyme of purifying.It shows that some natural enzyme of purifying in its activity in GRAMMR reaction and the celery are similar to.An inconvenience of this system is that virus is tended to reorganization, partly or entirely loses this expressing gene.This brings the form that also can produce brachymemma except the CEL I of complete length, has reduced the specific activity of this enzyme.

PCT application WO2004/035771 relates to a kind of method of producing CEL I in yeast.Effect hereto is that use according to codon in the yeast constitutes by the natural DNA sequence of modifying CEL I to a synthetic gene of CELI coding.This file show the recombinant C EL I by this synthetic gene production can discern all possible mispairing group and, and with illustrations identification and the shearing of mispairing A/A.On the other hand, it is to the not narration of mispairing preferred characteristics of described recombinant C EL I.

It seems that from above the whole bag of tricks of present available production recombinant C EL I does not provide and produces any great improvement that natural CEL I compares from celery.They do not mention the problem of natural CEL I substrate preferred characteristics in addition.

And hope can have the single base-pair mismatch of other endonuclease endonuclease capables of picture CELI in neutral pH down cut heteroduplex DNA template, but they have different mispairing preferred characteristics, or preferably, can carry out same good shearing to all mispairing.But, do not identify such endonuclease up to now as yet.

As the active existence of the endonuclease of CEl I in many plants, be in the news (cf. is people such as above-cited OLEYKOWSKI for example, 1998).But bring these active enzymes also not carry out signature, their biochemical characteristic for example substrate preferred characteristics also is not studied, and their sequence is not also identified.On the other hand, the structure homologue of CEL I on the computer silicon chip (in silico) be identified (people such as above-cited YANG, people NucleicAcids Res. such as TILL, 32,2632-41,2004).In them three (BFN1 of Arabidopis thaliana, ZEN1 that youth-and-old-age belongs to and the DSA6 of tawny daylily) have had report to relate to plant withered (169-180 2000 for people such as PEREZ-AMADOR, Plant Physiol.122).But they are not purified, and keep not carrying out signature on the biochemistry: the efficient of particularly in vitro discerning the heteroduplex DNA mispairing is not also tested.Having purified out from spinach is known as a kind of endonuclease of SP, and it is S1/P1 family by ownership based on its activity, and it has neutral pH optimum value.Picture CEL I, this enzyme is sheared the mispairing of insertion/disappearance and base replacement; But those comprise the mispairing (people such as OLEYKOWSKI, Biochemistry, 38,2200-5,1999) of guanine residue its nonrecognition.

In the process of seeking the alternative method that obtains recombinant C EL I, ladies and gentlemen contriver has attempted by the transient expression (in planta) in plant of Agrobacterium mediation it being expressed.

They have expressed recombinant C EL I on (agroinfiltrated) tobacco leaf that Agrobacterium is soaked into, and with ammonium sulfate precipitation method from leaf extract with its purification.They surprisingly find, they have obtained to have the very high productive rate of highly active recombinant C EL I, in addition, goods than it CEL I well known in the prior art, this recombinant C EL I goods are discerned mispairing with the susceptibility of wideer specificity and Geng Gao, even such mispairing also allows clearly to detect to for example T/T, and they to be considered to CEL I be to be difficult to identification.

Summary of the invention

In view of these results, ladies and gentlemen contriver has expected using this method to screen to be differentiated to be each endonuclease that belongs to S1/P1 family on computer chip by the activity of testing them in vitro.

Therefore the invention provides from a spot of parent material and obtain a large amount of endonucleases, a kind of method simply fast of S1/P1 nuclease particularly, and a kind of endonuclease of evaluate candidate in vitro active method, particularly endonuclease are provided in order to identify that mispairing is special.

Special endonuclease of mispairing be defined as herein a kind of can specifically shear all base alternate mispairing (be A/A, G/G, C/C, T/T, A/G, A/C, G/T, C/T, G/A, C/A, T/C, T/G) and the endonuclease of the insertion/disappearance of one or more Nucleotide.

Therefore one object of the present invention just provides a kind of method of producing the recombined endo nuclease, and wherein said method comprises:

-in host plant cell, express described recombined endo nuclease, by the Agrobacterium bacterial strain instantaneous conversion that comprises expression vector, this expression vector comprises the polynucleotide that described endonuclease is encoded;

-from described host plant cell, isolate described recombined endo nuclease.

Described vegetable cell can be the part of cell suspension or tissue or organ culture.In this case, this endonuclease capable is collected from supernatant liquor and/or from cultured cells or tissue or organ.Preferably, they are the whole plants or the part of isolating organ thus; In this case, will soak into (agroinfiltration) by Agrobacterium with the instantaneous conversion of Agrobacterium bacterial strain realizes.

Agrobacterium is soaked into to be based on the Agrobacterium that includes correlation gene is sent into a kind of instant expression method in the complete plant tissue.

A dna structure that includes correlation gene is become a binary vector by the clone and is transferred into selected Agrobacterium bacterial strain, and should the Agrobacterium through transforming grow to logarithmic phase or saturated and use the method identical with the conversion of conventional Agrobacterium mediation to collect.Classical ground, Agrobacterium soak into to be the suspension by the Agrobacterium cell that will be transformed or to advance select the organ (normally leaf) of plant with the injector to inject that does not have syringe needle, perhaps passes through the vacuum infiltration of several minutes.After this vacuum release, this organ or whole plants are placed in the growth room.This relevant marking protein extracts from the organ that soaks into, generally after infiltration one to four day.Each Agrobacterium is soaked into scheme has disclosure in different delivering on the thing, people such as KAPILA for example, (Plant Sci.122,101-108,1997); People such as BENDAHMANE, (Plant Cell, 11,781-792,1999); People such as SCOFIELD, (Science., 274,2063-5,1996); People such as TANG, (Science., 274,2060-3,1996); People such as MARILLONNET, (Proc Natl Acad Sci USA, 101,6852-7,2004); People such as WROBLEWSKI, (Plant Biotech.J., 3, pp.259-273,2005).

Classical scheme transient expression, that soak into especially for Agrobacterium that is used for the Agrobacterium mediation can be used in practice of the present invention.Have the Agrobacterium bacterial strain of binary vector and the regulation and control unit of control related gene expression and have very big range of choice, the skilled personage in this area can host plant that selection be more suitable in the middle of their, that for example use according to schedule.

In the experiment that in following examples, discloses, ladies and gentlemen contriver has used a pBIN19-deutero-binary vector, the Agrobacterium bacterial strain C58C1 of the pBIN61 and the high toxicity pCH32 plasmid of having hidden, and cDNA or genome encoding sequence are expressed under the CaMV 35S promoter.But other binary vectors, other Agrobacterium bacterial strains and other formations or inducible promoters can be used to arrive same result.

Advantageously, Agrobacterium is soaked into and will carry out in leaf, and it can randomly separate from described plant before or after soaking into immediately.

The host plant that can use in the method for the invention comprises and the compatible any plant of Agrobacterium conversion.Preferred plant is particularly including those plants, especially Ben Saimushi tobacco (Nicotiana benthamiana) and the common tobacco (Nicotiana tabacum) of Nicotiana.

According to an embodiment preferred of the present invention,, particularly from the leaf that Agrobacterium is soaked into, isolate described endonuclease by the plant organ that the method that comprises the following step is soaked into from Agrobacterium:

-the organ that soaks into from the Agrobacterium of expressing described endonuclease extracts cell content;

-with final concentration be 30% or above ammonium sulfate join in the described extract, and from supernatant liquor the isolated protein throw out;

-with final concentration be 80% or above ammonium sulfate join in the described supernatant liquor, and reclaim the proteins precipitate contain endonuclease.

Described proteins precipitate is suspended in a suitable damping fluid once more, for example is a damping fluid that comprises Tris HCl (pH 8), PMSF and 10% glycerine.It can directly use, and perhaps is saved to use under-80 ℃.

Alternately, the whole extracts that obtained after first step of this that shows can so use above, and need not carry out the step of a plurality of ammonium sulfate precipitations.

Can be randomly, the endonuclease endonuclease capable that method of the present invention is produced is further purified with known any proper method own, and post affinity purification for example wherein is labeled as CEL I in post with a label a certain special composition is had avidity.According to an embodiment preferred, it is histidine-tagged that CEL I of the present invention is marked by 6-, and the metal affinity chromatography method that is used on nickel-NTA is purified.

The present invention also provides a kind of method, and whether be used to test candidate's endonuclease is the special endonuclease of mispairing, and wherein said method comprises:

A) produce described candidate's endonuclease with method of the present invention as defined above with recombination form;

B) ability of the degraded single stranded DNA of described recombined endo nuclease is tested;

C) described recombined endo nuclease is tested a predetermined mispairing site segmental ability of shearing test heteroduplex DNA;

D) (that is: base substitutes mispairing A/A, G/G, C/C, T/T, A/G all types mispairing to be carried in described recombined endo nuclease shearing, A/C, G/T, C/T, G/A, C/A, T/C, T/G, and inserting or the disappearance mispairing) the segmental ability of heteroduplex DNA test.

If endonuclease has passed through step b), c) and (if i.e.: its single stranded DNA of can degrading of test d), can be in predetermined mispairing site shearing test heteroduplex DNA segment, and can shear the heteroduplex DNA segment of carrying all types mispairing), it just is considered to the special endonuclease of mispairing.

