CN1470645A - Primer sequence for cauliflower mosaic virus 35s promoter-containing transgenic crop nucleic acid amplification - Google Patents

Abstract

The present invention provides the primar sequences for nucleic acid amplification of the transgenic crop containing caulimovirus 35s promotor, they are contained in the extended regional range of four pairs of optimal primer sequences, and the extended regional range of every pair of primer sequence is: the primer pair is formed from upstream primer and downstream primer, in the upstream primer position of said primer pair 10 bases are forward extended and 10 bases are backward extended, and in the downstream primer position 10 bases are forward extended and 10 bases are backward extended, in the regional range of upstream and downstream extended positions of said primer pair the primer sequence can be obtained.

Description

Contain cauliflower mosaic virus 35s promotor transgenic crop nucleic acid amplification primer sequence

Technical field

The present invention relates to a kind of cauliflower mosaic virus 35s promotor transgenic crop nucleic acid amplification primer sequence that contains

Background technology

Over nearest 3 or four years, the detection of transgenic product becomes a domestic and international milestone, causes the extensive concern and the attention of various circles of society.Though United Nations's subsidiary organ (FAO, WHO etc.) and some provincialism international organizations set up unified detection technique in the world and method standard convening, but because inconsistent for the aspects such as security, risk management measure and other interests of transgenic product, the still difficult suggestion of reaching an agreement in various countries at present.The detection technique of comprehensive countries in the world transgenic product, mainly be divided into following three types according to detecting target: detect the foreign gene that inserts, detect exogenous gene expression thing (RNA or protein), detect insert foreign gene to the influence of receptor biological genetic expression (mainly detect foreign gene to insert near the effect gene site and to the influence of whole meta-bolites).Because detection cost height, the required time of the 3rd type are long, and it is lower to be considered to importance, present detection shorter mention in real work to this respect.Related detection target comprises three types in preceding two types testing: DNA, RNA and protein.Mainly use serological method for proteinic detection, because some transgenic product not marking protein or expression amount instability, the serology detection method is only used in indivedual transgenic product detect.Gene diagnosis technology such as PCR and direct nucleic acid hybridization are mainly adopted in detection for DNA and RNA.Up to the present the gene amplification diagnostic method has experienced the development of the following aspects: PCR/ electrophoresis detection, conventional hybridization or order-checking; PCR-ELISA; Real-time fluorescence PCR.

Both at home and abroad all detection methods do not solve the detection problem of transgenic product fully, and new detection method is in continuous appearance, and continue perfect among.At first, a few cover screening primers commonly used both at home and abroad at present can not detect commercial at present transformed variety fully; The generation that the difficult control of traditional round pcr is polluted; In addition, the detection reagent that quality does not pass a test often influences the judgement of detected result and the detection work of coming to testify.

Up to the present, the most rising detection technique is the real-time fluorescence PCR technology.The real-time fluorescence PCR technology has lot of advantages: used hybridization probe, improved the accuracy that detects; The highly sensitive of fluoroscopic examination; Need not reduce the pollution in the testing process preferably to PGR product post-processed; The amplification edges frontier inspection is surveyed, and has improved detection speed; Can use international standard substance that test sample is carried out quantitatively.The core link of this technology is that at first will obtain can be efficient, special and the primer of the purpose segment DNA that increases delicately.

Use consultative centre (ISAAA) statistics according to international Agricultural biotechnologies, calendar year 2001, whole world genetically modified crops cultivated area was 5,260 ten thousand hectares, more than ten country planted genetically modified crops, wherein 99% genetically modified crops are planted in the U.S., Argentina, Canada and Chinese, and approved commercialization genetically modified crops have soybean, corn, rape, cotton, tomato, potato, pimento, summer squash, pawpaw, beet, Dianthus caryophyllus L., petunia, flax, tobacco, watermelon, witloof etc.According to estimates, the food whole world with these genetically modified crops process for processing has nearly ten thousand kinds.

