CN1211484C - Novel DNA fragment elevating gene expression dose - Google Patents

Abstract

The invention provides a novel DNA fragment capable of enhancing the expression level of a gene. The DNA fragment according to the present invention contains a nucleotide sequence of from one of the nucleotides at around positions 1- to 152 to one of the nucleotides at around positions 259 to 374 in the sequence represented by SEQ ID NO:1 and is capable of enhancing the expression level of a gene.

Description

Improve the dna fragmentation of gene expression dose

Related application

The application requires the right of priority of Japanese patent application 1999 No. 232815, and its content is incorporated herein by reference.

Technical field

The present invention relates to a kind of new dna fragmentation, it is the expression of enhancing gene significantly.

Background technology

In recent years, in voguely in plant carry out molecular breeding with gene engineering.When utilizing the gene engineering expression alien gene in plant materials, the gene that imports in the plant may not high-caliberly be expressed, and the expression level that normally obtains is manyly lower than expection.In addition, when carrying out material production in plant materials, its essential condition imports exactly and efficiently expresses gene, thereby the technology of exploitation gene efficient expression is very important.

One of technology that promotes exogenous gene expression is exactly to utilize the dna fragmentation with the base sequence that promotes genetic expression.Such dna fragmentation has 5 ' untranslated leader or intron sequences.For example, report was arranged once, with first exon (5 ' untranslated leader) (the Plant Mol.Biol. such as Maas of corn Shrunken-1 gene 16, 199-207,1991) and first intron of the catalase gene of castor-oil plant No. the 103182nd, patent gazette (put down into 3 years) insert the upstream of foreign gene, promote expression of exogenous gene thereby make this foreign gene obtain expressing.Other has report, from several 5 ' untranslated leaders of plant or intron sequences the effect that promotes genetic expression (Plant Mol.Biol. such as Koziel is arranged 32, 393-405,1996).

The effect of this promotion genetic expression of intron sequences is subjected to the influence of adjacent exon sequence length.For example, near its 5 ' end of the 6th intron of ethanol dehydrogenase 1 gene of corn a 76bp exon is arranged, 3 ' can reach maximum expression effect (Plant Mol.Biol. such as Mascarenhas when a 53bp exon being arranged near the end 15, 913-920,1990).

In addition, the genetic expression increase effect that is caused by intron sequences also is subjected to influence (the Plant Mol.Biol. such as Koziel of the several factors such as base sequence of the kind of promotor or plant species, structure gene 32, 393-405,1996).Be not that all 5 ' untranslated leader and intron sequences can both promote expression of gene.Therefore be starved of further evaluation and more kinds ofly strong basis arranged more with utilizing because of the 5 ' untranslated leader or the intron sequences of expressional function.

Brief summary of the invention

An object of the present invention is to provide a kind of new dna fragmentation that can obviously improve genetic expression.

Another object of the present invention is to utilize described new dna fragmentation, provides a kind of method that can obviously improve exogenous gene expression to host gene.

Description of drawings

Fig. 1 represents to be used to analyze the building process of the carrier of promoter expression.B:BamHI among the figure, Bg:Bgl II, H:HindIII, Sc:Sac I, Sl:Sal I.

Fig. 2 is the result who analyzes the GUS expressive site of 213 promotors.Transverse axis has represented to check the various organs of the transformant that GUS expresses, and the longitudinal axis is illustrated in and shows the transformant number of expressing in the corresponding organ.Be expressed as separately among the figure:

Black: express the strongest, oblique line: express general～express very weak, grey: express the most weak

White: do not have and express

L: leaf, R: root, P: gynoecium, A: flower pesticide, Lo: lodicule, P ﹠amp; L: the inside/outside bran,

BS: small ear base portion

Fig. 3 represents need not the segmental preparation process of ATG.

Fig. 4 represents to be used for the structure of the plasmid of instantaneous detection.

Detailed Description Of The Invention

No matter the inventor finds finally through further investigation whether a kind of dna fragmentation or its part contain Have introne all strongly to promote gene expression, described dna fragmentation comprises a kind of predominant expression of Rice Floral Organ Gene (RPC213 gene; SEQ ID NO:3) arrives the 3rd ATG of next-door neighbour near the transcripting start point Sequence before (SEQ ID NO:1).

Below elaborate the present invention.

Dna fragmentation of the present invention shows the effect that increases this genetic expression in the analysis that the RPC213 gene promoter is expressed, for example dna fragmentation of the present invention is inserted between cauliflower mosaic virus 35S RNA promotor and beta-Glucuronidase (GUS) gene, and it is imported in the corn protoplastis expression system, contrast is inserted with this dna fragmentation and the expression system that does not insert this dna fragmentation, and the gene that its result has confirmed to insert this dna fragmentation has the active effect of remarkable increase GUS.Its effect does not have specificity to the paddy rice floral organ, and it all has ubiquity in a lot of vegetable cells.In addition, the RPC213 gene can be used as a kind of predominant expressed gene to be separated in the floral organ of rice varieties IR24, as described in subsequent embodiment 1.

The 1st kind of sequence of the present invention is gene order shown in SEQ ID NO:1 in the sequence table, before from RPC213 genetic transcription starting point to the 3rd ATG of next-door neighbour.This sequence is made of 374bp, comprises the intron of a 81bp.This sequence is inserted between the promotor and gene to be expressed in the described expression system, confirms that its genetic expression enhancement is than exceeding more than 90 times of not inserting.This sequence is equivalent to the 4996th to 5369 base sequence from SEQ ID NO:4, and it is RPC213 gene clone [RPG106; With reference to the E among the aftermentioned embodiment 2)] base sequence.

The gene order of the 2nd kind of sequence for shown in SEQ ID NO:7 in the sequence table, having modified.This sequence and the SEQ ID NO:1 that derives from the RPC213 gene much at one, but the T (thymus pyrimidine) that is arranged in 2 ATG of different reading frames is replaced into A (VITAMIN B4).Therefore, ATG just was not present among the sequence after intron excised from this sequence, and the translation of gene can be not initial from the starting point ATG of RPC213.The genetic expression enhancement of verified described sequence in this expression system is very high, so that reach about 60 times.

The 3rd kind of sequence is the sequence of modifying factor shown in the SEQ ID NO:5.This sequence is made of 325bp, and it has lacked among the SEQ ID NO:1 15bp of 34bp, the 3 ' end of 5 ' end, and the T (thymus pyrimidine) among the unique ATG (the 2nd ATG of RPC213) is replaced into A (VITAMIN B4) in the sequence.The intron that comprises 81bp in the sequence.This sequence is equivalent to the 5030th to the 5354th the base sequence of SEQ ID NO:4.This sequence is identified has the effect that increases genetic expression, about up to 11 times.Do not contain ATG behind this sequence excision intron, the translation of gene also just can not be initial from the ATG of RPC213.

The 4th kind of sequence is the sequence shown in the SEQ ID NO:2.This sequence is to add the exon sequence of 15bp and add the exon of 12bp at 3 ' end at the 81bp of RPC213 gene intron sequences 5 ' end, and this sequence length is 108bp.This sequence is equivalent to the 5147th to the 5254th the base sequence of SEQ ID NO:4.Verified this sequence increases acting as about 4 times of genetic expression.Do not contain ATG behind this sequence excision intron.

The 5th kind of sequence is the sequence shown in the SEQ ID NO:8 in the sequence table, and it is the cDNA sequence before from transcripting start point to the 3rd ATG of next-door neighbour in the RPC213 gene.This sequence does not contain intron and is made of 293bp.This sequence is equivalent to the 2nd to the 294th base sequence from SEQ ID NO:3, but the T (thymus pyrimidine) that wherein is arranged in 2 ATG of different reading frames has been replaced into A (VITAMIN B4).So the translation of expressing gene can be not initial from the ATG of RPC213.And the genetic expression enhancement that confirms this sequence is very high, is about 10 times.

From these sequence situations, the DNA construct that endogenous RPC213 gene is formed to the 3rd ATG of next-door neighbour sequence before from transcripting start point in the vegetable cell is suitable for the regulation and control of genetic expression, the regulation and control of especially transcribing most.Reduce (the 5th invention) though remove the intron expressional function the DNA from transcripting start point to the 3rd ATG of next-door neighbour, 4 times the expressional function but intron itself is only had an appointment, from this aspect, intron and do not comprise that the enhancement to genetic expression has synergistic effect between the primary structure of DNA (its from transcripting start point to the 3rd ATG of next-door neighbour) of intron.

Therefore, the invention provides: the dna fragmentation that comprises sequence shown in the SEQ ID NO:1 or its part, contain or do not contain the above-mentioned fragment of intron, by modifying above-mentioned dna fragmentation and keeping the dna fragmentation that the effect of reinforcing gene expression can obtain easily (for example comprise sequence, contain or do not contain intron and dna fragmentation that can reinforcing gene expression) near any base the 1-151 position near any base the 259-374 position.

Can separate the dna fragmentation contain sequence shown in the SEQ ID NO:1 from paddy rice, as described in embodiment hereinafter.Maybe will be respectively with 2 oligonucleotide of two ends complementary of sequence shown in the SEQ ID NO:1 as primer, be that template is carried out the PCR reaction and is easy to obtain this dna fragmentation with the rice genome.Moreover, utilize dna synthesizer to synthesize part or all DNA, also can prepare this fragment by suitable connection again.Base sequence shown in the SEQ ID NO:2,5,7 or 8 can prepare according to subsequently embodiment equally, or utilizes synthetic part or all the DNA of dna synthesizer, also can prepare by suitable connection again.

We know that when the base sequence of physiologically active DNA took place partly to change, it still had same physiologically active sometimes.Therefore, 1 or several nucleotide deletions, displacement, insertion or interpolation are arranged in the base sequence shown in the SEQ ID NO:1,2,5,7 or 8 or its partial sequence,, still belong to category of the present invention as long as have the genetic expression enhancement.For example, the interpolation of Nucleotide, insertion, disappearance or displacement can be passed through site-directed mutagenesis (as Nucl.Acids Res. 10, 6487-6500,1982) finish, herein " 1 or several Nucleotide " refer to add by kunkel method Kunkel, the number of insertion, disappearance or metathetical Nucleotide.As add or insert, disappearance, displacement be less than 10 Nucleotide, preferably less than 5 Nucleotide.For example can utilize with single stranded phage DNA complementary synthetic oligonucleotide primer thing and position mutagenesis, obtain required variation.Promptly make the synthetic and phage complementary chain of primer, transform the host bacteria that carries phage with the dna double chain that obtains with described synthetic oligonucleotide.On agar plate, cultivate the bacterium that has transformed, make the individual cells that contains phage form plaque.Like this, have the phage in 50% the new bacterium colony to contain the strand variation in theory, all the other bacterium colonies of 50% contain complete sequence.Can hybridize at the plaque that contains said mutation DNA but contain under the temperature that the plaque of complete sequence can not hybridize, gained plaque and the synthesising probing needle of having handled with kinases are hybridized.DNA is cultivated and reclaimed to the plaque of picking and this probe hybridization then.

Genome with other plant except that paddy rice is a template, to be complementary to 2 oligonucleotide of two ends of SEQ IDNO:1 respectively as primer, react through PCR, can obtain certain difference being arranged, but have the dna sequence dna of the genetic expression enhancement identical with dna fragmentation of the present invention with sequence shown in the SEQ IDNO:1.Such dna fragmentation generally can be hybridized with the dna fragmentation with sequence shown in the SEQ IDNO:1 under rigorous condition.Therefore as long as this dna fragmentation can increase genetic expression and all belongs to category of the present invention.This paper " rigorous condition " refers to: 6 * SSC, 5 * Denhert ' s solution, 0.1%SDS, 50% methane amide, room temperature～42 ℃.