The present invention also provides a kind of method of screening the special endonuclease of mispairing, and wherein said method comprises:

A) produce described candidate's endonuclease with method of the present invention as defined above with recombination form;

B) ability of described recombined endo nuclease degradation single stranded DNA is tested;

C) this recombined endo nuclease single stranded DNA of can degrading is tested, and to them known and have the mispairing site segmental ability of shearing test heteroduplex DNA of desirable features mark to test;

D) selecting can be known and the segmental recombined endo nuclease of mispairing site shearing test heteroduplex DNA of desirable features mark is arranged, and their is sheared the pulsating ability of heteroduplex DNA of carrying all types mispairing test;

E) select by step b), c) and d) the recombined endo nuclease of test.

An embodiment preferred according to method defined above, they also comprise a step, it is included in the ability of the following test of existence detection mutant allele in dna library of excessive wild-type allele and comes described their susceptibility of endonuclease test, and there is the endonuclease that can detect described mutant allele down in the wild-type allele that is chosen at least 9 times excessive (that is: in 10 a groups a mutant allele being arranged), preferably at least 14 times of excessive existence, also be more preferably at least 19 times of excessive existence, and according to the order of the preferred characteristics that increases, 29 times excessive, 39 times excessive, 49 times excessive, 59 times of excessive wild-type alleles.

Preferably, more than Ding Yi test is to have pH value 7 to 8, and is more favourable 7.4 to 7.8, and contains 5 to 20mM, the MgCl of more favourable 10mM ₂Reaction mixture in carry out.Advantageously, described reaction mixture also comprises 0.5mM to 2mM, the DTT of preferred 1mM.Ladies and gentlemen contriver has also observed at 2% to 10% (w/v), particularly adds PEG-8000 in 5% the final reacting mixture, has increased the overall activity of this endonuclease.

Candidate's endonuclease endonuclease capable of the enough method tests of the present invention of energy finds among this S1/P1 family.In the PFAM database (people such as BATEMAN, Nucleic Acids Res.32, D138-41,2004), this family is designated as PFAM 02265.For example can use from the HMM distribution (implicit Maldivian model (Hidden Markov Models)) of PFAM 02265 foundation and screen available dna sequence data storehouse, use HMMER software in different plants, to discern candidate's endonuclease as probe.

Alternately, InterPro IPR003154 code (corresponding to the S1/P1 nuclease) can be used to garbled data storehouse content, for example uses column address down:

http：//www.ebi.ac.uk/interpro/ISpy？ipr＝IPR003154

43 protein (table 1) have been identified with this code screening Trembl/Swissprot database.

Table 1: with the result of IPR003154 code screening Trembl/Swissprot database

Trembl or the Swissprot number of entering	Explanation	Sequence length	Bit (Blastp)
				P24504	Nuclease PA3 (EC 3.1.3.6)	270	127
P24289	Nuclease P 1 (EC 3.1.30.1)	270	127
				P24021	S1 nuclease (EC 3.1.30.1)	267	107
Q00235	The s1 nuclease precursor.	287	109
				Q9P356	Nuclease Le1.	310	111
Q7S8Q5	Putative protein matter.	306	114
				Q87OT1	Possible s1 nuclease.	324	119
Q8NIH8	Nuclease Le3.	298	129
				Q25267	3 '-phosphonuclease/nuclease.	477
Q9GNZ4	3 '-phosphonuclease/nuclease precursor.	378
				Q9NJ13	3 '-phosphonuclease/nuclease.	377
Q9NJY3	The nuclease that strand is special.	315
				Q86GJ3	The P4 nuclease.	316
Q8T4M4	I class nuclease.	3i6
				O65424	The difunctional nuclease of inferring	362	217
O65425	The difunctional nuclease of inferring	454	164
				O80326	The endonuclease enzyme precursor.	303	480
O81656	Withered relevant protein 6.	298	461
				O81958	The endonuclease enzyme.	288	289
Q93WW9	Si-type endonuclease (segment).	1361	239
				Q9ARD4	The nuclease of inferring.	289
Q9C9G4	The difunctional nuclease of inferring.	290	300
				Q9FTRO	The difunctional nuclease of inferring.	310
Q9FTR1	The difunctional nuclease of inferring.	311	180
				Q9LGA5	ESTs?D48949(5i554i)。	3081	293
Q9LL59	CEL I mispairing endonuclease.	296	627
				Q9SXG1	Nuclease I.	290	291
Q9ZR87	Difunctional nuclease.	328	308
				Q9ZR88	Difunctional nuclease (segment).	280	305
Q9ZR89	Difunctional nuclease bfn1.	305	445
				Q7XND5	OSJNBbOO34I13.4 protein.	252	277

Q7XPN4	OSJNBaOO6ODO6.10 protein.	290	275
				Q8LA68	Endonuclease is inferred.	296	281
Q8LCL6	The difunctional nuclease of inferring.	290	299
				Q8LDW6	The difunctional nuclease of inferring.	294	274
068530	Endonuclease S1 homologue.	309
				Q8XRE8	Single peptide protein matter of inferring.	337
Q989R8	Endonuclease.	278
				Q7P202	Possible endonuclease.	274
Q8F378	Nuclease Si (EC 3.1.30.1).	306
				Q8P5Y5	Endonuclease.	270
Q8PHA3	Endonuclease.	271
				Q9SXA6	Difunctional nuclease bfn1.	305	448

This is analyzed preferably and finishes by go up execution Blast at database (blastp or tblastn), uses a reference protein sequence (for example CEL I sequence), selects best hits.

Each following embodiment will describe five candidate's endonucleases that test obtains from Arabidopis thaliana with more details.

Ladies and gentlemen contriver finds one of these endonucleases, in appended sequence table, be illustrated in SEQ ID NO:2 (corresponding DNA sequence is illustrated in SEQ ID NO:1 under one's name) under one's name, and it is corresponding to the BFN1 of Arabidopis thaliana, have a different specificity, and bigger susceptibility is arranged than CEL I.

As an endonuclease that mispairing is special, this of BFN1 characteristic finds that it is unknown up to before this, allows it is proposed to use as the sudden change detection reagent, so that detect because base substitutes, and the mispairing that causes owing to one or more Nucleotide insertion/disappearances.

BFN1, and the special endonuclease of the identifiable mispairing of any the method according to this invention, the method for all available production endonuclease obtains in a large number.

The present invention also comprises obtainable in accordance with the present production process recombinant chou endonuclease enzyme preparation.These are recombinant chou CEL I goods and recombinant chou BFN1 goods particularly.

Recombinant chou CEL I goods of the present invention are compared with the CEL I goods of prior art has different mispairing specificitys and the susceptibility of Geng Gao.Recombinant chou CEL I goods of the present invention have following mispairing preferred characteristics: T/G～A/G～G/G～G/T～T/T～G/A 〉=A/A～C/C 〉=T/C～C/T＞A/C～C/A, and the mispairing preferred characteristics of the CEL I goods of prior art is C/C 〉=C/A～C/T 〉=G/G＞A/C～A/A～T/C＞T/G～G/T～G/A～A/G＞T/T.Recombinant chou CEL I goods of the present invention can identify mutant allele in the presence of 23 times of excessive wild-type alleles, and the CEL I goods of prior art surpass 8 times of dilutions and the time can not identify mutant allele effectively diluted.

Recombinant chou BFN1 goods of the present invention are compared with recombinant chou CEL I goods of the present invention with the CEL I goods of prior art also has different mispairing specificitys.Recombinant chou BFN1 goods of the present invention have following mispairing preferred characteristics: G/G～G/A～A/G～G/T～T/G＞T/T～A/A～C/C～T/C＞C/T～A/C～C/A.The mispairing preferred characteristics of each in these enzymes is summed up in the following Table 2.

Table 2: mispairing identification preferred characteristics relatively

Protein	Identification the most effectively	Identification well	Discern than less efficiently	Discern very weakly
					The CEL I (prior art) that obtains from celery	C/C?C/T C/A	G/G?A/C	A/A?G/A G/T?T/C T/G?A/G	T/T
According to recombinant chou CEL I of the present invention **	T/G?A/G G/G?G/T	T/T?G/A A/A?C/C	C/T?A/C T/C?C/A
					?BFN1(ENDO1)	G/G?G/A A/G?G/T T/G	A/A?T/T T/C?C/C	C/T?A/C C/A *

^*=these mispairing are more effective by recombinant chou Cel I by BFN1 (ENDO1) identification ratio. ^*Attention: the shear efficiency estimation is just semiquantitative; Therefore, by the identification of endonuclease, depend on investigator and/or test based on them, slight difference can appear in the ordering of mispairing.

Recombinant chou BFN1 goods of the present invention in addition all have higher susceptibility than the CEL I goods and the recombinant chou CEL I goods of the present invention of prior art.Recombinant chou BFN1 goods of the present invention can identify a mutant allele in the presence of the doubly excessive wild-type allele of 59-.

As mentioned above, recombinant chou BFN1 of the present invention or CEL I endonuclease enzyme preparation can use in any method that relates to the mispairing screening as a kind of detection reagent of suddenling change.They are at gene type, at aspect particularly advantageouies such as TILLING, high yield TILLING, Ecotilling, GRAMMR.

Use the method for endonuclease enzyme preparation of the present invention to consist essentially of step as in the prior art, that is: the PCR amplification of target sequence (pcr amplification), the sex change of amplification product and annealing are to allow forming heteroduplex between wild-type and mutant allele, endonuclease is sheared this heteroduplex, and analyzes shear product.The mixing energy of different endonucleases advantageously is used to shear these heteroduplexs when these methods of implementation.