Security to transgenic product, particularly genetically modified food is to the health of humans and animals and to the influence of ecotope, since transgenic technology occurs, it just is the focal issue that international organizations such as countries in the world and United Nations are concerned about always, United Nations had passed through " Biosafety Protocol " in 2000, this protocol is passed in and out to except medicine all, and active genetically modified organisms are relevant to pass by, examine, detect, risk assessment and management, liability for damage etc. have been made detailed regulation, wherein one of most important measure will be tested to transgenic product exactly, with clear and definite its kind, determine whether to be transgenic product approved or that secured permission, to prevent that some transgenic product with risk from spreading arbitrarily, causes irremediable loss.Calendar year 2001, European Union required genetically modified food is carried out identity management, and proposed so long as not intentional pollution, contained in the food to be no more than 1% transgenic product (threshold value) and then need not to identify, and the transgenic product detection not only needs qualitatively like this, also needs detection by quantitative.The country variant threshold size is different, does not wait from 1-5%.China announces and implements " agriculture genetically modified organism security control regulations " May 9 calendar year 2001, and has announced agriculture genetically modified organism safety evaluation, sign and three supporting management ways of import security management on January 5th, 2002.The relevant laws and regulations of various transgenic product have been put into effect in 36 countries and regions, the whole world at present.In a word, the research of transgenic product, producing and selling all will be carried out in particular environment and place under the permission and supervision of relevant government department.

In fact, successively find to occur in transgenic product research, production and the import and export process safety and supervision accident recent years, have various transgenic product diffusions, pollution and potential safety hazard, the detection supervision that strengthens transgenic product is very important.

European Union carried out new transgenic product laws and regulations on the management in 2002, required transgenic product is carried out omnidistance " tracking " from producing, transport, preserve, selling, detected, and did not pollute the non-transgenic product with the assurance transgenic product.The U.S. has proposed kind " individual character preservation " scheme, different is that requirement detects from producing, transport, preserve, sell " tracking " of carrying out whole process the non-transgenic product, to guarantee that the non-transgenic product is not polluted (in fact not contaminated fully is impossible, but will be controlled within certain tolerance band) by transgenic product.Many countries require the exporter to provide qualified after testing non-transgenic product to prove to import non-transgenic food.

In sum, genetically modified food all needs the check monitoring from links such as research, production, storage, transportation, sale, import and export, not only requires to detect whether contain transgenosis, and will detect the content of transgenic product.

To the detection of transgenic product, mainly want to solve the problem of following several aspects: whether be transgenic product; If contain transgenic product, be the commercial transgenic product of certain state's approved again, whether the content that then will detect transgenic product reaches permissible value; If still unratified transgenic product does not allow import or sale in principle.All these be unable to do without infallible GMO detection method.

A good GMO detection method at first will have GMO specific aim more widely.Though the acquired character of genetically modified crops is varied,, all need to insert certain exogenous regulating and controlling sequence, for example promotor, terminator or the like in order to make the gene successful expression that changes over to.The 35s promotor of cauliflower mosaic virus (CaMV) (or its artificial reconstruction sequence) is exactly a kind of modal insertion sequence, and about 70% genetically modified crops all contain this sequence.Therefore, the 35s promotor becomes the significant dna sequence dna of ideal that GMO detects.

Summary of the invention

Purpose of the present invention is exactly will provide at good, the highly sensitive amplimer of the specificity of 35s promoter sequence, is used for the detection of the PCR of genetically modified crops.

For achieving the above object, the present invention by the following technical solutions:

Contain cauliflower mosaic virus 35s promotor transgenic crop nucleic acid amplification primer sequence, described primer sequence comprises: by upstream primer 35s7248, its sequence is CGACAGTGGTCCCAAAGAT and downstream primer 35s2R, its sequence is that the primer of AAGACGTGGTTGGAACGTCTTC composition is right, before the right upstream primer position of this primer, prolong 10 bases and obtain 35s7238, after prolong 10 bases and obtain 35s7258, obtain 35s7290 and prolong 10 bases before the right downstream primer position of primer, after prolong 10 bases and obtain 35s7310, in the regional extent of the right upstream and downstream extended position of above-mentioned primer, the primer sequence that obtains.