The effect of dna fragmentation of the present invention is a reinforcing gene expression.Herein " effect of reinforcing gene expression " refer to, the upstream of the gene that dna fragmentation of the present invention is incorporated into promotor and controls by this promotor, downstream or preferred its central area, than situation about not integrating, the level of genetic expression strengthens 1 times at least, preferred 2 times, preferably be higher than 3 times.Can strengthen the preferred foreign gene of gene of expression, also the original gene of cell.

In order to confirm the activity of dna fragmentation reinforcing gene expression of the present invention, allow to use any expression system.Instantaneous detection as preferred subsequent embodiment 4 narrations.

The present invention further provides a kind of method, it comprises one of dna fragmentation of the present invention is integrated into a kind of DNA construct, this construct contains expressed exogenous gene in host cell, transform this host cell with this construct then, it increases with the DNA construct institute transformed host cells that does not contain described dna fragmentation described expression of exogenous gene ratio.

The host cell example has eukaryotic cell such as animal and plant cells or fungal cell etc., and the preferred plant cell, especially preferred monocot plant cell.

Foreign gene is can be at any gene of used host cell inner expression, as the gene of coded protein, or the gene of coded protein (for example gene that sense-rna is transcribed) not.

Promotor is any promotor that can work in used host cell.When being host cell, preferably use cauliflower mosaic virus 35S promoter, ubiquitin promoter, actin promoter, PPDK promotor, PEPC promotor etc. with the vegetable cell.

Dna fragmentation of the present invention can be integrated by following process: dna fragmentation of the present invention is coupled on the carrier or plasmid compatible with described host with promotor and the foreign gene under promotor control, uses this carrier or plasmid transformed host cell again.Preferred described carrier or plasmid have the mark that can screen transformant.The optimum seeking site of integrating dna fragmentation of the present invention but is not limited thereto between promotor and foreign gene, only requires and integrates the genetic expression enhancement that this dna fragmentation can be brought into play in the position.According to the present invention, entrained dna fragmentation of the present invention, promotor and the foreign gene of transformant both can be incorporated on the karyomit(e), also can be incorporated on the expression vector.

Again, the expression of exogenous gene level is relevant with the activity of the transcription speed of foreign gene, the accumulation of transcription product, proteinic accumulation or enzyme.

Set forth content of the present invention particularly according to embodiment below.

Embodiment

The separation of embodiment 1 RPC213 cDNA

Rice varieties " moonlight " is reached " IR24 " in hot-house culture, in order to experiment.

(A) extracting of RNA

Experiment material is taken from the leaf of [IR24], ripe and immature gynoecium, flower pesticide, lodicule, flower glume, immature seed, seeds germinated, root, callus and immature small ear (long 4.5-6.0mm), rapidly with liquid nitrogen freezing ℃ preservation then-80.With phenol/SDS method (Watanabe﹠amp; Price, institute of NAS periodical, 79, 6304-6308,1982) and the total RNA of extraction from these tissues.Adding a kind of oxidation inhibitor beta-mercaptoethanol in extraction buffer, to make final concentration be 10% (V/V).Again, in order to eliminate sneaking into of any trace amount DNA, will be for the tissue of testing in reverse transcription PCR, (the RNA level, Pharmacia) (FPLC is pure, Pharmacia) handles, and does not use the lithium chloride precipitator method with DNaseI down in existence at the RNase inhibitor.That is, at 40mM Tris-Cl pH7.5,6mM MgCl ₂With total nucleic acid and the 1.75U/ μ l RNase inhibitor mixed of 0.375 μ g/ μ l, add 0.375U/ μ lDNaseI (concentration is ultimate density) again in the damping fluid, 37 ℃ incubation 10-30 minute.Make the DNaseI inactivation with phenol/chloroform extracting then.

Leaf and root (being designated as root (soil) in the table 1) pick up from 1 month cultivation plant of greenhouse sowing, the prematurity gynoecium picks up from the plant in preceding 1 thoughtful 2 weeks of heading, ripe gynoecium and flower pesticide, lodicule, flower glume pick up from be about to bloom or bloom before a few days ago, immature seed picks up from the plant in the back 1-2 week of blooming.Seeds germinated and root be the N6 substratum (Scientia Sinica such as Chu, 18, 659-668,1975) and carry out the plant materials of 1 week, 3 all sterile culture behind the upper seeding wheel respectively.Be added with 2mg/l 2, on the N6 solid medium of 4-D seed induced, then 3 weeks of shaking culture in the same liquid nutrient medium of forming, getting callus.Total RNA of gynoecium and leaf with Oligotex-dT30 super (the wine treasured is made) according to the step purifying of shop instructions with preparation PolyA+RNA.

(B) structure in gynoecium cDNA library

Separation and purification PolyA+RNA from gynoecium is a template with the PolyA+RNA of about 1 μ g, with the synthetic cDNA of the synthetic box (STRATAGENE) of ZAP-cDNA.The specification sheets appended according to test kit connects the EcoRI joint again with after the XhoI digestion to cDNA, is connected in carrier UniZAP XR.Use Giga pack Gold packaging extract (STRATAGENE) that phage DNA is packaged among the phage particle then.

C) differential screening

Carry out differential screening according to high storehouse (WO98/29542) method.From B) get about 30,000 plaques in the cDNA library that makes up and check that the result has 198 plaques and gynoecium probe hybridization to show strong hybridization signal and only show weak signal with the leaf probe hybridization.Again wherein 152 clones are carried out programmed screening.For fear of the strong background of plaque hybridization and make screening effectively, adopt following method screening.At first, drip SM damping fluid (0.1M NaCl, the 7mMMgSO of chloroform in 200 μ l ₄, 50mM Tris-Cl pH7.5,0.01% gelatin) in and be stored in this damping fluid under 4 ℃ of the plaques of screening for the first time.Dilution is preserved liquid and with the phage bed board, is made the density of plaque very low (10-100pfu/ plate) then, separates single plaque and is stored among the same buffer.From this damping fluid, preparation contains the dull and stereotyped lysate of high density phage, carries out cutting in the body according to the synthetic box specification sheets of ZAP cDNA, thereby makes plasmid (pBLuescriptSK (-)) by this phage genome.

Also therefore cDNA is inserted fragment with restriction enzyme EcoRI and XhoI (precious wine is made) digested plasmid and carry out separation and purification.This cDNA inserts fragment and carries out fractional separation with 0.8% agarose gel electrophoresis, transfer to then on the HybondN+ nylon leaching film, with the probe of gynoecium and leaf, and carry out differential hybridization through oligo dT primer synthetic strand cDNA probe from total RNA of flower pesticide, seeds germinated, root, callus or immature seed.As a result, obtain 6 with gynoecium probe hybridization, and the cDNA of hybridizing hardly with other probes clone.Wherein will contain the 1.5kb cDNA that has an appointment and insert segmental clone's called after " RPC213 ", use for following experiment.

D) analyze the organ expression specificity that cDNA clones

To above-mentioned C) the cDNA clone " RPC213 " of screening carries out the Northern blot hybridization, to check expression pattern and the expression level thereof in each organ.Following making filter membrane.

At first remove above-mentioned A with deionized oxalic dialdehyde and DMSO according to " molecular cloning " (Smbrook etc., 1982)) in the secondary structure of total RNA 20 μ g of each organ, use 1% sepharose fractional separation then.With ordinary method RNA is transferred on the nylon membrane Gene Screen Plus (E.I.Du Pont Company) again.80 ℃ of vacuum-dryings are after 1 hour, in 20mM Tris-Cl pH8.0 filter membrane are boiled and remove oxalic dialdehyde in 5 minutes.The probe that uses is to utilize many primer marks system (Amersham company) the EcoRI-XhoI 1.5kb fragment of described cDNA to be carried out the probe of RI mark.Prehybridization and hybridization are all operated according to the filter membrane specification sheets.Wash conditions is: under the room temperature in 2 * SSC, 1%SDS and in 0.2 * SSC, 1%SDS each 5 minutes, and 65 ℃ in 0.16 * SSC, 1%SDS 15 minutes totally 2 times, among room temperature 2 * SSC 1 minute.Make Kodak X-Omat film-70 ℃ in the filter membrane exposure of spending the night.

As a result, in ripe gynoecium, detect strong hybridization signal, in flower glume and callus, detect weak signal, in leaf and flower pesticide and immature seed, detect extremely weak signal.And other organ does not detect signal.Therefore as can be known from Northern engram analysis result, more intense through the isolating expressional function that is cloned in the ripe gynoecium, in flower glume and callus, express very weakly, in leaf and flower pesticide and immature seed, express faint.The size of transcription product is speculated as about 1.6kb.

For the organ specificity that can analyze relevant cDNA clone is more with sensitivity expressed, be that template is carried out the reverse transcription PCR reaction with the RNA of each organ of paddy rice.At first, use GENESIS 2000 fluorescence sequenators (E.I.Du Pont Company) part to measure the segmental base sequence of cDNA that is inserted into plasmid pBluescript SK (-).Specification sheets according to sequenator carries out the T7 dna polymerase reaction with primer M13 and M14 (precious wine is made), carries out electrophoresis with 6% acrylamide gel.Measure base sequence from 5 ' (EcoRI) ends and 3 ' (XhoI) end both directions.Wherein the dna sequence dna with about 400 Nucleotide of 3 ' end (mRNA positive-sense strand) is that template is synthesized a kind of primer with dna synthesizer (ABI company):

213S；5′-CGCTATGGCCCGTTTCAGCT-3′

213AS；5′-GTCGTCCTGTCGCTTCATTAC-3′

With OPC post (ABI company) purifying, be used for reverse transcription PCR.Might be with the product of the about 250bp of these primer amplifications.Again with rice actin 1 gene (RAcl, PlantMol.Biol. such as McElroy 14, 163-171,1990) sequence be basic synthetic primer:

5′-GTATCCATGAGACTACATACAACT-3′

5′-TACTCAGCCTTGGCAATCCACA-3′

As control group.Accompany intron in the middle of these primers, when template DNA is mixed with genomic dna, except the cDNA product of 267bp, infer the genomic dna product that also has 350bp.

The total RNA of 10 μ g of above-mentioned each organ is mixed with the few dT15 primer (Amersham) of 500ng, 70 ℃ of 10 minutes degraded secondary structures in 55 μ l reaction solutions, behind the ice bath, 1 * the first polynucleotide chain damping fluid (BRL) of 100 μ l, 0.5mM dNTPmix, 10mM DTT, 2U/ μ lRNase inhibitor (the RNA level, Pharmacia), 37 ℃ of incubations 60 minutes in 10U/ μ l reversed transcriptive enzyme Superscript (BRL) (concentration the is ultimate density) reaction solution.95 ℃ of 5 minutes degradation of rna-cDNA heterozygotes then, ice bath.The cDNA concentration of this solution is 100ng/ μ l.Synthetic cDNA with each organ is diluted to 4 gradients (100ng/ μ l, 10ng/ μ l, 1ng/ μ l, 0.1ng/ μ l) again, as the template of PCR reaction.