Because their hypersensitivity, endonuclease enzyme preparation of the present invention can also be carried out high-yield process and differentiate a sudden change in the sample.For example, endonuclease enzyme preparation according to the present invention can be used for big many number of samples is carried out for example method of WO 01/75167 description, analyzes because it might concentrate in together many samples.

According to the present invention, above-mentioned endonuclease enzyme preparation can be used at from any organism or by one of its deutero-clone very the sample of high number at target gene one or more sudden changes are screened, performed step is as follows:

A) each monomer from described population increases to described target gene or its part,

B) in 2 dimensions or 3 dimension matrixes, described amplification product is sorted, comprises row, column (2 dimension matrix) and post (3 dimension matrix),

C) described amplification product is concentrated, for example obtained different storehouses with this, row, delegation or a post of described matrix represented in each storehouse,

D) in each storehouse, add the reference amplification product that from unmanifest gene, obtains, under the environment that can form heteroduplex, these storehouses cultivated,

E) use endonuclease enzyme preparation according to the present invention that each storehouse is cultivated, and

F) existence to heteroduplex detects in the storehouse of described cultivation.

Alternately, above method can be concentrated their (together with references of adding) then by at first in matrix sample being sorted, and carries out amplification, cultivates and detect step.

Depend on the number of samples that will screen, this matrix can be 2 dimensions or 3 dimension matrixes.For example, if screen 576 samples, can use 24 * 24 matrixes.If screen 13824 samples, 3 dimension matrixes may more suitable (24 * 24 * 24) so.Only need 72 reactions to screen this population, and the gene of each sudden change will be distinguished according to post, row and the row in the storehouse under it separately.

This, increases with the primer identical with target gene in this population corresponding to from this product that increases that obtains with reference to gene (contrast seek sudden change) with it with reference to the amplification product.Adding one is very important with reference to the amplification product.Really, to compare duplicate sudden change with the reference gene be very unlikely although all samples are being retained, and this will guarantee that heteroduplex just can form so if this group comprised a target gene of retaining sudden change.

The present invention will be illustrated by following further describing, wherein the embodiment of reference has showed the preparation and the performance of recombinant chou CEL-I endonuclease, to test from five candidate's endonucleases of Arabidopis thaliana, and to the discriminating of BFN1 (the following ENDO1 that also is named as) as the special endonuclease of mispairing.But should be appreciated that these embodiment only are used for explaining the present invention, do not constitute its any type of restriction.

Description of drawings

Fig. 1: the point mutation on the sepharose detects.(wild-type is with mutant DNA's) heteroduplex is by the diluent (D100～D1000) or not contain protein (-) to cultivate by different recombinant chou Cel I.

Fig. 2: the point mutation on the acrylamide gel detects.WT+Mut: (PCR) is mixed together before in the polymerase chain reaction from the DNA of wild-type and mutant, therefore produces heteroduplex.WT: only have wild-type DNA to be used to PCR, therefore only produce homoduplex.Mut: only have mutant DNA to be used to PCR, therefore only produce homoduplex.D100, D500 and D1000: the diluent of recombinant protein matter Cel I.

Pointed out the size (661bp) of homoduplex on gel top.Arrow at the 405bp place shows the segment by the FAM fluorochrome label.Arrow at the 256bp place shows the segment by the ROX fluorochrome label.

Fig. 3: the point mutation in the genomic dna on the sepharose detects.The PCR product obtains with primer 4-960 and 4-721 (SEQ ID Nos:3 and 4) according to the disclosure of following examples 4.They use the different diluent of the recombinant chou CEL I goods that obtained by ammonium sulfate precipitation method to come enzymolysis (disclosing as embodiment 2) then, and analyze on sepharose.The size of the PCR product of rms 1-13 mutant and wild-type allele approximately is 500bp (that definite is 481bp).As the detected result of suddenling change in the heteroduplex DNA, obtained about 200 and two bands of 300bp.Even these two bands also can be seen in sepharose when protein 1/1000 dilution that tobacco produces.

1:D100; 2:D500; 3:D1000; 4: do not have enzyme.

A：Terese；B：rms1.13；C：T+rms1.13。

Fig. 4: the recombinant chou Cel I activation analysis of all mispairing types.A series of mutant based on the Rx gene produce by PCR, and heteroduplex is to obtain by mixing corresponding to the amplification product of those different mutants.With IRD700 and IRD800 fluorophor (MWS ^) oligonucleotide of mark is used to PCR, and mispairing to detect be at LICOR4300 (LICOR ^) on carry out.This figure shows the operation path of IRD dyestuff 700 (A) and IRD dyestuff 800 (B).Path A shows the pulsating 5 ' end fragment of 204bp by the IRD-700-mark, and path B shows that the 438bp segment is at the disconnected IRD-800 dye marker of using of 3 ' dististyle.

Fig. 5: the proteinic susceptibility of recombinant chou Cel I that produces in the tobacco.1 wild-type pea (WtPea); 2 Le1; 3 Wt+Le1; 4 Wt+Le1+2DNAs; 5 Wt+Le1+4DNAs; 6 Wt+Le1+6DNAs; 7 Wt+Le1+8DNAs; 8 Wt+Le1+10DNAs.

Fig. 6: shear heteroduplex DNA in C-A/T-G mispairing site with five candidate's endonucleases.(Ho)=homoduplex DNA; (Ht)=heteroduplex DNA.

Fig. 7: use ENDO1 and ENDO5 detailed analysis to the specific recognition of all types mispairing.Used the experimental program identical with Fig. 4.

Fig. 8: the test of measuring the ENDO1 detection sensitivity.The mixture of mutant (Le-1) and wild-type (Torstag) DNA is used as the active template of ENDO1 in following ratio: 1 mutant correspondence 2,4,6,8,10,15,20,25,30,35,40,50 and 60 wild-types (from left to right).Last two row of each breadth are homoduplex (mutant are only arranged and wild-type is only arranged).The breadth on the left side: IRD700 path, detected fragment size=338bp.The breadth on the right: IRD800 path, detected fragment size=300bp.

Fig. 9: with the contrast of Cel 1 and Endo1 mispairing detection.The corresponding homoduplex of the 1st, 5,8 and 10 row.Being sheared the segment that obtains by endonuclease is 405bp (using blue markings) and 256bp (using red-label, not too obvious on black and white screen).Endo1 more effectively identifies mispairing than Cel 1.In addition, lower with Endo1 background (non-specific activity).

Figure 10: the detection that (D1000 and D5000) suddenlys change to a known point on acrylamide gel with ENDO1 in two kinds of different diluent.M5 and M12 are two plasmids that contain the Rx gene; One comprises the Wt type, and another comprises mutant.Primer: Rx21rox and Rx22fam (in the figure, less shear zone is used red-label, on gel, show clearly, but not too obvious on artwork master).

Embodiment

Clone, purification and the production of embodiment 1:CEL I endonuclease

The cDNA of clone CEL I

From celery, extract RNA

Tender leaf tissue (1g) grinds with a pestle and mortar in liquid nitrogen.Powder suspension is extracted in the damping fluid at 10ml Trizol (Gibco).This suspension mixes with the 2ml chloroform, when 4C under the 12000rpm centrifugal 15 minutes.This supernatant liquor mixes with isopyknic Virahol, and total RNA precipitates 10 minute under the 12000rpm with centrifugal in the time of 4 ℃.This pellet is with 80% alcohol flushing, and is air-dry and suspend once more in 200 μ l DEPC (DEPC) water.

Deoxyribonuclease (DNase) is handled

Carrying out deoxyribonuclease (DNase) handles hydrolysis to pollute the DNA of RNA goods.Condition (Pu Luomaige (Promega)) according to factory is cultivated the total RNA of 10 μ g with the DNase of 10 units.

Reaction was at room temperature cultivated 15 minutes, then by to add ethylenediamine tetraacetic acid (EDTA) (EDTA) to ultimate density be 25mM and stop by the DNase heated and inactivated being made in 10 minutes react 65 ℃ the time.

CEL I cDNA is synthetic

The RNA that 10 microlitre DNAse are handled is used for the synthetic of first gang of (first strand) cDNA.First strand of synthetic 20mers oligo dT primer with 2 picomoles of cDNA causes.The reaction mixture of 50 μ l (the 5x Superscript damping fluid [GIBCO-BRL] of 10 μ l, the 100mM DTT of 5 μ l, the 5mM dNTP of 5 μ l) is 70 ℃ of heating 10 minutes, then in cooled on ice.Superscript reversed transcriptive enzyme (200 units/μ l that add 1 μ l; GIBCO-BRL) and 1 μ l RNA enzyme inhibitors (RNase inhibitor) (37 units/μ l, Pharmacia), and this is reflected at 42 ℃ and cultivated 1 hour.Use pcr amplification that first gang of cDNA changed into double-stranded DNA, this is by using the pcr amplification of two primers special to 5 ' and the 3 ' non-translational region (UTR) of CEL I (face table 3 as follows).

Clone CEL I and on tobacco leaf, expressing

Total length CEL I opening code-reading frame is transcribed between the whole son by pcr amplification and the 35S promoter of binary vector pBin19 and cauliflower mosaic virus (CaMV) and is inserted, and produces pBIN35S-CELI with this.Another structure pBIN35S-CELI8His is also founded.PBIN35S-CELI8His and pBIN35S-CELI are identical, only except that CEL I protein C-end insert 8 amino acid whose histidine-tagged.Be used to produce oligonucleotide table 3 demonstration below of pBIN35S-CELI and pBIN35S-CELI8His.