Contain cauliflower mosaic virus 35s promotor transgenic crop nucleic acid amplification primer sequence, described primer sequence comprises: by its sequence of upstream primer 35s7201 is that TGCCATCATTGCGATAAAG and its sequence of downstream primer 35s7345R are that the primer formed of CCCTTACGTCAGTGGAGAT is right, before the right upstream primer position of this primer, prolong 10 bases, after prolong 10 bases, and prolong 10 bases before the right downstream primer position of primer, after prolong 10 bases, in the regional extent of the right upstream and downstream extended position of above-mentioned primer, the primer sequence that obtains.

Contain cauliflower mosaic virus 35s promotor transgenic crop nucleic acid amplification primer sequence, described primer sequence comprises: by its sequence of upstream primer 35s7190 is that GCTCCTACAAATGCCATCA downstream primer 35s7165 sequence is that the primer formed of GATAGTGGGATTGTGCGTCA is right, before the right upstream primer position of this primer, prolong 10 bases, after prolong 10 bases, and prolong 10 bases before the right downstream primer position of primer, after prolong 10 bases, in the regional extent of the right upstream and downstream extended position of above-mentioned primer, the primer sequence that obtains.

Contain cauliflower mosaic virus 35s promotor transgenic crop nucleic acid amplification primer sequence, described primer sequence comprises: by its sequence of upstream primer 35s7240 is that GCCTCTGCCGACAGTGGT and its sequence of downstream primer 35s7306R are that the primer formed of TTGAAGACGTGGTTGGAAC is right, before the right upstream primer position of this primer, prolong 10 bases, after prolong 10 bases, and prolong 10 bases before the right downstream primer position of primer, after prolong 10 bases, in the regional extent of the right upstream and downstream extended position of above-mentioned primer, the primer sequence that obtains.

Optimum primer sequence is as follows:

35s7240

GCCTCTGCCGACAGTGGT

35s7306r

TTGAAGACGTGGTTGGAAC

35s7201

TGCCATCATTGCGATAAAG

35s7345R

CCCTTACGTCAGTGGAGAT

35s7190

GCTCCTACAAATGCCATCA

35s7365r

GATAGTGCGATTGTGCGTCA

35s7248

CGACAGTGGTCCCAAAGAT

35s2r

AAGACGTGGTTGGAACGTCTTC

(genom sequence is seen appendix one)

Embodiment:

Fig. 1: utilize fluorescent PCR screening primer change in fluorescence collection of illustrative plates

Fig. 2: do fluorescent PCR with the 35s7240/35s2R primer and detect

Fig. 3: 35s promoter primer (35s7248/35s2R) amplification Fluka genetically engineered soybean standard substance electrophorogram design of primers:

The multiple 35s promoter sequence of selecting for use among the genetically modified crops GMO (comprise the native sequences of CaMV promotor and manually reconstruct sequence) is compared, and selection wherein lacks secondary structure and conservative gene regions designs many to primer.Primer length is generally about 20 bases, and GC content is 50%-60%, no secondary structure and repeatability in the primer, and with the interior no complementary sequence of primer, the melting temperature (Tm) between primer (Tm value) differs less than 5 ℃ between primer.As follows according to the primer that mentioned above principle is designed:

Upstream: 35s7185; 35s7190; 35s7201; 35s7240; 35s7248;

Downstream: 35s7250r; 35s7260r; 35s7282r; 35s2r; 35s7300r; 35s7305r; 35s7306r; 35s7345r; 35s7365r; Shown in the 35s7370r.

Table 1.PCR reaction system

Component	Final concentration
		10 * PCR reaction solution	????1×
DNTP (containing dUTP)	????0.2mmol/L
		The Taq enzyme	????2Unit
Mg2+ concentration	????2.5mmol/L
		Primer (upstream) I	????0.2umol/L
Primer (downstream)	????0.2umol/L
		Probe	????0.1umol/L
Template DNA	????2ul
		Mend DEPC water extremely	????20ul

The selection of PCR condition: according to our company's experience in the past, the selection of PCR condition is as follows:

93℃：3min；

40 circulations (fluorescence is collected at 60 ℃ of ends).