The PCR reaction is as follows: at first prepare the reaction solution of 20 μ l with the cDNA diluent of 1 μ l, wherein final concentration is: 0.5pM/ μ l primer, 0.2mM dNTP, 1 * PCR damping fluid, 0.05U Taq polysaccharase (precious wine is made).Carry out the PCR reaction with GeneAmp9600 (Perkin Elmer company), its condition is 94 ℃ of 1 circulations in 3 minutes, 94 ℃ 0.5 minute, 60 ℃ 1 minute, 72 ℃ totally 30 circulations in 1 minute, 72 ℃ of 1 circulations in 6 minutes.Take a picture behind PCR product process agarose gel electrophoresis, the ethidium bromide staining.Compare the intensity of each electrophoresis band, 2 samples that intensity is identical are evaluated as RPC 213 gene cDNAs that comprise equivalent.

Experiment in contrast makes total RNA reverse transcription product of each organ with the Racl gene primer of equal constitutive expression in all organs of paddy rice, and it is carried out PCR.The result detects the 267bp PCR product of expection in all organs of research, do not detect the 350bp product.Therefore think that template cDNA is not polluted by genomic dna.

By using plasmid clone, confirmed that primer with the RPC213 gene can increase to have and expected the product of molecular weight.When carrying out reverse transcription PCR with these primers, with the cDNA of 100ng as template, detect tangible PCR product band in ripe gynoecium and flower glume and callus, its band is very shallow in flower pesticide and immature seed, and its band is more shallow in leaf, seeds germinated and root.Wherein, also can detect the PCR product when template cDNA is diluted to 1ng in ripe gynoecium and flower glume, opposite callus, flower pesticide and immature seed can only detect the PCR product when template DNA reaches 10ng.Template is diluted to 100ng when following, can not detects the PCR product in leaf and seeds germinated, the root.Whether existence according to the product band reaches strength ratio, RPC213 expression of gene level is in each organ of paddy rice, with the expression level in the ripe gynoecium is 1 o'clock, and flower glume is about 1-1/10, and flower pesticide and immature seed and callus are about 1/10, other organ is about 1/100.

Each position of following surface analysis floral organ and the expression level of etap.Template is the cDNA that makes from the ovary of the column cap of complete ripe gynoecium, ripe gynoecium, ripe gynoecium, complete prematurity gynoecium and lodicule.CDNA and plasmid DNA with leaf compare group.Control experiment is at first carried out the PCR reaction with the Actin muscle primer.The result is that the 267bp product can increase from all template cDNA.Carry out the PCR reaction with the RPC213 Auele Specific Primer then.As a result, when the cDNA with 10ng is template, in all organs except that leaf, detect the PCR product.Even wherein prematurity gynoecium and column cap, lodicule are diluted to 0.1ng to template and also can detect its product, detect product when above yet in ripe gynoecium and ovary thereof, can only be diluted to 1ng in template.Estimate that thus the expression level of the RPC213 at each position of floral organ is with the level in sophisticated complete gynoecium at 1 o'clock, prematurity gynoecium and column cap, lodicule are about 10, and ovary is about 1.The result who is reverse transcription PCR shows, the RPC213 gene all has very strong predominant expression on the column cap of prematurity gynoecium, ripe gynoecium and lodicule, and the ovary of ripe gynoecium and flower glume are expressed very weak, expression hardly in other tissue.

Above Northern engram analysis result and RT-PCR result are reduced table 1.

The analytical results of table 1 RPC 213 genetic expressions

The ripe pistil stigma ovary of organ/analytical procedure prematurity gynoecium

Northern analyzes ++ NT NT NT

RT-PCR 1 10 1 10

Organ/analytical procedure lodicule inside/outside bran flower pesticide immature seed

Northern analysis NT+-±

RT-PCR 10 1-0.1 0.1 0.1

Organ/analytical procedure seeds germinated blade root subterraneous root callus

The Northern analysis-±--+

RT-PCR 0.01 0.01 0.01 NT 0.1

++: strongly expressed; +: weak expression; ±: seldom express;-: do not express.

NT: do not analyze.

RT-PCR: with the expression level in the ripe gynoecium is 1 relative expression's value of determining

E) mensuration of RPC213 base sequence

With the following whole base sequences that are determined at cDNA clone RPC213 (about 1.5kbp) specific expressed in the floral organ of fluorescence sequenator (373A type, Applied Biosystems).Base sequence with aforementioned M13 primer (precious wine is made) is basic synthetic primer, measures the not base sequence of area decoder again.Record the RPC213 base sequence that the total alkali radix is 1496bp at last by repeating this primer traveling method.Carry out the ORF retrieval, identify reading frame with maximum ORF.In this reading frame, a kind of sequence (Heidecker and Messing, Annu.Rev.Plant Physiol. that is similar to the PolyA signal 37, 439-466,1986) and be positioned at about 70bp in downstream and the 90bp place of the sub-TGA of translation stop codon.SEQ ID NO:3 shows whole base sequences of RPC213.The base sequence of SEQ ID NO:3 is 1524bp altogether, is added on transcriptional start point 28bp afterwards comprising the base sequence according to following genomic clone.

The separation of embodiment 2 RPC213 promotors

(A) structure of genomic library

The genomic dna of the leaf that paddy rice " IR24 " is after planting about 2 months separates with SDS/ phenol method and with lithium chloride precipitator method purifying.With the partially digested genomic dna of restriction enzyme MboI (precious wine is made), be used for sucrose density gradient centrifugation.Sucrose is made 5 gradient concentrations (10,17.5,25,32.5 and 40%) with damping fluid (20mM Tris-HCl pH8.0,1mMEDTA, 200mM NaCl) dissolving.Make this sucrose solution by said sequence layering from bottom to up in centrifuge tube (40PA, Hitachi), top layer is partially digested dna solution.20 ℃ with rotor SRP28SA (Hitachi) with 20, centrifugal 17 hours of 000rpm is divided into 80 fractions of each 0.5ml with peristaltic pump with this mixture again, obtains to contain in a large number the fraction of 16-23kb DNA.This DNA fraction is connected to λ DASHII/BamHI (STRATAGENE) with T4 dna ligase (BOEHRINGERMANNHEIM), uses GigapackIIGold packaging extract (STRATAGENE) to be packaged into phage particle again.

(B) Ke Long screening

Make approximately 10, the 000pfu phage mixes with the intestinal bacteria SRBP2 that is used to infect, and flattens 39 ℃ of incubated overnight on 14 * 10cm square culture dish.Nylon leaching film Hybond N+ (Amersham) is contacted with the plaque surface, handle filter membrane according to the appended explanation of filter membrane.The 0.6kb EcoRI-SalI fragment of paddy rice floral organ-specific cDNA (RPC213) 5 ' end is carried out the RI mark with many primer marks system (Amersham), is that probe carries out plaque hybridization with the gained marker.Hybridization and wash conditions are according to the C among the embodiment 1) implement.From 100,000 plaques, filter out 6 positive colonies according to this method.Preparing phage DNA again from these positive plaques, is that template is carried out the RPC reaction with PCR213 Auele Specific Primer 213S, 213AS with this DNA.The expection product of about 250bp has consequently increased in 2 clones (RPG106 and RPG107).

(C) contain the subclone in the district of promotor

Extract DNA from above-mentioned 2 RPC213 genomic clones, after cutting with restriction enzyme SacI, HindIII (precious wine is made) enzyme, fractional separation in 0.8% sepharose.From the plant materials of after planting about 1 month rice varieties [autumn light] and [IR24] by phenol/SDS method (Theor.Appl.Genet. such as Komari 77, 547-552,1989) and separation and purification DNA.Cut the DNA of about 5 μ g with SacI, HindIII enzyme, electrophoresis is the same.Again DNA is with trace on nylon leaching film HybondN+ (Amersham), then as embodiment 1D) as described in the dna fragmentation of aforementioned 1.5kb is carried out the RI mark, carry out DNA hybridization with this marker as probe.

Hybridization and wash conditions are implemented according to the filter membrane specification sheets.Its result of implementation is, in RPG106, band of the same size in the situation with total genomic dna occurs.Thereby with among the RPG106 with the 6.0kb SacI fragment subclone of probe reaction same site to pBluescript.Use 4 kinds of restriction enzyme BglII, HindIII, SacI, SalI to make physical map, so that further locate the district that comprises this promotor.

(D) measure the segmental whole base sequences of 5.4kb SacI-SalI among the RPG106

4 BglII sites are arranged on the genomic clone RPG106.Utilize these restriction sites to carry out subclone, measure the base sequence of two chains with M13 primer (precious wine is made) by fluorescence sequenator (373A type, Applied Biosystems).Can not can measure base sequence with primer walking method with the district of this method decoding and the proximity in subclone site, thereby measure the segmental whole base sequences of 5.4kb SacI-SalI (5396bp altogether) of RPG106, be shown in SEQ ID NO:4.This base sequence and RPC213cDNA clone's base sequence relatively, just wherein a part of but comprise almost whole ORF with the isolating cDNA clone of differential sieve method as can be known.That is, ATG is positioned at isolating cDNA clone 5 ' end 7 base places, upstream.The reading frame that comprises this ATG is consistent with above-mentioned cDNA reading frame.The intron sequences that a 81bp obviously, is arranged between ATG in the same reading frame of RPC213 gene and the 3rd ATG.Between an ATG and intron, there is one to belong to the 2nd ATG of different reading frames with them.Among the cDNA from 5 ' hold the sequence in the 1st SalI site that 300bp is arranged approximately, respective area in it and the RPG106 genomic dna but not contain the base sequence of intron in full accord.

(E) mensuration of transcripting start point

Measure transcripting start point according to primer extension.A Synthetic 2 primer

213Z；5′-TGCTGGTATGGATGTGATG-3′

213Z-2；5′-CTGACGAGGCTGTTGCTG-3′

With MEGARABEL test kit (precious wine is made) by specification 5 of above-mentioned primer (each 10pM) ' end with [γ- ³²P] ATP carries out the RI mark.RNase inhibitor (RNA level, Pharmacia) the following primer 0.1pM (0.3 * 10 that in damping fluid (0.25M KCl, 2mM Tris-HCl pH8.0,0.2mM EDTA), makes described mark of existence at 3U/ μ l ⁶Cpm) with total RNA 50 μ g of prematurity small ear (heading before 1-2 week) or leaf 42 ℃ of annealing 2 hours in 10 μ l reaction system.Add another damping fluid (66mM Tris-HCl pH8.3,6.6mM MgCl then ₂, 1.3mM DTT, 0.66mM dNTP, 130 μ g/ml dactinomycins) and 30 μ l and 1 μ l (200U) ThermoScript II (SUPERSCRIPT, BRL), 42 ℃ of incubations 1 hour.Add ethanol and ammonium acetate then and make it precipitation, air-dry after sinking with 70% washing with alcohol, be dissolved in electrophoretic buffer (with the reaction terminating liquid and the 0.1MNaOH of T7 sequencing kit (Pharmacia), 1mM EDTA gets with mixing in 2: 1).