Table 3:

The primer title
		CEL N end	?5’TATCGTTCTAGAGGGAATGACGCGATTATATTCTGTGTTC?3’ ?SEQ?ID?N°5
CEL C end	?5’TATCTGAATTCATGCCAAAGAATGATC?3’ ?SEQ?ID?N°6
		CEL C holds 8 His	?5’AATTCAATGGTGATGGTGGTGATGGTGATGTGCCAAAGAATGATCTGC ?GG?3’ ?SEQ?ID?N°7

These structures are transformed enters the people such as Agrobacterium bacterial classification C58C1:(Hamilton that carry toxicity helper plasmid pCH32, PNAS, 93 (18): 9975-9979,1996).PCH32 has expressed VirG and VirE and has been used to promote T-DNA to transform.The Agrobacterium cell is inoculated in L broth culture people such as (, 1989) Sambrook of the 5mL that has added 50 μ g/mL kantlex and 5 μ g/mL tsiklomitsins (tetracycline), 28 ℃ of one nights of growth down.To add 50 μ g/mL kantlex then, the L broth culture (50mL) of 5 μ g/mL tsiklomitsins is inoculated in the nutrient solution that 5-mL spends the night, 29 ℃ of growths 2 days down.Cell comprises 10mM MgCl at one ₂, 10mM MES, pH 5.6, and precipitated and to be suspended into ultimate density once more be 0.5OD in the solution of 150 μ M Syringylethanones ₆₀₀Nutrient solution enters tobacco leaf (Nicotianabenthamiana leaves) in the Agrobacterium infiltration and at room temperature cultivated 2 hours before.

The Agrobacterium suspension does not have the injector to inject of syringe needle to advance in the leaf with one.

The Ben Saimushi Nicotiana plant (Nicotiana benthamiana plants) that Agrobacterium is soaked into was cultivated illumination in 16 hours, 60% humidity at least 48 hours under 24 ℃.In order to test the efficient that Agrobacterium is soaked into, plant also uses the structure of expressing green fluorescent protein matter (GFP) to carry out the Agrobacterium infiltration.Before these leaves of harvesting, use ultraviolet lamp to check the GFP expression intensity of each sheet leaf.Have only the GFP of working as to be expressed, plant leaf could gather in.

From tobacco leaf, prepare protein by ammonium sulfate precipitation method

The tobacco leaf that Agrobacterium is soaked into is gathered in and is weighed.The leaves that two gram Agrobacteriums are soaked into are containing 0.1M Tris-HCl pH8, and 200 μ M PMSF carry out homogenization treatment in the 7ml damping fluid of 0.125mM beta-mercaptoethanol and 10% glycerine, cell debris are granulated in centrifugal 25 minutes under 3000g then.For supernatant liquor, add 100% ammonium sulfate and make ultimate density reach 30%, then sample was cultivated on ice 1 hour, under 30000g, protein was granulated in centrifugal 30 minutes 4 ℃ the time, these granular protein are at 30% ammonium sulfate precipitation.For supernatant liquor, add 100% ammonium sulfate and make ultimate density reach 80%, then sample was cultivated on ice 1 hour once more, as above centrifugal protein is granulated, ammonium sulfate precipitation 80%.The proteinic pellet that is included in 80% ammonium sulfate precipitation suspends in 600 μ l homogenize damping fluid once more.Protein concn is determined with coomassie reagent analysis test kit (kit Coomassie Plus Reagent Assay (Pierce)).The pellet of homogeneous comprises 14 μ g protein/μ l.Therefore, from the tobacco leaf that 2 gram Agrobacteriums are soaked into, regain 8400 μ g protein.The pellet of homogeneous is containing 50mM Tris-HCl pH8, is diluted to 1 μ g/ μ l in the damping fluid of 10% glycerine and 100 μ M PMSF, and the five equilibrium sample is also preserved under-80 ℃.

Protein with Ni-NTA affinity chromatography purification His-6 mark:

Collect the tobacco leaf of 5 gram Agrobacteriums infiltrations and containing sodium phosphate (100mM), Tris HCl pH 8 (10mM), NaCl (200mM), methyl Sodium Metabisulphate 65 (Sodium methabisulfite) (0.2%), PMSF (1mM) carries out homogenization treatment in the freezing damping fluid of β mercaptoethanol (10mM).After homogenizing, sample descended centrifugal 10 minutes for 4 ℃ at 6000g (Beckman, rotor JA 20).(10mM) adds this supernatant liquor with imidazoles, with NaOH pH transferred to 9.This solution is 42, and 000g (Beckman, rotor JA 20) descended centrifugal 60 minutes for 4 ℃.This supernatant liquor with mix with the damping fluid that homogenizes+10mM imidazoles pH9 (buffer B) equilibrated 1ml Ni-NTA agarose (Quiagen) in advance.This mixture was 4 ℃ of homogeneous 2 hours, so that protein bound is to Ni-NTA agarose grain.This is installed in the polypropylene post of 1ml (Quiagen), and resin is with the buffer B flushing of 20ml.This protein 5ml (buffer B of 5 * 1ml)+250mM imidazoles pH9 wash-out.Aliquot is saved the activity of carrying out enzyme in purification process.For fear of any restraining effect of high density imidazoles for enzymic activity, eluted part contains Tris-HCl pH8 with 4 liters, 0.1M, PMSF 100 μ M and ZnCl ₂The damping fluid of 2 μ M is dialysed a night at 4 ℃.Like this, reclaim 1000 μ g protein.The pellet of homogeneous is containing 50mM Tris-HCl pH8, is diluted to 3 μ g/ μ l in the damping fluid of 10% glycerine and 100 μ M PMSF, five equilibrium sample and-80 ℃ of preservations.(dilution D10,000).

Embodiment 2: the degraded of strand specific DNA

(SUNG SC, LAKKOWSKI MSr. (1962), J Biol Chem.1962 Feb are carried out in the activity such as the former description of this recombinant chou Cel I degraded single stranded DNA; 237:506-11).Deoxyribonuclease (Dnase), rnase (Rnase) and the no proteolytic enzyme Shuo pea genomic dna (protease free Pea genomic DNA) of 30 micrograms are contained 50mM Tris-HCl (pH 7.6), 10mM MgCl at one ₂, cultivate with 2 μ g protein extracts in the damping fluid of 1mM DTT and 5%PEG-8000.For termination reaction, add the isopyknic 20mM LaCl among the 0.2N HCl ₃Sample under 21000g centrifugal 40 minutes, use the spectrophotometer measurement supernatant liquor in the optical density of 260nm to determine to become the amount of acid-soluble DNA.

Embodiment 3: the endonuclease that produces in the tobacco is sheared heteroduplex DNA and detected a test gene on agarose and acrylamide gel known point sudden change

Whether can discern one point mutation in order to test the CEL I endonuclease that in tobacco, produces, the activity of the recombinant chou CELI goods that obtain by ammonium sulfate precipitation method is to testing at two different clones of single point sudden change heteroduplex DNA: C-G to A-T changes (people such as Bendhamane, Plant Cell, 11,781-792,1999).(R21 5 ' GAC ATA TGG ACT ACA GAA GCT TGG G 3 ' SEQ ID N ° 8 to use two oligonucleotide R21 and R22; R22 5 ' GTT CAC GGG TCA CAT CAT GCA TTC C 3 ' SEQ ID N ° 9) on two clones, carried out polymerase chain reaction (PCR).The pcr amplification and the reorganization of heteroduplex DNA have been carried out with following scheme: 95 ℃ of following sex change 2 minutes, carried out 94 ℃ of 7 round-robin subsequently 20 seconds, Tm (55 ℃)+3 ℃ to Tm-4 ℃ carries out 15s, each circulation-1 ℃, reduce to 72 ℃ and prolong 1 minute with 0.5 ℃ of/second gradient at 72 ℃, carried out 94 ℃ of 44 round-robin then 20 seconds, 30 ℃ Tm-5 ℃, reduce to 72 ℃ and prolong 1 minute with 0.5 ℃ of/second gradient at 72 ℃, prolong 5 minutes at 72 ℃ at last, and carried out denaturing step 10 minutes at 94 ℃, reduce to 40 ℃ then and kept 20 seconds, each circulation-0.3 ℃.

This PCR product (mixture of wild-type and mutant DNA, or only be wild-type or mutant DNA) (1 μ g/ μ l mother liquor is diluted to 1/100 with CEL I goods by following, 1/500, or 1/1000) cultivates: for example, the PCR product (500ng) of 10 μ l is 2.5 μ l reaction buffer (the Hepes 10mM of 25 μ l with cumulative volume, MgSO4 10mM, Triton X1000.002% KCl10mM) cultivated 30 minutes at 37 ℃ with the CEL I goods of 2.5 μ l dilution.Reaction stops with the 500mM EDTA of 5 μ l, and this enzymolysis product is analyzed on 3% sepharose.

As shown in Figure 1, the detection of the point mutation of the test gene Rx on heteroduplex DNA is disclosed by the appearance of two bands that are diluted to 1/100,1/500 and 1/1000 about 200bp and 400bp.These bands can not occur when adding enzyme.

Use that fluorescently-labeled primer obtains and use with the PCR product of top the same method enzymolysis and on the ABI377 sequencer, on acrylamide gel, analyze (Fig. 2).

As shown in Figure 2,256 and these two bands of 405bp have only when Wt and Mut DNAs mix and just occur because formed heteroduplex between these two DNA.This just manifests more clearly when using the different lengths ripple that gel is developed.Particularly, when using WT+Mut to mix, be with and clearly present with the 256bp of ROX fluorescence dye (redness) mark, and be not very clearly individual on artwork master 2, and do not exist in other cases as pcr template.