Under same template amount, same reaction conditions, the Ct value and the Rn value that are obtained with the specific fluorescence probe signals of 35s promoter sequence are index (the two can reflect pulsating amount of amplification and matter), the amplification situation of more different primers to making up; Simultaneously more same PCR product is carried out agarose electrophoresis.Select the single person of amplified band and Ct value and the high person of Rn value, right as the primer that DNA/PCR to be selected detects.See Figure 1

Among Fig. 1,26 is that the 35s7240/7370 primer is right, and Ct is 28.43,27 is that the 35s7201/7345 primer is right, and Ct is 24.96,28 to be that the 35s7240/7306 primer is right, Ct is 23.98,29 to be that the 35s7190/7282 primer is right, and Ct is 32.67,30 is that the 35s7201/7305 primer is right, Ct is 28.80,31 to be that the 35s7190/7365 primer is right, and Ct is 26.34,32 is that the 35s7248/2R primer is right, and Ct is 23.85.

Have the amplification line Ct value of four pairs of primers smaller among Fig. 1 as can be seen, its fluorescence intensity Rn also has certain altitude, and tentatively selected its primer as stand-by DNA/PCR detection is right.The primer of these four amplification lines specifically sees Table 2 to being 35s7248/35s2R, 35s7240/35s7306,35s7201/35s7345 and 35s7190/35s7365 respectively:

The primer amplification efficiency ratio of four pairs of amplifications of table 2 35s promotor

	??35s7248/35s2R	???357240/35s7306	???35s7201/35s7345	???35s7190/35s7365
					??Ct	??23.85	???23.98	????24.96	???26.34

By Fig. 1, table 2 as seen, 35s7248/35s2R, 35s7240/35s7306,35s7201/35s7345 and four pairs of primers of 35s7190/35s7365 all have amplification preferably, and are wherein best with 35s7248/35s2R especially.

The best primer that filters out the 35s promotor that can increase at first is to being: upstream 35s7248 and downstream 35s2R; Its Ct value is 23.85.For whether near other primer location investigating this zone has same expanding effect, satisfy again on the basis of this primer position (35s7248), with prolong before the upstream primer 10 bases obtain 35s7238, after prolong 10 bases and obtain 35s7258; In like manner change downstream primer position (35s2R) and obtain 35s7290,35s7310.Through doing the fluorescent PCR screening with aforementioned similarity condition, primer is 25.12 to the Ct value of 35s7238/35s7290; Primer is 25.43 to the Ct value of 35s7258/35s7310.These results suggest are respectively extended in the regional extent of 10 bases in the right upstream and downstream of the best primer of primary dcreening operation, still can choose the amplimer of good 35s promotor.Two upstream primers of forward and backward extension:

35s7238：ATGCCTCTGCCGACAGTG

Two downstream primers after the forward and backward extension of 35s7258:CCCAAAGATGGACCCCCAC:

35s7290：AACGTCTTCTTTTTCCACG

35s7290:TTGCTTTGAAGACGTGGTTG uses the best upstream and downstream primer of selecting to carrying out the optimization of PCR reaction system

A. the optimization of primer concentration

In the experiment primer concentration is increased progressively with 0.1umol/L from 0.1umol/L to 0.8umol/L.Proportioning to the primer different concns compares.Best primer final concentration result is as follows:

Sequence to be checked	The primer title	Best final concentration (μ M)
			The 35s promotor	Upstream primer 35s7248	????0.2
Downstream primer 35s2r	????0.2

B. the optimization of magnesium ion concentration

In the experiment magnesium ion concentration is increased progressively with 0.5mmol/L from 1.0mmol/L to 2.5mmol/L.

Selected 2.5mmol/L MgCl2 is a test kit reaction system magnesium ion concentration from repeated experiments repeatedly.

The optimization of c.Taq archaeal dna polymerase (Taq enzyme) consumption

The optimization experiment result of Taq enzyme dosage (in the U of unit), selected 2U Taq enzyme is as using Taq enzyme amount in the test kit.

The optimization of d.dNTPs concentration

Selected 0.2mmol/L is as the final concentration of test kit dNTPs in the optimization experiment of dNTPs concentration.