With complete soln in 95 ℃ of heating 3 minutes, electrophoresis on 6% acrylamide gel then.Simultaneously electrophoretic also useful same primers as, be that template is implemented the product that checks order and form through the T7 sequencing kit with the plasmid that contains 2.3kb RPG106 BglII, and the 10bp of the thing that serves as a mark and 50bp ladder (BRL company), described ladder has been used MEGARABEL test kit and [γ ^-32P] ATP carries out the RI mark endways by permutoid reaction.As a result, never express among the leaf RNA of this gene and do not obtain extension products, on the contrary, when being template, detect the band of 2 extension products, detect the band of 3 extension products with the 213Z-2 primer with the 213Z primer with total RNA of prematurity small ear.By with ladder relatively, with these two primer products therefroms to detect the position the same.From then on the result has continuous 3 groups of transcription initiation bases " CAA ", and concludes and transcribe from these cytosine(Cyt)s or VITAMIN B4 on the RPC213 gene.TATA box sample sequence (5 '-TATAAAT-3 ') is positioned at the 31bp place, upstream of the cytosine(Cyt) (C) of upstream transcription starting point.Other plant gene similar (Nucleic Acids Res., 15,6643-6653,1987) of distance from this TATA box to transcripting start point and Joshi report.In addition, the translation initiation codon of supposing (ATG) is present in the 21bp place, downstream of the C of this transcripting start point.

The analysis of embodiment 3 RPC213 promoter expressions

A) make up carrier and the rice transformation that is used for the promoter expression analysis

For the vivoexpression of the promotor of analytical separation, the carrier (Fig. 1) that following structure links to each other with the GUS reporter gene.The carrier that uses as pSB21 (plant magazine such as Komari, 10, 165-174,1996).And utilize the unique HindIII site and the BamHI site at 35S promoter two ends in this carrier.

At first digest RPG106 SacI 6.0kb (pBluescript) simultaneously with the preparation promoter fragment with HindIII and BglII, this fragment is made of the about 1.8kb of upstream in the BglII site at 87bp place, RPC213 gene the one ATG downstream.This fragment is connected with the carrier pSB21 that removes 35S promoter with same enzyme digestion.With gained plasmid vector called after pYOT213 α G.In this pYOT213 α G, an ATG of RPC213 gene and the ATG of gus gene are in same reading frame.Thus, when initial, gus protein matter just is translated into fusion rotein from an ATG in the translation of RPC213 gene.

The translation of supposing the RPC213 gene makes up another carrier in order to following method and has wider promoter fragment with preparation since the 3rd ATG.For a part with this promoter region of pcr amplification, at first synthetic 1 pair of primer:

213P-5H-2；5′-GACGTGATCCACGGCATTGACG-3′

213P?2ndATG-Bam；5′-CGGGGATCCGTTCTCCTCCACCCACGC-3′

213P-5H-2 is positioned at the upstream, unique HindIII site of RPG106.213P 2ndATG-Bam has base sequence and BamHI site of next-door neighbour RPC213 gene the 3rd ATG upstream.Carry out the PCR reaction in the reaction system of 100 μ l, this system comprises above-mentioned primer (each 100pM), about 1 μ g DNA and Extaq (precious wine is made) by the preliminary alkaline denaturation of RPG106 template is obtained.

Reaction conditions is with 94 ℃ of circulations in 3 minutes, 94 ℃ 1 minute, 60 ℃ 1 minute, 72 ℃ totally 20 circulations in 2.5 minutes, 72 ℃ of 1 circulations in 6 minutes.With the product cloning of amplification afterwards, check base sequence in pCRII (Invitrogen).Digest this plasmid with HindIII and BamHI, separate the RPC213 promoter fragment of 2.0kb, be connected to then and handle with same enzyme and do not contain on the carrier pSB21 of 35S promoter.The gained plasmid inserts the RPG106 HindIII fragment of 3.3kb further with HindIII digestion and dephosphorylation, and this fragment is to form with HindIII digestion RPG106 SacI6.0kb (pBluescript).With gained plasmid vector called after pYOT213 β G.This carrier has gus gene in described promotor downstream, and it comprises about 5.3kb fragment of next-door neighbour RPC213 gene the 3rd ATG upstream.Two carriers that so make up are imported to the agrobacterium tumefaciens lba4404 strain respectively with the triparental cross mode and be used for the rice conversion test.

According to Hiei etc. (the plant magazine, 6, 271-282,1994) and method uses the callus from the immature embryo of rice varieties " moonlight " to carry out rice conversion.

B) analyze the promoter expression site by histological observation to GUS

On the transformant that imports pYOT213 α G or pYOT213 β G, gather the small ear in leaf, root and heading stage and flowering period, press Jefferson etc. (EMBO J., 6, 3901-3907,1987) method carry out GUS dyeing with X-gluc. (5-bromo-4-chloro-3-indoles-β-D-glucuronic acid) as substrate, under stereoscopic microscope and opticmicroscope, carry out the observation of histocytology.The organ of small ear inside has gynoecium, flower pesticide, lodicule, flower glume and small ear base portion, and the intensity of promoter expression GUS is divided into 4 grades (Fig. 2).

In the transformant that imports pYOT213 α G, none is dyeed the organ of being checked by GUS, yet shows gus gene expression promoter activity in the part organ of 5 transformant.Wherein, in pYOT213 α G-17 transformant, observing gynoecium and lodicule has GUS to express, and has very faint GUS to express on flower glume and the small ear base portion.This observations and Northern hybridization and RT-PCR result are basic identical.And the GUS of pYOT213 α G-4 expression detects in gynoecium specifically.The expressive site of gynoecium is the part between style and ovary.Leaf and root and flower pesticide are not all seen the expression of GUS in these 5 transformant.Promptly 2 transformant show the gynoecium expression, and 1 transformant has lodicule to express.4 transformant have utmost point weak expression at flower glume, and 3 transformant have utmost point weak expression at the small ear base portion.

On the other hand, 13 pYOT213 β G transformant have been checked.Wherein there are the leaf and the root of 5 transformant (pYOT213 β G-3,7,8,16 and 17) not to have the GUS expression or utmost point weak expression is arranged, and have GUS to express in the floral organ and demonstration floral organ-specific promoter activity.Wherein the GUS of 2 transformant (pYOT213 β G-7 and 8) be expressed in gynoecium and the lodicule relative stronger, in flower pesticide extremely a little less than, this is consistent with Northern hybridization and RT-PCR result.Also have 8 transformant except the transformant that shows the floral organ-specific expression, though observe the GUS expression at leaf and root, the promoter activity of floral organ is bigger.For example, the GUS that can observe leaf and root in pYOT213 β G-6 transformant expresses, and it is very strong to find in gynoecium that especially its GUS expresses.Observe very weak expression at flower glume, flower pesticide, lodicule and small ear base portion.In pYOT213 β G-17, the expression of leaf and root is very weak or almost do not have, and the expression in the gynoecium is more intense.In the gynoecium of transformant pYOT213 β G, the GUS expressive site mainly is a column cap, i.e. the hair shape tissue of column cap axle and column cap.

Respectively the GUS expression of results in each organ is reduced Fig. 2: none plant shows the strongly expressed of leaf and root, wherein be slightly more than 1/2 plant and be presented in the leaf medium level to the expression of weak level, 1/3 or plant still less be presented at of the expression of the medium level of root to weak level.Other plant shows utmost point weak expression or does not have expression at leaf and root.Yet, in floral organ, all organs except that flower pesticide, promptly gynoecium, lodicule, flower glume and small ear base portion all have very strong promoter activity.Especially show tangible GUS and express in the gynoecium of all 13 transformant, wherein 1 shows deep green GUS dyeing (strongly expressed).In lodicule and flower glume, about 2/3 plant has the expression of promotor to gus gene, and transformant more than half (being respectively 5 and 6) shows the GUS strongly expressed.2 plant show that the small ear base portion has strongly expressed.

From above result as can be known, 2 dna fragmentations of this that is connected with gus gene have tangible promoter activity in floral organ.Have long active 213 β and have greater activity.The promoter activity of 213 β is than the promoter activity height of 213 α, but the organ specificity of two promoter fragments is very similar, think that thus the base sequence of the RPC213 promoter expression level of regulating (can strengthen it expresses) is arranged in the SacI-HindIII fragment of 3.3kb (its be included in the 213 β base sequences in 5 of 213 α ' district and be not arranged in the base sequence of 213 α), or being arranged in BglII from 213 α 3 ' district to the sequence RPC213 gene the 3rd ATG, a kind of possibility in back is bigger.

First intron sequences of embodiment 4 RPC213 genes, be close to the analysis of genetic expression reinforced effects of the sequence of forming from the exon sequence between transcripting start point to the three ATG, by above-mentioned two sequences of this first intron

The 21bp place, downstream of the upstream transcription starting point of RPC213 gene has an ATG (1stATG).There is the intron (first intron) of a 81bp at 146bp place, the one ATG downstream, and there is the 3rd ATG (3st ATG) at 354bp place in downstream.If this intron of montage, these two ATG will be positioned at same reading frame.It is positioned at another reading frame at 112bp place, 1st ATG downstream another ATG (2nd ATG), and terminator codon (TGA) appears in 23bp place, 3rd ATG upstream in this reading frame, can not make up a longer ORF (Fig. 3,4) during the described intron of montage.Therefore think that this 2nd ATG can not be as the translation initiation codon of RPC213 gene in vegetable cell.

The result of above-mentioned promoter expression analysis shows that the zone of 1st ATG to 3rd ATG has important regulating effect to this expression of gene in 213 genes, and then has analyzed the genetic expression reinforced effects in this section zone.

A) structure of plasmid

According to above-mentioned dna sequence dna information, first intron of RPC213 gene and the exon sequence (from transcripting start point to being close to before the 3rd ATG) that comprises this intron are cloned with PCR.

The primer of synthetic amplification first intron is to as follows:

213inFW1：5′-GGGTCTAGACCTGCACGTACTAGGTATAGTAGC-3′

213inRV1：5′-CACCCCGGGCCGTCGTCCCCTGCAAGG-3′。

The primer that is used for the exon sequence that amplification comprises this intron (from transcripting start point to being close to before the 3rd ATG) is to synthetic as follows:

213ledFW1：5′-TCGTCTAGAAAGGCAGAAAAGAAAGCCAATG-3′

213ledRV1：5′-AGCGGGCCCGGGTTCTCCTCCACCCACGC-3′

These primers are integrated with XbaI respectively or the SmaI restriction site is cloned in order to aftermentioned.On the dna fragmentation that primer increased that uses the amplification intron, except the intron of 81bp, add the 15bp exon in its 5 ' side, add the 12bp exon in its 3 ' side.The dna fragmentation that comprise first intron of transcripting start point to the primer gained of the part that is close to 3rdATG comprises 374bp with increasing.PCR reaction solution 50 μ l, wherein template DNA (RPG106 SacI 6.0kb) 10ng, primer 10pM, dNTPs0.2mM, 1 * GC damping fluid (precious wine is made), Ex-taq 2.5U.Reaction conditions is 96 ℃ of circulations in 3 minutes, 96 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ totally 30 circulations, last 72 ℃ of circulations in 6 minutes in 1 fen.The PCR product cloning is arrived on pCRII (Invitrogen) carrier with the check base sequence.The base sequence of every kind of PCR product of its result is all identical with the base sequence of corresponding dna profiling.Above-mentioned 2 base sequences are represented with SEQ ID NO:2 and 1.

To be cloned into the intron of pC RII and comprise this intron and use XbaI and SmaI to digest from transcripting start point to one section sequence of next-door neighbour 3rdATG, be integrated into then and go up (be respectively pYT213I and pYT213RI, see Fig. 4) with the carrier pBI221 carrier (CLONTECH) of same enzyme digestion.