These results show that the CEL I protein that (in planta) produces in the plant can discern mispairing in DNA.

Embodiment 4: detect the point mutation in the genomic dna that obtains from pea with recombinant chou CEL I

Whether can be used to detect a single point sudden change the pea in order to test the recombinant chou CEL I that purifies from tobacco, before carry out (people Plant Physiol 2001 such as MORUS, the 126:1205-1213. of signature by Catherine Rameau; People such as RAMEAU, Plant Physiol 2002,115:458-467) different pea rms and le mutant are used to experiment; Rms1.11 comprises G----〉A is arranged in the different positions of gene order; Rms 1-12 comprises G----〉A; Rms 1-13 comprises G---〉A.All all are to G----at same gene rms1〉A undergos mutation, but is positioned at different positions.

(rms1-12) and the wild-type and the mutant allele of le position, the pea genomic dna of 50 nanogram(ng)s is used as template for rms1-13, rms1-10 for the rms position of increasing.The primer that uses in this pcr amplification is summarized among the table 4.

Table 4:

Pea mutant title	The primer title	Sequence 5 '---3 '
			rms?1-10	4m118	5’TTGGTTGGACTTCACTTTGAGC?3’ SEQ?ID?N°10
	4m984	5’CACAACAATCAGCAATGACAGC?3’ SEQ?ID?N°11
			rms?1-12	4-347	5’GTGATTGCTCCACCTCCGCCACC?3’ SEQ?ID?N°12
	4-134	5’TACAGCGATTGATATAATATAAAATTATCC?3’ SEQ?ID?N°13
			rms?1-13	4-960	5’GTGTTTGTCCAGTAATAGTGTCAGCATA?3’ SEQ?ID?N°3
	4-721	5’AGGAACCTGAGAAAAGACTCGCCAGC?3’ SEQ?ID?N°4
			le?1	le?2462	5’TGATATTGTCGTGCAATATGATGAAAC?3’ SEQ?ID?N°14
	le?3082	5’ATACCTATTTAGCCCACTTGGACAC?3’ SEQ?ID?N°15

The program of pcr amplification be 94 ℃ 1 minute, (94 ℃ 15 seconds, 55 ℃ 15 seconds, 74 ℃ 1 minute, X35) 74 ℃ 7 minutes, 8 ℃.This PCR product on sepharose, analyze with the different dilutions of the recombinant chou CEL I goods that obtain with ammonium sulfate precipitation method as above the disclosure of embodiment 2 carry out enzymolysis.As shown in Figure 3, the size of the PCR product of rms1-13 mutant and wild-type mutant is approximately 500bp (being 481bp exactly).As the result that sudden change in the heteroduplex DNA detects, obtained about 200 and two bands of 300bp.Even these two are with the dilution of the protein 1/1000 that produces in tobacco also can see in sepharose.This result shows that the protein that produces in the plant at first can discern the point mutation that occurs in the genomic dna, though secondly because protein be diluted to 1/1000 enzymolysis product also can be in sight, so it is very activated.

Embodiment 5: the efficient of shearing mispairing with recombinant chou CEL I in different mispairing parts

In order to test whether recombinant chou CEL I prepared in accordance with the present invention preferably cuts off a certain type as the CEL I that purifies from celery mispairing, a series of mutant have been created based on the Rx gene.For that purpose, we have designed different primer (being called Rx-A, T, G or C), and each comprises a different point mutation.Each of these primers allows (A, T, G or C) in 4 substrates of Rx gene specified location introduction.Heteroduplex is to create by mixing the amplification product that obtains with different primers.

PCR mixture (cumulative volume is 50 μ l) comprises template DNA (50ng), dNTP (0.2mM), 5 μ l PCR stopper Pfu (10X, Stratagene), primer Rx 21 (0.4 μ M), primer Rx-A or Rx-T or Rx-G or Rx-C (0.4 μ M), Pfu (5U, Stratagene, 2.5 units/μ l).The program that is used for pcr amplification be 94 ℃ 1 minute, (94 ℃ 15 seconds, 55 ℃ 15 seconds, 74 ℃ 2 minutes, X35) 74 ℃ 7 minutes, 8 ℃ are spent the night.With IRD700 and IRD800 fluorophor (MWS ^) oligonucleotide of mark is used to this PCR to allow at LICOR4300 (LICOR ^) on mispairing detect.

This PCR product is analyzed on sepharose, and clones in pGEM 3Zf.All clones have been sorted to guarantee that correct sudden change is inserted into.In the pcr amplification as the combination of these structures of template all types of mispairing that are used to recombinate.

The method that the PCR product of mispairing such as top embodiment 2 discloses is cultivated, and uses as recombinant chou CEL I goods that top embodiment 1 discloses obtains from tobacco leaf with ammonium sulfate precipitation method.

Each enzymolysis product is analyzed on sepharose.Used the acrylamide gel of sex change 6.5%, deposition condition is: 1500V, and 40W, 40mA, 45 ℃, sweep velocity is 1.

The result is presented at (Licor Gel) on Fig. 4.

These results show that CEL I goods of the present invention identify all types of mispairing, especially the CEL I that directly purifies of prior art report from celery the mispairing of faint identification.Really, shown in top table 2, CEL I goods of the present invention with very high specific recognition by the mispairing of the faint identification of CEL I goods of prior art, as T/T, G/A, A/G, G/T, T/G, and the mispairing preferred characteristics of this enzyme is as follows: T/G～A/G～G/G～G/T＞T/T～G/A～A/A～C/C＞T/C～C/T～A/C～C/A.

When CEL I reaction buffer replenished into 5%PEG, this specific activity also can be enhanced (not display data).

Embodiment 6: the susceptibility of recombinant chou CEL I

In order to verify that recombinant chou CEL I of the present invention can be used to the high flow-rate gene type, whether can in a monomer storehouse, identify sudden change to it and test.

Be used to the Le1 locus that increases corresponding to the genomic dna of short pea mutant Le1 with from the genomic dna of wild-type pea cultivated variety Torstag with known SNP (C--〉T).These genomic dnas when the formation of homoduplex and heteroduplex with comparing.

In order to produce heteroduplex DNA, the genomic dna that obtains from pea plant homojunction zoarium of le1 locus is diluted by the genomic dna that obtains from pea plant homojunction zoarium with the Le1 locus of different ratios, uses by the primer Le2462 of TET fluorescence dye (5 '-TGATATTGTCGTGCAATATGATGAAAC-3 ' SEQ ID N ° 14) mark with by ROX (MWG ^) Le3082 of fluorescence dye (5 '-ATACCTATTTAGCCCACTTGGACAC-3 ' SEQ ID N ° 15) mark, 30ng is used for pcr amplification.Following the carrying out of this PCR reaction: 94 ℃ 1 minute, (94 ℃ 15 seconds, 55 ℃ 15 seconds, 74 ℃ 1 minute) X35,74 ℃ 7 minutes.From the mispairing inspection assay method that the heteroduplex DNA of PCR product reorganization is described, be used as template in the above.

Use shows at Fig. 5 from proteinic this concentrated result of experiment that tobacco produces.As expected, when no matter when having formed heteroduplex between wild-type chain and mutant DNA chain, our recombinant protein matter can both identify SNPLe1.As the result of enzymolysis, obtained two bands (300bp and 338bp) of desired size and met not the 3rd band (638bp) of enzymolysis homoduplex.Being marked as this red 338bp band clearly illustrates (but on the artwork master poor visibility some) on the gel.What is interesting is most that even if when having used the storehouse (adding Le1 and the wild-type of 23 kinds of unknown gene group DNA) of 24 different genes group DNA, this sudden change still can be arrived by protein detection.

In a word, the protein that produces in the plant has hypersensitivity, allows to identify a known SNP among the dna sequence dna from the genomic dna amplification of at least 24 individualities.

Embodiment 7: the bioinformation research of different endonucleases in the Arabidopis thaliana

Use has been done the analysis from the gene cluster of the Arabidopis thaliana that is encoded to endonuclease from protein preface type (protein profile) PF02265 of database PFAM.This preface type HMM is used as probe all 27117 predicted protein matter with target arabidopsis gene group, and explains effect for fear of automatic structure and the full gene group has been carried out the translation of 6 different frameshit.We identify 5 candidate gene At1g11190, At1g68290, At4g21590, At4g21585 and At4g21600 in this analysis.

Embodiment 8: clone and expression Arabidopis thaliana candidate gene in tobacco leaf

The cDNA of each candidate gene by pcr amplification and insert 35S promoter and binary vector pBin61 in the CaMV that transcribes terminal between to produce pBIN35S-ENDO1,-ENDO2,-ENDO3,-ENDO4 and-ENDO5, their respectively corresponding At1g11190, At1g68290, At4g21585, At4g21590 and At4g21600 (table 5).These structures are converted to the Agrobacterium bacterial strain C58C1 that carries toxicity helper plasmid pCH32, and (HAMILTON CM waits the people, (1996) ProcNatl Acad Sci USA., 93 (18): 9975-9).PCH32 has expressed VirG and VirE and has been used as and improved T-DNA and shift.The Agrobacterium cell is inoculated in the L broth culture of 2mL people 1989 such as () SAMBROOK, and this substratum has added 50 μ g/mL kantlex and 5 μ g/mL tsiklomitsins and 28 ℃ of growth a whole nights.Cell comprises 10mM MgCl at one ₂, 10mM MES, precipitated and to be suspended into ultimate density once more be 0.5OD in the solution of pH 5.6 and 150 μ M Syringylethanones ₆₀₀This nutrient solution soaks into into Agrobacterium at room temperature to be cultivated 2 hours before the Ben Saimushi tobacco leaf.The Ben Saimushi tobacco plant that Agrobacterium is soaked into is at 24 ℃, illumination in 16 hours, and 60% humidity was cultivated 24 hours at least.In order to test the efficient that Agrobacterium is soaked into, plant is also carried out Agrobacterium by the structure with expressing green fluorescent protein (GFP) and soaks into.Before these leaves of harvesting, the every intensity use ultra-violet lamp inspection that leaf GFP expresses.These plant leafs have only as GFP has been expressed just harvesting.Candidate albumen matter is extracted with ammonium sulfate precipitation method, and is disclosed as embodiment 1.