E. comprehensive above reaction system optimization experimental result, the PCR reaction system after the optimization sees Table 3.

PCR reaction system after table 3 is optimized

Component	Final concentration
			10 * PCR reaction buffer (pH=8.9)	????1×
Mg2+ concentration	????2.5mmol/L
		DNTPs (containing dUTP)	????0.2mmol/L

The Taq enzyme	????2U
		Primer (upstream)	????0.2umol/L
Primer (downstream)	????0.2umol/L
		Probe	????0.1umol/L
Template	????2ul
		Moisturizing extremely	????20ul

4. Fa Ming effect: through repeated screening, it is right to obtain 35s7248/35s2R, 357240/35s7306,35s7201/35s7345 and four pairs of best primers of 35s7190/35s7365.Its purposes comprises and is used for that conventional PCR (agarose electrophoresis), PCR/ELISA detect or fluorescent PCR detects.Use it for when doing the fluorescent PCR detection, the DNA that extracts with Fluka soybean standard substance 0.1% genetically engineered soybean that meets international standard does template, and the Ct value that obtains is between 31.0-32.0, and this is the reliable detection lower limit of present different fluorometric assay instruments; And 0.1% detection sensitivity has reached the examination criteria of present international like product.

Embodiment 1

Qualitative detection: choose transgenosis and not genetically modified agricultural-food such as soybean, corn, rape, tomato, potato, extract genomic dna with the Promega paramagnetic particle method, be specially: the 100mg vegetable material of weighing places the 2ml centrifuge tube; Add 500ul Lysis Buffer A and 5ul RNase A, with the material mixing; Add 250ulLysis Buffer B, mixing, room temperature was placed 10 minutes; Add 750ul precipitation buffering liquid, high speed centrifugation behind the mixing (13000 * g) 10 minutes; Draw supernatant in clean 2ml centrifuge tube, add the 50ul magnetic powder fluid, mixing; Add 0.8 volume Virahol in the mixed solution, mixing, room temperature was placed 5 minutes; Centrifuge tube is placed magnet stand last 1 minute, remove clear liquor; Take out centrifuge tube, add 250ul Lysis Buffer B again, mixing is placed on magnet stand last 1 minute, removes clear liquor; Clean magnetic with 1ml 70% ethanol, place magnet stand last 1 minute, remove clear liquor; Step repeats 2 times; Take out centrifuge tube, in 65 ℃ of dried baths under dry 5 minutes or the room temperature dry 15-30 minute; Add the 100ul deionized water in the centrifuge tube, in 65 ℃ of dried baths, hatched 5 minutes behind the mixing, move to magnet stand last 1 minute again, draw clear liquor in the clean centrifuge tube of 0.5ml, standby as dna profiling.

Among Fig. 2,11 is genetically engineered soybean, and 12 is transgene rape, and 15 is the transgenosis tomato, and 16 is the transgenosis potato.

Do fluorescent PCR with the 35s7240/35s2R primer and detect, be specially: in the 20ul reaction system, add plant genome DNA 2ul, carry out fluorescent PCR and detect, concrete reaction conditions is the same.After testing, the amplification that all is positive of above-mentioned genetically modified crops, its Ct value is respectively: genetically engineered soybean 22.36; Transgene rape 18.71; Transgenic Fructus Lycopersici esculenti 28.55; Transgenosis potato 23.81, its detection sensitivity all can reach 0.1%; And not genetically modified agricultural-food such as conventional corn, white maize etc. all do not have amplified signal, point out this primer to having good sensitivity and specificity.Embodiment 2

Detection by quantitative: get the Fluka soybean standard substance that meet international standard, genome DNA extracting method is the same, does the fluorescent PCR detection by quantitative with the 35s7240/35s2R primer, and the fluorescent PCR instrument adopts RocheLight-Cycler.Its result such as table 4

Table 4: do fluorescent PCR quantitative measurement standard product and sample ct value with the 35s7240/35s2R primer

Sample	0.0％	0.1％	0.5％	1.0％	2.0％	5.0％	Sample	1	Sample 2
										The Ct value	40.0	31.7	29.6	28.5	27.8	26.9	28.8	27.7
GMO content							0.94％	2.26％
									Deviation							-6％	+13％

The regression curve that obtains from above-mentioned data is y=-0.346x+7.9383; Dependency r2=0.99; Regard sample with 1.0% and 2.0% standard substance again, the GMO content that records is respectively 0.94% and 2.26%, quantitatively deviation is 5%-15% (the quantitative deviation of the similar detection of GENESCAN company of European Union is≤20%), and the detection efficiency of prompting the primer has reached the world level of this project in the nucleic acid amplification detection range.