Even it is initial that translation is 1st ATG from pYT213RI, this reading frame is consistent with gus gene also.To add 90 amino-acid residues this moment at the gus protein N-terminal.In order to remove this possibility, with the synthetic similar sequence of PCR, this sequence comprises the zone of RPC213 gene transcription starting point to next-door neighbour 3rd ATG, but does not comprise 1st ATG or be positioned at the 2nd ATG of the different reading frames in its 112bp downstream.

Synthetic following primer, it comprises the contiguous sequence of RPC213 gene the one ATG, but wherein ATG has been replaced into AAG:

213ledFW-atg：5′-

CGTCTAGAAAGGCAGAAAAGAAAGCCAAAGGC?GTC-3′；

This primer is recombinated with aforesaid 213ledRV1 again, is that template is carried out PCR reaction (Fig. 3 A) with RPG106 SacI 6.0kb.The composition of PCR reaction solution and reaction conditions are all according to the carrying out of pYT213RI and pYT213I.The PCR product cloning to pCRII, after the checking base sequence, is digested with restriction enzyme XbaI and SmaI simultaneously, the gained fragment is incorporated on the carrier pBI221 (plasmid A) that digests with same enzyme.

The RPC213 gene is restricted property site StuI in the 11bp downstream of 1st ATG, has restriction site MluI in the 20bp upstream of 3rd ATG.As shown in Figure 3, restricted property site BglII between 1st ATG and the intron, and between intron and 3rd ATG restricted property site Eco52I.Digest the fragment that RPG 106 SacI 6.0kb obtain about 0.32kb simultaneously with restriction enzyme StuI and MluI, with its two ends with klenow (precious wine is made) passivation.This fragment is connected to SmaI degraded and the pBI221 that handles with CIP, makes up plasmid B, this plasmid has been integrated first intron and the adjacent exon thereof of RPC213 with correct direction between 35S promoter and gus gene.

Dna fragmentation from the RPC213 gene among plasmid A and the plasmid B respectively has only an ATG (promptly 112bp place, an ATG downstream belongs to the 2nd ATG of another reading frame).If translation initiation in this ATG, then ends in the above-mentioned short ORF probably.So with chain PCR such as this ATG of following deletion (Fig. 3 B and 3C).

At first synthetic a kind of primer, its comprise the contiguous sequence of 2nd ATG and wherein ATG substituted by AAG:

213Fwlink：5′-CTTCTCCAAGGCCTGTACGG-3′

Synthesize and its complementary primer:

213Rvlink：5′-CCGTACAGGCCTTGGAGAAG-3′

Resynthesis is positioned at the primer of above-mentioned BglI restriction site upstream:

213FW5Bg：5′-CCAATCATCACATCCATACC-3′

The primer of further synthetic Eco52I restriction site downstream part:

213RV3E52：5′-CCGCCGCAGTCCACACC-3′

Add 213RV3E52 with 213Fwlink, or 213FW5Bg adds 213RVlink and carries out PCR reaction (PCR, Fig. 3 B and 3C) for the first time respectively.Contain in the 100 μ l reaction solutions: template DNA [RPG106 SacI6.0kb (Fig. 3 B) or RPC213cDNA (Fig. 3 C)] 800ng, primer 100pM, dNTPs 0.2mM, 1 * EX-taq damping fluid (precious wine is made), EX-taq 5.0U.Reaction conditions is 98 ℃ of 1 circulations in 3 minutes, 98 ℃ 1 minute, 60 ℃ 1 minute, 72 ℃ totally 15 circulations in 1 minute, last 72 ℃ of 1 circulations in 6 minutes.With genomic clone (RPG106 SacI 6.0kb) when being template, add can the increase fragment (Fig. 3 B frg.1) of 153bp of 213RV3E52 with 213Fwlink, add can the increase fragment (frg.2 of same figure) of 67bp of 213RVlink with 213FW5Bg, as expected.When being template with RPC213cDNA, can be respectively by expection amplification 72bp fragment (Fig. 3 C frg.4) and 67bp fragment (frg.5 of same figure).Handle these PCR products to remove after the terminal VITAMIN B4 with klenow, carry out gel-purified again.Then 213FWlink is added 213RV3E52 gained PCR product and 213FW5Bg and add 213RVlink gained PCR product and pack in the same test tube, being template with these products again carries out the PCR reaction second time with the primer 2 13FW5Bg and the 213RV3E52 in the outside.Comprise in the 100 μ l reaction solutions: template DNA 100-500ng, primer 100pM, dNTP 0.2mM, 1 * EX-taq damping fluid (precious wine is made), EX-taq5.0U.Reaction conditions is 98 ℃ of 1 circulations in 3 minutes, 98 ℃ 1 minute, 60 ℃ 1 minute, 72 ℃ 10 circulations in 1 minute, last 72 ℃ of 1 circulations in 6 minutes.According to the PCR reaction second time, be expectably increased respectively 201bp fragment (Fig. 3 B frg.3) and 120bp fragment (Fig. 3 C frg.6) of template with genomic clone (RPG106 SacI 6.0kb) with cDNA clone (RPC213cDNA).Digest the chain PCR product (201bp fragment) of genome sequence simultaneously with restriction enzyme BglII and Eco52I, make up pYT213RI-A and pYT213dRI (Fig. 4) respectively by being incorporated into the plasmid A of same restrictions restriction endonuclease digestion or plasmid B.The 120bp fragment that comes from the cDNA sequence is integrated into the plasmid A and the plasmid B that have digested with same enzyme then with BglII and Eco52I digestion, has made up pYT213R-A and pYT213dR (Fig. 4) respectively.The dna sequence dna that comes from the RPC213 gene that is incorporated into pYT213dRI, pYT213dR, pYT213RI-A, pYT213R-A is represented with the SEQ ID NO:5-8 in the sequence table respectively.Comprise from transcripting start point to the whole sequence that comprises intron next-door neighbour the 3rd ATG from the sequence of RPC213 among the pYT213RI-A, and the T (thymus pyrimidine) of an ATG and the 2nd ATG is all substituted by A (VITAMIN B4).In pYT213R-A, do not contain intron sequences.In pYT213dRI, deleted 5 ' side 32bp (so no longer containing an ATG) and 3 ' side 20bp of the sequence that comes from the RPC213 gene among the pYT213RI-A.In addition, deleted intron sequences among the pYT213dR.

B) instantaneous detection

With corn yellow leaf is experiment material, separates protoplastis.The separation of material of plant and growth conditions, protoplastis is carried out according to the report (Sheen, vegetable cell 3,225-245,1991) of Sheen substantially.Isolating protoplastis is suspended in the electroporation damping fluid (0.6M N.F,USP MANNITOL, contain 4mM Mes-NaOH, the pH5.7 of 20mM KCl).The Gene Pulser of producing with Biorad company carries out electroporation under the condition of 125 μ F, 400V/cm.Used in the electroporation and be suspended in about 1 * 10 in the 0.8ml electroporation damping fluid ⁵Individual protoplastis, contain gus gene 30 μ g plasmid DNA, contain the 15 μ g pDO432 (science such as Ow of luciferase gene 234: 856-859,1986) and 75 μ g salmon sperm DNAs.After electroporation is finished, protoplastis is cultivated in 25 ℃ of lucifuges.The protoplastis that reclaims is suspended in the 50mM Tris-H of 75 μ l ₃PO ₄, among the pH7.5, add the Lysis ReagentLuc (Toyo Ink MFG., Tokyo, Japan) of equivalent after, with ultrasonic disruption to extract enzyme liquid.GUS test (fluorescent test) is carried out according to the Jefferson method.The detection of uciferase activity is carried out with PicaGene (ToyoInk MFG.).The active luciferin enzymic activity stdn of GUA (biotechnology such as Leckie by cotransformation 17: 52-3,56-7,1994).

Instantaneous detected result is in shown in the table 2.

First intron of table 2 RPC213 gene, sequence and the sequence that comprises first intron from transcripting start point to next-door neighbour the 3rd ATG from transcripting start point to next-door neighbour the 3rd ATG, their genetic expression reinforced effects

Plasmid constitutes relative GUS activity value

pBI221 35Spro-GUS-NOS 1

PYT213RI 35Spro-213 leader sequence+intron-GUS-NOS 92.9

PYT213I 35Spro-213 intron-GUS-NOS 3.9

PYT213dRI 35Spro-213 Δ 5 ′ ﹠amp; 3 ' leader sequence+intron-GUS-NOS 11.3

PYT213dR 35Spro-213 Δ 5 ′ ﹠amp; 3 ' leader sequence-GUS-NOS 0.3

PYT213RI-A 35Spro-213 leader sequence (ATG)+intron-GUS-NOS 60.4

PYT213R-A 35Spro-213 leader sequence (ATG)-GUS-NOS 10.5

Activity with pBI221 is 1, and the GUS activity is expressed as relative value.

Exceeding more than 90 times of the GUS specific activity pBI221 contrast of pYT213RI.This shows that the sequence that contains first intron from transcripting start point to next-door neighbour the 3rd ATG has very strong genetic expression reinforcing effect in the RPC213 gene.Even the GUS activity of independent intron sequences is also high 3.9 times than control group (pYT213I).

When being expressed as fusion rotein, known gus protein still keeps its activity.With regard to plasmid pYT213RI, in the protoplastis of the corn leaf that is used for instantaneous detection, translation when initial, might be added the aminoacid sequence of 90 residues from 1st ATG at the N of gus protein end.Therefore it can increase the stability of gus protein matter, thereby detects very high GUS activity.Do not accept detection from another construct (need not the construct of ATG) of the initial translation of fragment of RPC213 gene yet.The result is, the pYT213RI-A of this ATG of need not also shows than control group and exceeds GUS activity more than 60 times.This means in the RPC213 gene the sequence that contains first intron itself from transcripting start point to next-door neighbour the 3rd ATG can be on transcriptional level reinforcing gene expression.And its effect is very strong.Even the sequence that does not contain first intron from transcripting start point to next-door neighbour the 3rd ATG in the RPC213 gene also shows the GUS activity (pYT213R-A) that is higher than about 10 times of control groups.

On the other hand, in the RPC213 gene from transcripting start point to the next-door neighbour's sequence of the 3rd ATG and the identical sequence that contains first intron, from its dna sequence dna 5 ' and 3 ' side deletion dozens of base, its genetic expression reinforcing effect can reduce greatly.Be about 1/6 (than high about 11 times of control group) that the activity of pYT213dRI reaches pYT213RI-A, and pYT213dR show non-activity.These results suggest, the one-level dna structure of the sequence from transcripting start point to next-door neighbour the 3rd ATG is for regulating vegetable cell endogenous RPC213 expression of gene, and it is best especially transcribing.From above result as can be known: but sequence, first intron from transcripting start point to next-door neighbour the 3rd ATG and the dna sequence dna that comprises these two sequences about 10 times, 4 times and 60 times of reinforcing gene expression respectively the RPC213 gene.We wish that these elements are for having substantive contribution in the expression that improves alien gene aspect the genetically engineered.