Table 5: be used to clone the sequence that has or do not have the primer of histidine-tagged candidate's endonuclease

Candidate albumen matter	The AGI gene	Primer
			ENDO5	At4g21600	Forward: AAGGATCCGAAAGCTCTGTGTTTCAGA SEQ ID NO:16 is reverse: GGAGTTGTTACGTGGGTTCTCAAGGATC SEQ ID NO:17
ENDO4	At4g21585	Forward: CTGGATCCCTGTTTTTAACTTTGGAAAG SEQ ID NO:18 is reverse: GGATGTTCAAGTGATTCTCCTGGATC SEQ ID NO:19
			ENDO3	At4g21590	Forward: AAGGATCCATTCGACAAACTTTGTAAC SEQ ID NO:20 is reverse: AGAGTGGTCTTGGGAATATTTATCTCAG SEQ ID NO:21
ENDO2	At1g68290	Forward: ACGGATCCCATTTCAAAGAACTCTGA SEQ ID NO:22 is reverse: GACCAATCATTATGCTGTAACTTCAG SEQ ID NO:23
			ENDO1 SEQ?ID?NO：2	At1g11190	Forward: CAGGATCCAAGTTTCAAACTTGAAG SEQ ID NO:24 is reverse: CGGTATGTCGGGTTTGGTTCAAGTGG SEQ ID NO:25

Embodiment 9: the biochemical characteristics of candidate albumen matter.

Judge as a simple experiment whether candidate albumen matter has activity, we have cultivated some super spirial plasmids with the protein extract (80% ammonium sulfate precipitation thing) of different dilutions.As the result that endonuclease in the protein extract exists, this superhelix should be by lax, when you carry out can occurring when culture medium is walked glue some new DNA bands on a sepharose.Use different dilutions, the endonuclease that we can be more different and can find out which is most active.Control group is the recombinant chou Cel I endonuclease by ammonium sulfate precipitation method preparation always, and is disclosed as top embodiment 1.

In order to screen the candidate albumen matter that can shear heteroduplex DNA in the mispairing site, we can also use the quick signature system based on three consecutive steps.

In the first step, test the ability of this candidate albumen matter degraded single stranded DNA.It is because the DNA in heteroduplex DNA mispairing site is a strand that this condition is tested.Therefore, one can not the enzymolysis single stranded DNA endonuclease be predicted to be and can not shear DNA in the mispairing site.The second, this candidate albumen matter should known and well signature the mispairing site on shear a test heteroduplex DNA.The 3rd, to their shear the segmental efficient of heteroduplex DNA of carrying all types mispairing by testing the assessment of 1 and 2 protein.This be utilize by one group well signature the DNA work box of plasmid contexture carry out, these plasmids are configured in and comprise four kinds of each in may Nucleotide on the specific position of insertion.

The ability of degraded single stranded DNA

The carrying out that the activity of this candidate albumen matter degraded single stranded DNA such as embodiment 2 describe.All five candidate albumen matter demonstrate nuclease in this analysis, and are classified to inactive from the most active: ENDO1, ENDO5, ENDO2, ENDO3 and ENDO4.

Shear heteroduplex DNA in C-A/T-G mispairing site

For whether this candidate albumen matter of testing the tobacco generation can identify a single point sudden change, we have tested protein extract on the heteroduplex DNA that disclosure produced by embodiment 3 activity.Comprise that each or two allelic PCR products cultivate with the protein extract of 1/1000 dilution, these protein extracts are from candidate's endonuclease gene or carry out the leaf that Agrobacterium soaks in contrast with GFP and get, its mode is as follows: 500ng PCR product is that 25 μ l comprise 50mM Tris-HCl (pH 7.6), 10mM MgCl at final volume ₂, cultivated 30 minutes at 37 ℃ in the protein tobacco extract of 1mM DTT and 5%PEG-8000.These are reflected at ultimate density 80mM and stop with EDTA, and analyze on 3% sepharose.

If this two oligonucleotide are by fluorescent mark, this enzymolysis product is analyzed with 377Abi determined dna sequence instrument on acrylamide gel.In this experiment, if we estimate that protein extract comprises the special endonuclease of mispairing, this heteroduplex DNA will be sheared in the mispairing site, therefore discharge 256bp and two bands of 405bp.

These results show that on Fig. 6 (attention is seen with the 256bp band of red-label is very clear when enzyme is present in the heteroduplex, if do not exist just unclear; This band is not very clear on artwork master).

From this biochemical analysis, our conclusion is that these five endonucleases have demonstrated the special shear active of mispairing.In addition, have higher single stranded DNA special-three enzyme ENDO1 of nuclease, ENDO5, ENDO2 also shears heteroduplex DNA with high-level efficiency more in C-A/T-G mispairing site.And in these three endonucleases, ENDO1 and ENDO5 are most active.Therefore, these two nucleases are selected carries out more accurate signature.

Candidate's endonuclease is in the mismatch cleavage efficient in different mispairing site

The major objective of this task is to differentiate the endonuclease can shear the mispairing that CEL-I can not effectively discern.This be to use by one group well signature the DNA work box of plasmid contexture carry out, the specific position that these plasmids are configured in insertion comprises four kinds of each in may Nucleotide.The combination of these structures is as all types of mispairing that are used to recombinate of the template in the pcr amplification.

The PCR product of mispairing is as above cultivated (seeing embodiment 5) with candidate's endonuclease and is analyzed on LICOR sequencing machine.

The results are shown in Fig. 7.

In this was analyzed, ENDO5 faintly discerned the mispairing of T/T type as CEL-I.On the contrary, ENDO1 discerns the mispairing of nearly all type expeditiously.We may safely draw the conclusion from this is analyzed, and ENDO1 can discern the nd mispairing of CEL-I.

Embodiment 10: ENDO1 detects the susceptibility of mutant allele in a dna library

The susceptibility of ENDO1 is assessed as the description of embodiment 3, with 2,4,6,8,10,15,20,25 of the DNA that carries wild-type allele, 30,35,40,50 or 60 times of dilutions.

The result of this extensive experimentation is presented in Fig. 8, and it has shown from 60 allelotrope of the fit wild-type of a homojunction and will detect from an allelotrope of the fit mutant of a homojunction.Done from two organic PCR, and amplicon quantification on sepharose, the mixed of successively decreasing from 1: 1 to 1: 60 according to pcr amplification together.Measured then in those different mutants: the activity of ENDO1 under the ratio of wild-type.

In identical experiment, the CEL-I that purifies from celery can detect an allelotrope at most with muting sensitivity in the middle of 16, has only when diluting not enough or equaling 8 times to obtain correct sensitivity.

In a word, according to endonuclease of the present invention particularly ENDO1 have still less background noise than Cel I, compare with Cel I and can be used in very high extent of dilution and have better specificity and activity than Cel I endonuclease.

Check point sudden change on the acrylic amine gel.

A series of mutant have been created based on the Rx gene.In order to show the specificity of ENDO1, we have designed the different plasmids that comprise the each type mispairing.This PCR mixture comprises the oligonucleotide special to plasmid.With ROX and FAM fluorophor (MWG ^) oligonucleotide of mark is used to PCR to allow at ABI377 MWG ^On carry out mispairing and detect.

As shown in Figure 9, ENDO1 can not cut when only having homoduplex to exist, for example line 1 or line 5, and we on gel the only band that can see be the vertical homoduplex of gel (approximately 600bp).

(the heteroduplex that forms between two DNA chains from two different plasmids when whenever we have a mispairing in sample, for example online 2,3,4 or 6,7 and 9), ENDO1 just can discern and cut on the mispairing site, cause occurring corresponding two bands of two products, each is with a fluorophor mark.Because this ENDO 1 enzymolysis can see minimizing in background, and some mispairing only can be detected (for example line 9) by ENDO1.

The detection that on the acrylic amine gel at ENDO 1 in two different dilution D1000 and D5000 a known point is suddenlyd change

Two plasmids of the Rx gene that comprises an agriotype and a mutation type have been used.They are only distinguished by a known point mutation.This PCR mixture comprises the oligonucleotide special to plasmid.With ROX and FAM fluorophor (MWG ^) oligonucleotide of mark is used to PCR to allow at ABI377 MWG ^On carry out mispairing and detect.

As shown in figure 10, when whenever heteroduplex occurring in our sample (M5+M12), ENDO1 just can discern and cut in this mispairing site, causes occurring two bands of fluorophor mark.When having only M5 or M12 homoduplex to occur, only band that ENDO1 does not cut and we can see on gel is at the vertical homoduplex of gel (approximately 600bp).When having used D5000 to ENDO1, we can see the improvement of background.Therefore, Endo1 compares with any endonuclease as known in the art and can use very high extent of dilution.