Embodiment 3

Electrophoresis detection: get the Fluka genetically engineered soybean standard substance that meet international standard, genome DNA extracting method is the same, carries out pcr amplification with 35s7240/35s2R primer primer, and the pcr amplification condition is as follows:

93 ℃: 1 circulation of 3min

93 ℃: 15 sec; 60 ℃: 30 sec; 40 circulations of 72 ℃ of 1min

Get above-mentioned amplified production, adopt 1% agarose, 2V/CM electrophoresis one hour, EB working fluid soak 15min, and observations is as seen under the ultraviolet lamp: all visible amplified band clearly of positive sample, and negative sample does not have any amplified band, specifically sees Fig. 3.

Among Fig. 3

1) 0.1% genetically engineered soybean standard substance 0.0% genetically engineered soybean standard substance 2)

3) 2.0% genetically engineered soybean standard substance 0.5% genetically engineered soybean standard substance 4)

M)2000ladder

Advantage of the present invention:primer provided by the invention detects doing fluorescent PCR, and its detection sensitivity can reach 0.1%, and not genetically modified agricultural product soybean, corn etc. illustrate that all without amplified signal these primers have good sensitivity and specificity. When this primer quantitatively detected being PCR, its quantitative error was 5-15%, and its detection efficiency can reach the world level of this project in the field of nucleic acid amplification. appendix one: 35S gene complete sequence 35S PROMOTER:880bp CCCCAGATTAGCCTTTTCAATTTCAGAAAGAATGCTAACCCACAGATGGTTAGAGA GGCTTACGCAGCA GGTCTCATCAAGACGATCTACCCGAGCAATAATCTCCAGGAAATCAAATACCTTCC CAAGAAGGTTAAA GATGCAGTCAAAAGATTCAGGACTAACTGCATCAAGAACACAGAGAAAGATATATT TCTCAAGATCAGA AGTACTATTCCAGTATGGACGATTCAAGGCTTGCTTCACAAACCAAGGCAAGTAAT AGAGATTGGAGTC TCTAAAAAGGTAGTTCCCACTGAATCAAAGGCCATGGAGTCAAAGATTCAAATAGA GGACCTAACAGAA CTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAA GAAGAAAATCTTC GTCAACATGGTGGAGCACGACACACTTGTCTACTCCAAAAATATCAAAGATACAGT CTCAGAAGACCAA AGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCA TTGCCCAGCTATC TGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGA

                                          35s7190         35s7201 AAGGCCATCGTTGAAG

GGACCCCCACCCACGAGGAGCATC

                        35s7240        35s7248 GTGGAAAAA AGCAAGTGGATTGATGTGAT ATCTCCACTGACGTA

      35s2r        35s7306r                                          35s7345R AGGGA TGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTG

    35s7365r GAGAGAACACGGGGGACTCTAGAGGATCCATAGATCTGATAACAAAGATGAG

＜110〉＜120〉35s＜130〉＜160〉8＜170〉PatentIn version 3.1＜210〉1＜211〉18＜212〉DNA＜213〉＜400〉1gcctctgccg acagtggt 18＜210〉2＜211〉19＜212〉DNA＜213〉＜400〉2ttgaagacgt ggttggaac 19＜210〉3＜211〉19＜212〉DNA＜213〉＜400〉3tgccatcatt gcgataaag 19＜210〉4＜211〉19＜212〉DNA＜213〉＜400〉4cccttacgtc agtggagat 19＜210〉5＜211〉19＜212〉DNA＜213〉＜400〉5gctcctacaa atgccatca 19＜210〉6＜211〉20＜212〉DNA＜213〉＜400〉6gatagtggga ttgtgcgtca 20＜210〉7＜211〉19＜212〉DNA＜213〉＜400〉7cgacagtggt cccaaagat 19＜210〉8＜211〉22＜212〉DNA＜213〉＜400〉8aagacgtggt tggaacgtct tc 22