Sequence table

＜110〉Japan Tobacco Inc (JTI)

＜120〉the new dna fragmentation of raising gene expression dose

<130>991306

<160>25

<210>1

<211>374

<212>DNA

＜213〉rice

Kind: IR24

Tissue: greenery

The source:

Library name: derived from the λ DASHII genomic library of greenery genomic dna

Clone's name: RPG106 Sac I-Sal I 5.4kb

<220>

＜223〉chain: two strands

Topology configuration: linearity

Molecule type: genomic dna

Feature: nt1, nt2: through the RPC 213 gene transcription starting points of primer extension mensuration

First ATG of nt21-nt23:RPC 213 genes

Second ATG of nt133-nt135:RPC 213 genes

First intron of nt167-nt247:RPC 213 genes

<400>1

aaaggcagaa?aagaaagcca?atggcgtctt?caggcctcgc?agttgcagca?acagcctcgt 60

cagcctggct?ctgctgcccc?aatcatcaca?tccataccag?cagcagcaga?tctcgcaagc 120

atcttcttct?ccatggcctg?tacgggtctg?cacctgcacg?tactaggtat?agtagctgca 180

actttattca?caatgtgatg?tcacgttatt?atatatgttt?cgtcgtcaat?ggcggcgaac 240

cttgcagggg?acgacggccg?ccggtgtgga?ctgcggcggc?ggccaccgca?gcagcgccgg 300

cggacacggc?ggcgtcggcg?cggcgggagc?aggtggagat?cgcccggtcg?ctgaacgcgt 360

gggtggagga?gaac 374

<210>2

<211>108

<212>DNA

＜213〉rice

Kind: IR24

Tissue: greenery

The source:

Library name: derived from the λ DASHII genomic library of greenery genomic dna

Clone's name: RPG106 Sac I-Sal I 5.4kb

<220>

＜223〉chain: two strands

Topology configuration: linearity

Molecule type: genomic dna

First intron of feature: nt16-nt96:RPC 213 genes

<400>2

acctgcacgt?actaggtata?gtagctgcaa?ctttattcac?aatgtgatgt?cacgttatta 60

tatatgtttc?gtcgtcaatg?gcggcgaacc?ttgcagggga?cgacggcc 108

<210>3

<211>1524

<212>DNA

＜213〉rice

Kind: IR24

Tissue: gynoecium

The source:

Library name: derived from the λ ZAPII cDNA library of gynoecium mRNA

Clone's name: RPC213

<220>

＜223〉chain: two strands

Topology configuration: linearity

The cDNA of molecule type: mRNA

Feature: nt1, nt2, nt3: through the RPC 213 gene transcription starting points of primer extension mensuration

First ATG of nt22-nt24:RPC 213 genes

Second ATG of nt134-nt136:RPC 213 genes

The 3rd ATG of nt295-nt297:RPC 213 genes

The terminator codon of nt1276-nt1278:RPC 213 genes

Nt1343-nt1348:nt1365-nt1370:poly (A) signal

nt1507-nt1524：poly(A)

<400>3

caaaggcaga?aaagaaagcc?a?atg?gcg?tct?tca?ggc?ctc?gca?gtt?gca?gca 51

Met?Ala?Ser?Ser?Gly?Leu?Ala?Val?Ala?Ala

1 5 10

aca?gcc?tcg?tca?gcc?tgg?ctc?tgc?tgc?ccc?aat?cat?cac?atc?cat?acc 99

Thr?Ala?Ser?Ser?Ala?Trp?Leu?Cys?Cys?Pro?Asn?His?His?Ile?His?Thr

15 20 25

agc?agc?agc?aga?tct?cgc?aag?cat?ctt?ctt?ctc?cat?ggc?ctg?tac?ggg 147

Ser?Ser?Ser?Arg?Ser?Arg?Lys?His?Leu?Leu?Leu?His?Gly?Leu?Tyr?Gly

30 35 40

tct?gca?cct?gca?cgt?act?agg?gga?cga?cgg?ccg?ccg?gtg?tgg?act?gcg 195

Ser?Ala?Pro?Ala?Arg?Thr?Arg?Gly?Arg?Arg?Pro?Pro?Val?Trp?Thr?Ala

45 50 55

gcg?gcg?gcc?acc?gca?gca?gcg?ccg?gcg?gac?acg?gcg?gcg?tcg?gcg?cgg 243

Ala?Ala?Ala?Thr?Ala?Ala?Ala?Pro?Ala?Asp?Thr?Ala?Ala?Ser?Ala?Arg

60 65 70

cgg?gag?cag?gtg?gag?atc?gcc?cgg?tcg?ctg?aac?gcg?tgg?gtg?gag?gag 291

Arg?Glu?Gln?Val?Glu?Ile?Ala?Arg?Ser?Leu?Asn?Ala?Trp?Val?Glu?Glu

75 80 85 90

aac?atg?ctc?ccg?ctg?ctc?acc?ccc?gtc?gac?tcc?gcg?tgg?cag?ccg?cac 339

Asn?Met?Leu?Pro?Leu?Leu?Thr?Pro?Val?Asp?Ser?Ala?Trp?Gln?Pro?His

95 100 105

gac?ttc?ctt?ccc?tgc?tcg?gcc?gcg?ggc?ggc?ggc?gag?gcg?ctg?gcg?gcg 387

Asp?Phe?Leu?Pro?Cys?Ser?Ala?Ala?Gly?Gly?Gly?Glu?Ala?Leu?Ala?Ala

110 115 120

ttc?acg?gag?ggc?gtg?gcc?gag?ctg?cgc?gcg?ggc?gcc?gcc?ggc?gtg?ccg 435

Phe?Thr?Glu?Gly?Val?Ala?Glu?Leu?Arg?Ala?Gly?Ala?Ala?Gly?Val?Pro

125 130 135

gac?gag?gtg?ctg?gtc?tgc?ctc?gtg?ggg?aac?atg?gtg?acg?gag?gag?gcg 483

Asp?Glu?Val?Leu?Val?Cys?Leu?Val?Gly?Asn?Met?Val?Thr?Glu?Glu?Ala

140 145 150

ctc?ccG?acg?tac?cag?agc?atg?ggc?aac?cgc?gcc?gag?ggc?ctc?gcc?gac 531

Leu?Pro?Thr?Tyr?Gln?Ser?Met?Gly?Asn?Arg?Ala?Glu?Gly?Leu?Ala?Asp

155 160 165 170

ggc?acc?ggc?gtg?agc?ccc?ctc?ccc?tgg?gcg?cgc?tgg?ctc?cgc?ggc?tgg 579

Gly?Thr?Gly?Val?Ser?Pro?Leu?Pro?Trp?Ala?Arg?Trp?Leu?Arg?Gly?Trp

175 180 185

acc?gcc?gag?gag?aac?cgc?cac?ggc?gac?ctc?ctc?aac?cgc?tac?ctc?tac 627

Thr?Ala?glu?Glu?Asn?Arg?His?Gly?Asp?Leu?Leu?Asn?Arg?Tyr?Leu?Tyr

190 195 200

ctc?tcc?ggc?cgc?gtc?gac?atg?cgc?cag?gtc?gag?gcc?acc?gtg?cac?cgc 675

Leu?Ser?Gly?Arg?Val?Asp?Met?Arg?Gln?Val?Glu?Ala?Thr?Val?His?Arg

205 210 215

ctc?ctc?cGc?aac?ggc?atg?gag?atg?ctg?gcg?ccg?gcg?agc?ccg?tac?cac 723

Leu?Leu?Arg?Asn?Gly?Met?Glu?Met?Leu?Ala?Pro?Ala?Ser?Pro?Tyr?His

220 225 230

ggc?ctg?atc?tac?ggc?gcg?ttc?cag?gag?cgc?gcc?acc?ttc?atc?tcc?cac 771

Gly?Leu?Ile?Tyr?Gly?Ala?Phe?gln?Glu?Arg?Ala?Thr?Phe?Ile?Ser?His

235 240 245 250

ggc?cac?acg?gcg?agg?ctc?gcg?ggg?cag?cac?ggc?gac?cgg?gcg?ctc?gcc 819

Gly?His?Thr?Ala?Arg?Leu?Ala?Gly?Gln?His?Gly?Asp?Arg?Ala?Leu?Ala

255 260 265

aag?atc?tgc?ggc?gtg?atc?gcc?gcc?gac?gag?agg?cgg?cac?gag?gcg?ggc 867

Lys?Ile?Cys?Gly?Val?Ile?Ala?Ala?Asp?Glu?Arg?Arg?His?Glu?Ala?Gly

270 275 280

tac?acg?atg?gcg?tcc?gcc?agg?ctg?ttc?gag?ctc?gac?ccg?gac?ggc?atg 915

Tyr?Thr?Met?Ala?Ser?Ala?Arg?Leu?Phe?Glu?Leu?Asp?Pro?Asp?Gly?Met

285 290 295

gcg?cgc?gcg?ctg?gcg?gac?gtc?atg?cgc?ggg?aag?gtg?acc?atg?ccg?ggg 963

Ala?Arg?Ala?Leu?Ala?Asp?Val?Met?Arg?Gly?Lys?Val?Thr?Met?Pro?Gly

300 305 310

cag?ctc?atg?tcg?gac?ggc?cgc?gac?ggc?gac?ggc?gag?cac?agc?ctg?ttc 1011

Gln?Leu?Met?Ser?Asp?Gly?Arg?Asp?Gly?Asp?Gly?Glu?His?Ser?Leu?Phe

315 320 325 330

gcc?cgg?ttc?tcc?gcc?gtg?gcg?gag?cgc?gcc?ggc?gtg?tac?acg?gcg?agg 1059

Ala?Arg?Phe?Ser?Ala?Val?Ala?Glu?Arg?Ala?Gly?Val?Tyr?Thr?Ala?Arg

335 340 345

gac?tac?ggc?gaa?ctc?gtc?gag?cac?ttc?gtg?cgg?agg?tgg?cgg?gtg?gcg 1107

Asp?Tyr?Gly?Glu?Leu?Val?Glu?His?Phe?Val?Arg?Arg?Trp?Arg?Val?Ala

350 355 360

gag?ctc?gcg?gcg?ggg?ctc?tcc?ggc?gag?ggc?cga?cgc?gcg?cag?gag?tac 1155

Glu?Leu?Ala?Ala?Gly?Leu?Ser?Gly?Glu?Gly?Arg?Arg?Ala?Gln?Glu?Tyr

365 370 375

ctg?tgc?ggg?ttg?gcg?ccc?aag?atc?cgg?agg?atg?gag?gag?ctg?gcc?cac 1203

Leu?Cys?Gly?Leu?Ala?Pro?Lys?Ile?Arg?Arg?Met?Glu?Glu?Leu?Ala?His

380 385 390

cgg?agg?gcg?gcc?cgc?atc?gag?ccc?gct?atg?gcc?cgt?ttc?agc?tgg?atc 1251

Arg?Arg?Ala?Ala?Arg?Ile?Glu?Pro?Ala?Met?Ala?Arg?Phe?Ser?Trp?Ile

395 400 405 410

ttc?gat?agg?ccc?gtc?atg?ctg?ggc?tga?tcaacccggg?gcttcggtta?tggtttt?1305

Phe?Asp?Arg?Pro?Val?Met?Leu?Gly

415

atgggcccgt?ttactgggct?ctgcttgctc?aaattataat?aagctacatc?gtgtgctaaa?1365

ataatttatc?tttgttatta?aggattcgtg?tgagaaagct?attttgtttt?ctgtagcaag?1425

tttaggaatg?taatgtaatg?taatgaagcg?gcaggacgac?tgccatttga?ttaagaaaag?1485

actcgcgctt?gtttgtagtc?caaaaaaaaa?aaaaaaaaa 1524

<210>4

<211>5396

<212>DNA

＜213〉rice

Kind: IR24

The source:

Library name: derived from the λ DASHII genomic library of greenery genomic dna

Clone's name: RPG106 Sac I-Sal I 5.4kb

<220>

＜223〉chain: two strands

Topology configuration: linearity

Molecule type: genomic dna

Feature: nt1-nt5369, nt3335-nt5108: the sequence that its promoter activity has been confirmed by GUS

Nt4964-nt4969:TATA box sample sequence

Nt4995,4996,4997: initial by RPC 213 gene transcription that primer extension is measured

The point

First ATG of nt5016-nt5018:RPC 213 genes

Second ATG of nt5128-nt5130:RPC 213 genes

The 3rd ATG of nt5370-nt5372:RPC 213 genes

Nt5162-nt5242: intron

Nt1-nt6:Sac I restriction site

Nt729-nt734, nt2811-nt2816, nt5103-nt5108:Bgl II restriction site

Nt3335-nt3340:Hind III site

<400>4

gagctcatgt?gaccgttctc?ggtgagttca?gagataacgt?ttagacttcc?cttatcagcc 60

tcgtgcgggc?acctataggg?tttgtctgag?tcaatctccg?atgtcagcca?agaaagaaca 120

gagcatacga?gtaaatctcc?cgtcttgctg?taatcaagaa?tttggattga?agtcaagaaa 180

ttttatctcg?gcaggtacac?catctcttca?ttccgtattc?cttgtcgaga?tccaccaacc 240

gttctcgagt?gatcgagaag?gtgtagaatc?tgcgacggag?ctttgtcgac?atttgtcgta 300

ctcgccttag?tcgatcttgg?tgtagaacca?tagagacatg?gagccttcgt?caatgtcgaa 360

tagaattttc?ctgaaatcaa?tactcataaa?agaatattag?atagaaataa?cccccgagcg 420

aacgctcaaa?gggtaacatg?ttatacaatg?tatggaaaac?tgaaaatgaa?ttaaatttac 480

agaccaatgt?tttgtatatg?agcgtctact?cttttaccga?cttcgatcag?tcaatttgtt 540

aagttatata?ctttccctag?cccctagcct?tgtcgttgga?gaatcgttct?cggaagataa 600

ggctcttgga?cctttgacct?gcctcggttg?aacaagcact?aatcctagcc?cccagccgtg 660

aagttggaaa?acccgatttc?cgattacacg?gcttggttaa?tacgcacggc?gagaactctt 720

acacgaccag?atcttacatg?gtcttttgtc?tctacagtat?ccgacaaggc?cttattggct 780

ctgggcgtcc?ccagccgaag?ttcccttagg?ttcctcggag?gccttgtcaa?gacggtgtaa 840

agggacagta?ggataggttt?caacgctagg?tgtcatcgtg?gtaagggatc?tctgggtaaa 900

acacttggcg?atcttgtgta?cctgatatca?actttgttgg?agtaaaggta?atgggagaat 960

cgctacacct?ctggttgagg?accaggtggt?agtcgcaact?cgaccacttg?aagtagaaat?1020

agtgggagaa?tcgctacacc?gctggtcgag?aaccaagtag?tagtctaaac?tcgaccacta?1080

gaattaaagg?tagtgggaga?atcgctacac?cgctggtcga?gaactaggta?tagtctaaac?1140

tcgaccacta?gaagtaaagg?tagtgggaga?atcgctacac?cgctggtcga?ggaccaggta?1200

gtagtcgtaa?ctcgaccact?agaagtggaa?atagtgggag?aatcgctaca?ccgctggtcg?1260

agaaccaggt?gtaatctaaa?ctcgaccact?tgaagtaaat?gtgcgagaga?tcgctacgat?1320

tgacgggtct?agaaccagtg?agtaggtgtc?tctcaaccat?cttaagtcat?ggtgcgagga?1380

ctgctgcgtt?attgctgtag?tcgtacctcg?accatctaaa?gttaaggtgc?gagagattgc?1440

tacgttttac?tagttcaaga?accagcgagc?gagtagaatt?atctctcgaa?caccaatgaa?1500

agttgcggtg?cgagagattg?ctacgtactg?gttcgaggac?catcgagcga?gtagaattat?1560

ctctcgaaca?ccaatggaag?ttgcggtgcg?agagatttct?acgtactggt?tcgagaacca?1620

gcgagcgagt?agaatcatct?ctcgaacacc?aatggaggtt?gcggtgcgaa?agattaatat?1680

gcactggttc?gaggaccagc?gaacgtgtag?agttatatct?cgaacaccaa?tggaagttgc?1740

ggtgcgagag?attgctacgt?actagttcga?ggaccatcga?gcgagtagaa?ttatttctcg?1800

aacaccaatg?gaagttgcgg?tgcgagagat?tgctacgtac?tggttcgaga?accagcgagc?1860

gagtagaatt?atctctcgaa?caccaatgga?agtttgcggt?gcgagagatt?gctacgtact?1920

ggttcaagaa?ccatggaagt?tgcggtgcga?gagatttcta?tgtactggtt?cgaggaccag?1980

ggagcgagta?gaattatctc?tcgaacacca?atggaagttt?gcggtgcgag?agattgctac?2040

gtactggttc?gagaaccagt?gaatgtgtag?agttatctct?cgaacaccaa?tggaggttgc?2100

ggtgcgagag?attgctacgt?actggttcga?gaaccagcga?acgtgtagag?ttatctctcg?2160

aacacatgga?ggttgcggtg?cgagagattg?ctacgtactg?gttcgaggac?cagtgaacgt?2220

gtagagttat?ctctcgaaca?ccaatggagg?tgctagagtt?ggtttattac?atatgcgtct?2280

catgtggcca?gcatgactca?cacacccaac?ttgtagcata?tccggatgtc?tgttcgcaag?2340

catgtcgggt?gatcaagccg?acagcgctcg?cgaggaatta?tccgttaaca?accttttctc?2400

gagtagtcta?gccatggcgg?gtgctatgag?ataggtcgtc?ggtcttcgtt?ggtgggttgg?2460

gcgtgacgac?tttgcatttg?tcgagatcgt?tctcgataat?gcggtgtact?tgaccacaac?2520

ctagtcgagt?gctcaattgt?tcctgaaaaa?tattttctag?aagacaagac?atatagcaga?2580

taatatcgag?tatgtactca?gaaaactgca?tggatcttct?agtattatca?ggatgtaacg?2640

agcagatgta?aatattaggc?attatgtaaa?ccgtaaacaa?gcatgattca?tacaaaagag?2700

aatagagcga?gccccagtgt?tagaccgttg?tcggcctaac?accggaaaca?ctcacataat?2760

aaatattgta?taaaaaacat?gctctaggta?aacataataa?attatattat?agatctgaca?2820

attctgtatg?atctgaatag?gtacgataaa?ttgcatataa?aatattgcgt?acctttgtag?2880

atacatgccg?gatgtatcta?cgaaattagt?agattcaatc?tactgaatac?ctttgccttc?2940

ttggtgagga?acagcaactc?cttaatatgc?ttttgcgtgc?atggtactgt?cccccgtgca?3000

cgtaccatgt?aatctggtca?tttaattgac?ctgtttgtct?ttagccccga?gtcagattgc?3060

tgcctagaga?ttggatagta?gtgcagacgt?ggaaactccc?cgagtccgac?tagcatttac?3120

accaataagc?agatcaatcc?gacgctttga?tttccgctcc?acgacgcgct?tgttttgttg?3180

gtggagatcg?atgccgtgtt?cggcttggac?gcggttaatc?gagccctcca?ccagttgatg?3240

tggcgcgtgt?attggtactg?atcaatctcg?aaggttgtct?gcactgttga?ttgacaacct?3300

caaaattgac?gtgatccacg?gcattgacgt?cttgaagctt?gagcgatcct?gataaatcga?3360

atttgttgac?gacgattgtt?ccgatctcgt?cgggacacgt?attctggtag?gtttagatca?3420

cccaacagcg?aagttgtcga?gtagattgtt?gtcggagaat?ccatctctta?aacccatctc?3480

gtcgaaatcc?tgaagcacca?aaatccccct?acctggcgtg?ccattatcga?cgtttgatgt?3540

ctcgactacg?gtatttgcat?gtcatggggg?atcgttggta?ctaggatata?cgcgagactg?3600

acgtaaaaga?gatggagaca?gggattttta?tacaggttcg?ggcccctgaa?ttgtcatata?3660

ataaccctac?atcctgttgg?ccgaagccgg?tattgctctt?attcatgata?atcacaccat?3720

tacaatattt?agggtagcct?atctaactat?tgtcgacatg?gcggtctgac?gatctgactc?3780

gtagtcgaca?acagggtagc?cttcctcctc?gaacctgtgc?ctgacgagat?cagagatagc?3840

gctttcgtct?ctcctgacag?tatcctgaga?caccgtaggg?gacttgtcgt?gcctatctct?3900

gaagtcgata?tccggcgtct?tgtcttggcg?tatgttggct?tgtattggct?tgtggctttg?3960

tggcgtttat?gttgctcgta?tattgtggtg?ggtgtgtatt?gtccgtgtct?tgtatggtgg?4020

gtgtcgattg?tgtcccattt?ccttctaggg?gaccttgtat?ttatacccat?aggtgtcccc?4080

ttgtccaagt?agaactaggg?aaaccaatat?ggatacaatc?cgattagtcc?tttgtcgttt?4140

ccatgtagaa?ctttggttgt?ctttctttat?ccggaactcc?tcctatatcc?gcaggttatt?4200

ttcgtatagg?acatgttatg?tggtgggtcc?taccgagatt?tagtcaacta?ctattaggta?4260

tgtggtatcc?ataaccctga?cacataccat?gatttttctg?tctatcaata?actgcctcgg?4320

tgaacttgaa?gaagtaggtt?gttattgcag?caataatgag?acaaactagt?atttatttat?4380

gatatccctt?ggttaagtag?tcatgcgtta?taataggaac?ctctaattcc?ctcgtaaata?4440

cagctaagtt?tattataaca?agagctttaa?taatattaaa?attgtagcct?tttttggatt?4500

tgtacgaaat?aattagcctt?aaaaaacatt?taatgttggt?tagctcaaaa?tatttggaaa?4560

tggagtgagt?atatgttact?gacttcaaaa?atttttcaaa?cggtattcat?gtcgttttcg?4620

tgagtggact?gaaacagcag?taattacatt?gaacatttga?acacctgtat?aaagtattaa?4680

atatatacta?aaaaataatt?aattatacat?attacgacta?atttgcaaga?cgaatctttt?4740

aagcataatt?gctccatgat?ttaacaatat?agtgctacag?taaacatgtg?ctaatgacgg?4800

attaattagg?cttaataaat?tcgtctcacg?tttactgacg?gattctataa?ttgatttttt?4860

tattaatgcc?caaacacccc?atacaacact?ctatataata?ctcaatgtga?cgtgccaaaa?4920

ctttagacac?ctggatgtaa?acaccactct?gttccttctc?ctctataaat?ggcaccgggg?4980

tggtttgtcg?gcaccaaagg?cagaaaagaa?agcca?atg?gcg?tct?tca?ggc?ctc 5033

Met?Ala?Ser?Ser?Gly?Leu

1 5

gca?gtt?gca?gca?aca?gcc?tcg?tca?gcc?tgg?ctc?tgc?tgc?ccc?aat?cat 5081

Ala?Val?Ala?Ala?Thr?Ala?Ser?Ser?Ala?Trp?Leu?Cys?Cys?Pro?Asn?His

10 15 20

cac?atc?cat?acc?agc?agc?agc?aga?tct?cgc?aag?cat?ctt?ctt?ctc?cat 5129

His?Ile?His?Thr?Ser?Ser?Ser?Arg?Ser?Arg?Lys?His?Leu?Leu?Leu?His

25 30 35

ggc?ctg?tac?ggg?tct?gca?cct?gca?cgt?act?ag[g?tatagtagct?gcaactttat5182

Gly?Leu?Tyr?Gly?Ser?Ala?Pro?Ala?Arg?Thr?Arg

40 45

tcacaatgtg?atgtcacgtt?attatatatg?tttcgtcgtc?aatggcggcg?aaccttgcag]5242

g?gga?cga?cgg?ccg?ccg?gtg?tgg?act?gcg?gcg?gcg?gcc?acc?gca?gca?gcg?5291

Gly?Arg?Arg?Pro?Pro?Val?Trp?Thr?Ala?Ala?Ala?Ala?thr?Ala?Ala?Ala

50 55 60 65

ccg?gcg?gac?acg?gcg?gcg?tcg?gcg?cgg?cgg?gag?cag?gtg?gag?atc?gcc 5339

Pro?Ala?Asp?Thr?Ala?Ala?Ser?Ala?Arg?Arg?Glu?Gln?Val?Glu?Ile?Ala

70 75 80

cgg?tcg?ctg?aac?gcg?tgg?gtg?gag?gag?aac?atg?ctc?ccg?ctg?ctc?acc 5387

Arg?Ser?Leu?Asn?Ala?Trp?Val?Glu?Glu?Asn?Met?Leu?Pro?Leu?Leu?Thr

85 90 95

ccc?gtc?gac 5396