Sequence table

＜110〉Genoplante Valor

France National Agricultural Science research institute

Abdel Fei Debendamanei

This Thule of Benedikt Bao Yesi

The Nei Teli Keyes of Cali

The Mi Xieerka Bosch

＜120〉production method of the endonuclease of high sensitivity, new product of endonuclease and uses thereof

<130>MJP/bv1516-19

<150>PCT/EP2004/009159

<151>2004-07-30

<150>PCT/EP2004/009166

<151>2004-07-30

<160>25

<170>PatentIn?version?3.3

<210>1

<211>2640

<212>DNA

＜213〉Arabidopis thaliana (Arabidopsis thaliana)

<220>

<221>misc_feature

＜223〉ENDO1 gene A t1g11190

<400>1

aaattcgatg?aggttgttat?agacaagaga?agacattttt?atacaaaaga?gtttatcatt 60

atataagttt?caaactttga?agatatggca?tcggctttta?gatcatccac?gaggttgatt 120

cttgtattag?gtatactgat?tttgtgttcg?gtttcttctg?tccgaagctg?gagcaaagaa 180

ggtcatattc?ttacttgtag?aattgctcag?gtaattaagt?taatgatcta?ttgtttgaag 240

caactatttt?ggttattctt?gtcttatata?tgtattagtg?agatatacct?acaaattttt 300

aattaggatt?gacttttaaa?ttgctatacg?ttaccatgcc?taacatctca?tgtagatgat 360

catgaataca?aacatgtcta?atggcatatc?aaattccaag?tttttttggt?agagatctga 420

gtcatttgac?cgttataaga?ttcataacaa?aagttcgtat?gtgtgtgttt?ttgtggtgtg 480

accagaatct?tttagaagcc?ggaccagcac?atgtagtaga?gaatctgtta?ccggattacg 540

tgaaaggaga?tttatcagca?ttgtgtgtgt?ggcctgacca?gatccgacat?tggtacaagt 600

atcgttggac?cagccatctc?cattacatcg?acactcccga?ccaagcctgc?tcttacgaat 660

actctagtaa?gtcacaaccg?agacattttc?agataacctt?aatccgtttt?ctaattatct 720

tgaaccggag?ttaaccaaaa?aatcaattac?aaataccaaa?ccggattaaa?aacaggggat 780

tgtcatgatc?aacatggatt?gaaggatatg?tgtgtggatg?gagcaatcca?gaatttcacg 840

tctcagcttc?agcattacgg?tgaaggaaca?tctgatcgta?gatgtatgtc?atcattttca 900

tttatttcat?ataatgatga?tatccaaagt?gtaactgcgt?attttgtatt?ttgatgcata 960

acttaagttt?ttaaaattat?aatatatcct?tgttcaatca?catagataac?atgaccgaag 1020

cccttttgtt?cttgtctcat?ttcatgggag?atattcatca?ggtttattac?tcatcatcga 1080

ttcatttcac?acctccacac?atatagctct?atttccatgt?taaatattta?attaacatgg 1140

tttttttttt?tttccttaaa?aagccgatgc?atgtgggatt?cacaagtgat?gaaggaggaa 1200

acacgataga?tttacgttgg?tacaaacaca?aatccaatct?acatcatgta?agcttcttct 1260

tttgtctctt?tcaactttaa?atttcatcat?gaaaacaaaa?aaaaaattaa?cgaaggaaac 1320

aaaatatgta?ggtatgggat?agagagatca?ttctcacggc?tctaaaagaa?aactacgaca 1380

agaacttgga?tcttctccaa?gaggatcttg?agaagaacat?caccaatgta?atagacacta 1440

atttattcat?attttactat?aattttaaga?atctttataa?tggttatcat?atattaggga 1500

ttatggcacg?acgatctatc?ttcgtggaca?gaatgcaacg?atcttatcgc?ttgtccacac 1560

aagtaagttt?taaattactt?ggtttaagat?tggcttgacg?ctcgtttgaa?gctagctaca 1620

aattttgata?ctttttctgg?tccaaaaatc?ttacaaagat?actgaaaata?aaataatagg 1680

ttttaaactt?ttaatttatt?tggagttgga?taggattaag?tttcactaac?ttccaattca 1740

aagtcaatta?atagtagttt?accatgatta?gtgggttgac?taatgtacca?tatatattac 1800

cttatatcac?atcttatttc?cgatgtgaga?tttcttatga?aacataatta?gactcgaacc 1860

ttttgtgttt?cgatatatgt?agtgtattca?tgatcagaat?cttattaagt?ttacaactga 1920

aaactaaaat?attaacatca?taattataga?ttcttaagta?ggttttgttt?gggtggagaa 1980

aatatccaat?ttcgaataac?attatataaa?atattgaact?aattttaatt?gtatacgcag 2040

gtatgcttca?gagagtataa?agttagcttg?taaatgggga?tacaaaggcg?tcaagtctgg 2100

tgaaacgtta?tcaggtacgt?tgtttgcttc?ttctttttct?cgtacgctaa?caaaaatatt 2160

taaaaataaa?cccgaccaaa?tgaagtttaa?ttaatcggat?taatgatttt?taatagtcac 2220

tacttttttt?gtgtgggata?tatgactgtc?taatatataa?ttttataaga?aagctaaagg 2280

atttgtttaa?taatttccga?taaataattt?tgcagaagaa?tatttcaata?caaggttgcc 2340

aatagtgatg?aagagaatag?ttcagggagg?agttagacta?gccatgatac?taaaccgggt 2400

ttttagtgac?gatcatgcta?ttgctggtgt?tgctgccact?tgaaccaaac?ccgacatacc 2460

ggggcatcaa?agcatttgat?taagagatta?tttgatacat?tcacaaaatt?aattaaggct 2520

gatcagacat?tcttttcttt?tagtagcttt?atctatgtga?cagctaatgc?ctgtggactg 2580

ctttgtttag?aagtgtttag?cattagatca?tatgctaatt?caatgttatt?aattcatcgt 2640

<210>2

<211>305

<212>PRT

＜213〉Arabidopis thaliana (Arabidopsis thaliana)

<220>

<221>misc_feature

＜223〉protein ENDO1 At1g11190

<400>2

Met?Ala?Ser?Ala?Phe?Arg?Ser?Ser?Thr?Arg?Leu?Ile?Leu?Val?Leu?Gly

1 5 10 15

Ile?Leu?Ile?Leu?Cys?Ser?Val?Ser?Ser?Val?Arg?Ser?Trp?Ser?Lys?Glu

20 25 30

Gly?His?Ile?Leu?Thr?Cys?Arg?Ile?Ala?Gln?Asn?Leu?Leu?Glu?Ala?Gly

35 40 45

Pro?Ala?His?Val?Val?Glu?Asn?Leu?Leu?Pro?Asp?Tyr?Val?Lys?Gly?Asp

50 55 60

Leu?Ser?Ala?Leu?Cys?Val?Trp?Pro?Asp?Gln?Ile?Arg?His?Trp?Tyr?Lys

65 70 75 80

Tyr?Arg?Trp?Thr?Ser?His?Leu?His?Tyr?Ile?Asp?Thr?Pro?Asp?Gln?Ala

85 90 95

Cys?Ser?Tyr?Glu?Tyr?Ser?Arg?Asp?Cys?His?Asp?Gln?His?Gly?Leu?Lys

100 105 110

Asp?Met?Cys?Val?Asp?Gly?Ala?Ile?Gln?Asn?Phe?Thr?Ser?Gln?Leu?Gln

115 120 125

His?Tyr?Gly?Glu?Gly?Thr?Ser?Asp?Arg?Arg?Tyr?Asn?Met?Thr?Glu?Ala

130 135 140

Leu?Leu?Phe?Leu?Ser?His?Phe?Met?Gly?Asp?Ile?His?Gln?Pro?Met?His

145 150 155 160

Val?Gly?Phe?Thr?Ser?Asp?Glu?Gly?Gly?Asn?Thr?Ile?Asp?Leu?Arg?Trp

165 170 175

Tyr?Lys?His?Lys?Ser?Asn?Leu?His?His?Val?Trp?Asp?Arg?Glu?Ile?Ile

180 185 190

Leu?Thr?Ala?Leu?Lys?Glu?Asn?Tyr?Asp?Lys?Asn?Leu?Asp?Leu?Leu?Gln

195 200 205

Glu?Asp?Leu?Glu?Lys?Asn?Ile?Thr?Asn?Gly?Leu?Trp?His?Asp?Asp?Leu

210 215 220

Ser?Ser?Trp?Thr?Glu?Cys?Asn?Asp?Leu?Ile?Ala?Cys?Pro?His?Lys?Tyr

225 230 235 240

Ala?Ser?Glu?Ser?Ile?Lys?Leu?Ala?Cys?Lys?Trp?Gly?Tyr?Lys?Gly?Val

245 250 255

Lys?Ser?Gly?Glu?Thr?Leu?Ser?Glu?Glu?Tyr?Phe?Asn?Thr?Arg?Leu?Pro

260 265 270

Ile?Val?Met?Lys?Arg?Ile?Val?Gln?Gly?Gly?Val?Arg?Leu?Ala?Met?Ile

275 280 285

Leu?Asn?Arg?Val?Phe?Ser?Asp?Asp?His?Ala?Ile?Ala?Gly?Val?Ala?Ala

290 295 300

Thr

305

<210>3

<211>28

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉primer 4-960

<400>3

gtgtttgtcc?agtaatagtg?tcagcata 28

<210>4

<211>26

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉primer 4-721

<400>4

aggaacctga?gaaaagactc?gccagc 26

<210>5

<211>40

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉CEL N-terminal

<400>5

tatcgttcta?gagggaatga?cgcgattata?ttctgtgttc 40

<210>6

<211>27

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉CEL C-terminal

<400>6

tatctgaatt?catgccaaag?aatgatc 27

<210>7

<211>50

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉CEL C-terminal 8 His

<400>7

aattcaatgg?tgatggtggt?gatggtgatg?tgccaaagaa?tgatctgcgg 50

<210>8

<211>25

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉primer (R21)

<400>8

gacatatgga?ctacagaagc?ttggg 25

<210>9

<211>25

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉primer (R22)

<400>9

gttcacgggt?cacatcatgc?attcc 25

<210>10

<211>22

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉primer 4m118

<400>10

ttggttggac?ttcactttga?gc 22

<210>11

<211>22

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉primer 4m984

<400>11

cacaacaatc?agcaatgaca?gc 22

<210>12

<211>23

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉primer 4-347

<400>12

gtgattgctc?cacctccgcc?acc 23

<210>13

<211>30

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉primer 4-134

<400>13

tacagcgatt?gatataatat?aaaattatcc 30

<210>14

<211>27

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉primer le 2462

<400>14

tgatattgtc?gtgcaatatg?atgaaac 27

<210>15

<211>25

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉primer le 3082

<400>15

atacctattt?agcccacttg?gacac 25

<210>16

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉forward primer of ENDO5

<400>16

aaggatccga?aagctctgtg?tttcaga 27

<210>17

<211>28

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉reverse primer of ENDO5

<400>17

ggagttgtta?cgtgggttct?caaggatc 28

<210>18

<211>28

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉forward primer of ENDO4

<400>18

ctggatccct?gtttttaact?ttggaaag 28

<210>19

<211>26

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉reverse primer of ENDO4

<400>19

ggatgttcaa?gtgattctcc?tggatc 26

<210>20

<211>27

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉forward primer of ENDO3

<400>20

aaggatccat?tcgacaaact?ttgtaac 27

<210>21

<211>28

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉reverse primer of ENDO3

<400>21

agagtggtct?tgggaatatt?tatctcag 28

<210>22

<211>26

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉forward primer of ENDO2

<400>22

acggatccca?tttcaaagaa?ctctga 26

<210>23

<211>26

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉reverse primer of ENDO2

<400>23

gaccaatcat?tatgctgtaa?cttcag 26

<210>24

<211>25

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉forward primer of ENDO1

<400>24

caggatccaa?gtttcaaact?tgaag 25

<210>25

<211>26

<212>DNA

＜213〉artificial sequence (Artificial sequence)

<220>

＜223〉reverse primer of ENDO1

<400>25

cggtatgtcg?ggtttggttc?aagtgg 26

Claims (20)

1. method of producing the recombinant chou endonuclease, wherein said method comprises:

-at the described recombinant chou endonuclease of the cell inner expression of host plant, carrying out instantaneous conversion by the Agrobacterium bacterial strain that comprises expression vector, this expression vector comprises the polynucleotide that described endonuclease is encoded;

-from described host plant cell, isolate described recombinant chou endonuclease.

2. the method for claim 1 is characterized in that, described vegetable cell is in complete plant or by in its organ of separating, and wherein uses the instantaneous conversion of described Agrobacterium bacterial strain to soak into by Agrobacterium and finish.

3. method as claimed in claim 2 is characterized in that, it is to carry out in the leaf of described host plant that described Agrobacterium is soaked into.

4. as each described method in the claim 1 to 3, it is characterized in that described host plant belongs to Nicotiana (thegenus Nicotiana).

5. as each described method in the claim 2 to 4, it is characterized in that, isolate described endonuclease in the plant organ that the method by comprising the following step is soaked into from Agrobacterium:

-the organ that soaks into from the Agrobacterium of expressing described endonuclease extracts cell content;

-add ammonium sulfate to ultimate density to described extract to be at least 30%, and from supernatant liquor, isolate protein precipitation;

-add ammonium sulfate to ultimate density to described supernatant liquor to be at least 80%, and reclaim the protein precipitation that comprises endonuclease.

6. method as claimed in claim 5 is characterized in that, ammonium sulfate is to be added into 30% ultimate density in first settling step, and in second settling step to 80% ultimate density.

7. whether candidate's endonuclease of a test S1/P1 family (PFAM 02265) is the method for the special endonuclease of mispairing, and wherein said method comprises:

A) use as each described method in the claim 1 to 5 produce recombinant form as described in candidate's endonuclease;

B) ability of described recombinant chou endonuclease enzyme liberating single stranded DNA is tested;

C) described recombinant chou endonuclease segmental ability of shearing test heteroduplex DNA on predetermined mispairing site is tested;

D) described recombinant chou endonuclease being sheared the segmental ability of heteroduplex DNA of carrying all types mispairing tests.

8. method of screening the special endonuclease of mispairing, wherein said method comprises:

A) with candidate's endonuclease of producing recombinant form as each described method in the claim 1 to 5;

B) ability of described recombinant chou endonuclease enzyme liberating single stranded DNA is tested;

C) the recombinant chou endonuclease of the single stranded DNA of can degrading is tested, and to they known and also well signature the mispairing site on the segmental ability of shearing test heteroduplex DNA test;

D) select can known and also well signature the mispairing site on the segmental recombinant chou endonuclease of shearing test heteroduplex DNA, and their are sheared the segmental ability of heteroduplex DNA carry all types mispairing test;

E) select by step b), c) and the recombinant chou endonuclease of test d).

9. as claim 7 or 8 described methods, the step that further comprises a described recombinant chou endonuclease susceptibility of test, this is that the ability that detects mutant allele in the presence of excessive wild-type allele, to them in dna library is tested, and is chosen at least 9 times of excessive wild-type alleles and has the endonucleases that can detect described mutant allele down.

One kind can be by recombinant chou endonuclease enzyme preparation as method obtains as described in each in the claim 7 to 9.

11. recombinant chou endonuclease enzyme preparation as claimed in claim 10 is characterized in that, described endonuclease is selected from CELI that derives from celery (Apium graveolens) and the BFN1 that derives from Arabidopis thaliana (Arabidopsis thaliana).

12. recombinant chou CELI endonuclease enzyme preparation as claimed in claim 11, it is characterized in that, described recombinant chou CELI endonuclease has following mispairing preferred characteristics: T/T～T/G～A/G～G/G～G/A～G/T 〉=A/A～C/C 〉=T/C～C/T＞A/C～C/A, and can in the presence of 23 times of excessive wild-type alleles, discern mutant allele.

13. one kind can be by the recombinant chou BFN1 endonuclease enzyme preparation of the acquisition of method as described in claim 7, wherein said recombinant chou BFN1 has following mispairing preferred characteristics: G/G～G/A～A/G～G/T～T/G＞T/T～A/A～C/C～T/C＞C/T～A/C～C/A, and can in the presence of 59 times of excessive wild-type alleles, discern mutant allele.

14. one kind as the purposes of recombinant chou endonuclease enzyme preparation as described in each in the claim 10 to 13, be used to detect in DNA duplex by base and substitute the mispairing that causes, perhaps insert or lack the mispairing that one or more Nucleotide cause in the chain in described duplex.

15. one kind as each target inductive local lesion in genome of described recombinant chou endonuclease enzyme preparation (Targeting-Induced Local Lesions IN Genomes, TILLING) purposes in the mismatch cleavage scheme in the claim 10 to 13.

16. one kind as the purposes of recombinant chou endonuclease enzyme preparation as described in each in the claim 10 to 13, is used for differentiating by Ecotilling the polymorphism of the DNA of natural population.

17. one kind as in the claim 10 to 13 as described in each recombinant chou endonuclease enzyme preparation as the purposes of mispairing detection reagent.

18. one kind as the purposes of recombinant chou endonuclease enzyme preparation in the mispairing screening method as described in each in the claim 10 to 13.

19. one kind as the purposes of recombinant chou endonuclease enzyme preparation as described in each in the claim 10 to 13, is used for any organism population or screens one or more sudden changes simultaneously in the target gene of deutero-clone thus, it carries out through the following steps:

A) described target gene or its part to each individuality in the described population increases,

B) described amplification product is sorted in 2 dimensions or 3 dimension matrixes, comprises row, column (2 dimension matrix) and post (3 dimension matrix),

C) described amplification product is concentrated, obtained different storehouses with this, row, delegation or a post of described matrix represented in each storehouse,

D) the reference amplification product that obtains from not mutated gene to each storehouse interpolation, and under the environment that allows the formation heteroduplex, these storehouses are cultivated, and

E) with described endonuclease enzyme preparation each storehouse is cultivated, and

F) existence of detection heteroduplex in the storehouse of described cultivation.

20. one kind as the purposes of recombinant chou endonuclease enzyme preparation as described in each in the claim 10 to 13, be used for the one or more sudden changes in the target gene being screened simultaneously, wherein carry out following steps any organism population or in by its deutero-clone:

A) each individuality to described population sorts in 2 dimensions that comprise row, column (2 dimension matrix) and post (3 dimension matrix) or 3 dimension matrixes,

B) each row, row and post concentrated obtained different storehouses, thereby make each storehouse represent row of described matrix, delegation or a post with this,

C) in each storehouse, add the reference gene product that obtains from not mutated gene,

D) in each storehouse, described target gene or its part are increased, with the storehouse of this product that obtains to increase,

E) under the environment that allows the formation heteroduplex, the storehouse of described amplification product is cultivated,

F) with described endonuclease enzyme preparation the storehouse of described amplification product is cultivated, and

G) existence of detection heteroduplex in the storehouse of described cultivation.

Images