Pro?Val?Asp

100

<210>5

<211>325

<212>DNA

＜213〉rice

Kind: IR24

The source:

Library name: derived from the λ DASHII genomic library of greenery genomic dna

Clone's name: RPG106 Sac I-Sal I 5.4kb

<220>

＜223〉chain: two strands

Topology configuration: linearity

Molecule type: the genomic dna of modification

Characteristics: the latter half of nt1-nt3:Stu I restriction site

Nt321-nt325: the first half of blunt end Mlu I restriction site

Nt100: the introducing sudden change (T → A)

First intron of nt133-nt213:RPC 213 genes

<400>5

cctcgcagtt?gcagcaacag?cctcgtcagc?ctggctctgc?tgccccaatc?atcacatcca 60

taccagcagc?agcagatctc?gcaagcatct?tcttctccaa?ggcctgtacg?ggtctgcacc 120

tgcacgtact?aggtatagta?gctgcaactt?tattcacaat?gtgatgtcac?gttattatat 180

atgtttcgtc?gtcaatggcg?gcgaaccttg?caggggacga?cggccgccgg?tgtggactgc 240

ggcggcggcc?accgcagcag?cgccggcgga?cacggcggcg?tcggcgcggc?gggagcaggt 300

ggagatcgcc?cggtcgctga?acgcg 325

<210>6

<211>244

<212>DNA

＜213〉rice

Kind: IR24

Tissue: gynoecium

The source:

Library name: derived from the λ EPAII cDNA library of gynoecium mRNA

Clone's name: RPC213

<220>

＜223〉chain: two strands

Topology configuration: linearity

Molecule type: at the modification type cDNA of mRNA

Characteristics: the latter half of nt1-nt3:StuI restriction site

Nt240-nt244: the first half of blunt end MluI restriction site

Nt100: the introducing sudden change (T → A)

<400>6

cctcgcagtt?gcagcaacag?cctcgtcagc?ctggctctgc?tgccccaatc?atcacatcca 60

taccagcagc?agcagatctc?gcaagcatct?tcttctccaa?ggcctgtacg?ggtctgcacc 120

tgcacgtact?aggggacgac?ggccgccggt?gtggactgcg?gcggcggcca?ccgcagcagc 180

gccggcggac?acggcggcgt?cggcgcggcg?ggagcaggtg?gagatcgccc?ggtcgctgaa 240

cgcg 244

<210>7

<211>374

<212>DNA

＜213〉rice

Kind: IR24

The source:

Library name: derived from the λ DASHII genomic library of greenery genomic dna

Clone's name: RPG106 Sac I-Sal I 5.4kb

<220>

＜223〉chain: two strands

Topology configuration: linearity

Molecule type: the genomic dna of modification

Characteristics: nt1, nt2: through the RPC 213 gene transcription starting points of primer extension mensuration

Nt22: the introducing sudden change (T → A)

Nt134: the introducing sudden change (T → A)

First intron of nt167-nt247:RPC 213 genes

<400>7

aaaggcagaa?aagaaagcca?aaggcgtctt?caggcctcgc?agttgcagca?acagcctcgt 60

cagcctggct?ctgctgcccc?aatcatcaca?tccataccag?cagcagcaga?tctcgcaagc 120

atcttcttct?ccaaggcctg?tacgggtctg?cacctgcacg?tactaggtat?agtagctgca 180

actttattca?caatgtgatg?tcacgttatt?atatatgttt?cgtcgtcaat?ggcggcgaac 240

cttgcagggg?acgacggccg?ccggtgtgga?ctgcggcggc?ggccaccgca?gcagcgccgg 300

cggacacggc?ggcgtcggcg?cggcgggagc?aggtggagat?cgcccggtcg?ctgaacgcgt 360

gggtggagga?gaac 374

<210>8

<211>293

<212>DNA

＜213〉rice

Kind: IR24

Tissue: gynoecium

The source:

Library name: derived from the λ EPAII cDNA library of gynoecium mRNA

Clone's name: RPC213

<220>

＜223〉chain: two strands

Topology configuration: linearity

Molecule type: at the modification type cDNA that modifies mRNA

Characteristics: nt1, nt2: through the RPC 213 gene transcription starting points of primer extension mensuration

Nt22: the introducing sudden change (T → A)

Nt134: the introducing sudden change (T → A)

<400>8

aaaggcagaa?aagaaagcca?aaggcgtctt?caggcctcgc?agttgcagca?acagcctcgt 60

cagcctggct?ctgctgcccc?aatcatcaca?tccataccag?cagcagcaga?tctcgcaagc 120

atcttcttct?ccaaggcctg?tacgggtctg?cacctgcacg?tactagggga?cgacggccgc 180

cggtgtggac?tgcggcggcg?gccaccgcag?cagcgccggc?ggacacggcg?gcgtcggcgc 240

ggcgggagca?ggtggagatc?gcccggtcgc?tgaacgcgtg?ggtggaggag?aac 293

<210>9

<211>20

<212>DNA

＜213〉artificial sequence

<400>9

cgctatggcc?cgtttcagct 20

<210>10

<211>21

<212>DNA

＜213〉artificial sequence

<400>10

gtcgtcctgt?cgcttcatta?c 21

<210>11

<211>24

<212>DNA

＜213〉artificial sequence

<400>11

gtatccatga?gactacatac?aact 24

<210>12

<211>22

<212>DNA

＜213〉artificial sequence

<400>12

tactcagcct?tggcaatcca?ca 22

<210>13

<211>19

<212>DNA

＜213〉artificial sequence

<400>13

tgctggtatg?gatgtgatg 19

<210>14

<211>18

<212>DNA

＜213〉artificial sequence

<400>14

ctgacgaggc?tgttgctg 18

<210>15

<211>22

<212>DNA

＜213〉artificial sequence

<400>15

gacgtgatcc?acggcattga?cg 22

<210>16

<211>27

<212>DNA

＜213〉artificial sequence

<400>16

cggggatccg?ttctcctcca?cccacgc 27

<210>17

<211>33

<212>DNA

＜213〉artificial sequence

<400>17

gggtctagac?ctgcacgtac?taggtatagt?agc 33

<210>18

<211>27

<212>DNA

＜213〉artificial sequence

<400>18

caccccgggc?cgtcgtcccc?tgcaagg 27

<210>19

<211>31

<212>DNA

＜213〉artificial sequence

<400>19

tcgtctagaa?aggcagaaaa?gaaagccaat?g 31

<210>20

<211>29

<212>DNA

＜213〉artificial sequence

<400>20

agcgggcccg?ggttctcctc?cacccacgc 29

<210>21

<211>36

<212>DNA

＜213〉artificial sequence

<400>21

tcgtctagaa?aggcagaaaa?gaaagccaaa?ggcgtc 36

<210>22

<211>20

<212>DNA

＜213〉artificial sequence

<400>22

cttctccaag?gcctgtacgg 20

<210>23

<211>20

<212>DNA

＜213〉artificial sequence

<400>23

ccgtacaggc?cttggagaag 20

<210>24

<211>20

<212>DNA

＜213〉artificial sequence

<400>24

ccaatcatca?catccatacc 20

<210>25

<211>17

<212>DNA

＜213〉artificial sequence

<400>25

ccgccgcagt?ccacacc 17

Claims (10)

1. dna fragmentation, it comprises any one base to the 259 of the 1st to the 152nd of SEQ ID NO:1 to the base sequence between any one base of the 374th, and gene expression amount is increased.

2. dna fragmentation, it comprises the sequence of base of 374 of the bases to the of the 1st of SEQ ID NO:1, and gene expression amount is increased.

3. dna fragmentation, it comprises the sequence of base of 359 of the bases to the of the 35th of SEQ ID NO:1, and gene expression amount is increased.

4. dna fragmentation, it comprises the sequence of base of 259 of the bases to the of the 152nd of SEQ ID NO:1, and gene expression amount is increased.

5. dna fragmentation, the base sequence that it comprises are that Accessory Right requires to remove in the base sequence of any one defined of 1-4 from this part base sequence of the base of 247 of the bases to the of the 167th of SEQ ID NO:1, and gene expression amount is increased.

6. dna fragmentation, it comprises modifies the sequence that the back produces to each base sequence among the claim 1-5, and gene expression amount is increased, and wherein said being modified to one is not that the codon of initiator codon is modified the first initiator codon ATG and/or the second initiator codon ATG.

7. dna fragmentation, it comprises the base sequence shown in the SEQ ID NO:1,2,5,7 or 8, or from they deutero-sequences, and gene expression amount is increased, wherein said disappearance, displacement, insertion or the interpolation of deriving and comprising one or more Nucleotide.

8. dna fragmentation, it under rigorous condition with the dna fragmentation hybridization that comprises sequence shown in the SEQ ID NO:1,2,5,7 or 8, and gene expression amount is increased.

9. the dna fragmentation described in the claim 8, wherein hybridization is carried out under the following conditions, 6 * SSC, 5 * Denhart ' s solution, 0.1%SDS and 50% methane amide, temperature range is a room temperature to 42 ℃.

10. method that increases exogenous gene expression, it comprises introduces a kind of DNA construct with each dna fragmentation among the claim 1-9, make described will be in host cell expressed exogenous gene be positioned at the downstream of a promotor, and with described DNA construct transformed host cell, thereby make the expression amount of described foreign gene in this host cell than expression amount height with the identical construct institute transformed host cells of the dna fragmentation that does not comprise among the claim 1-9 each.

Images