Claims (8)

1. one kind contains cauliflower mosaic virus 35s promotor transgenic crop nucleic acid amplification primer sequence, it is characterized in that: described primer sequence comprises: by upstream primer 35s7248, its sequence is CGACAGTGGTCCCAAAGAT and downstream primer 35s2R, its sequence is that the primer of AAGACGTGGTTGGAACGTCTTC composition is right, before the right upstream primer position of this primer, prolong 10 bases and obtain 35s7238, after prolong 10 bases and obtain 35s7258, obtain 35s7290 and prolong 10 bases before the right downstream primer position of primer, after prolong 10 bases and obtain 35s7310, in the regional extent of the right upstream and downstream extended position of above-mentioned primer, the primer sequence that obtains.

2. the cauliflower mosaic virus 35s promotor transgenic crop nucleic acid amplification primer sequence that contains according to claim 1, it is characterized in that described primer sequence: the upstream primer sequence is CGACAGTGGTCCCAAAGGAT, and the downstream primer sequence is AAGACGTGGTTGGAACGTCTTC.

3. one kind contains cauliflower mosaic virus 35s promotor transgenic crop nucleic acid amplification primer sequence, it is characterized in that described primer sequence comprises: by its sequence of upstream primer 35s7201 is that TGCCATCATTGCGATAAAG and its sequence of downstream primer 35s7345R are that the primer formed of CCCTTACGTCAGTGGAGAT is right, before the right upstream primer position of this primer, prolong 10 bases, after prolong 10 bases, and prolong 10 bases before the right downstream primer position of primer, after prolong 10 bases, in the regional extent of the right upstream and downstream extended position of above-mentioned primer, the primer sequence that obtains.

4. the cauliflower mosaic virus 35s promotor transgenic crop nucleic acid amplification primer sequence that contains according to claim 3, it is characterized in that described primer sequence: the upstream primer sequence is TGCCATCATTGCGATAAAG, and the downstream primer sequence is CCCTTACGTCAGTGGAGA.

5. one kind contains cauliflower mosaic virus 35s promotor transgenic crop nucleic acid amplification primer sequence, it is characterized in that described primer sequence comprises: by its sequence of upstream primer 35s7190 is that GCTCCTACAAATGCCATCA downstream primer 35s7165 sequence is that the primer formed of GATAGTGGGATTGTGCGTCA is right, before the right upstream primer position of this primer, prolong 10 bases, after prolong 10 bases, and prolong 10 bases before the right downstream primer position of primer, after prolong 10 bases, in the regional extent of the right upstream and downstream extended position of above-mentioned primer, the primer sequence that obtains.

6. one kind contains cauliflower mosaic virus 35S promoter transgenic crop nucleic acid amplification primer sequence, it is characterized in that described primer sequence: upstream primer sequence: GCTCCTACAAATGCCATCA, the downstream primer sequence is GATAGTGGGATTGTGCGTCA3.

7 one kinds contain cauliflower mosaic virus 35s promotor transgenic crop nucleic acid amplification primer sequence, it is characterized in that described primer sequence comprises: by its sequence of upstream primer 35s7240 is that GCCTCTGCCGACAGTGGT and its sequence of downstream primer 35s7306R are that the primer formed of TTGAAGACGTGGTTGGAAC is right, before the right upstream primer position of this primer, prolong 10 bases, after prolong 10 bases, and prolong 10 bases before the right downstream primer position of primer, after prolong 10 bases, in the regional extent of the right upstream and downstream extended position of above-mentioned primer, the primer sequence that obtains.

8. one kind contains cauliflower mosaic virus 35S promoter transgenic crop nucleic acid amplification primer sequence, and it is characterized in that described primer sequence: the upstream primer sequence is GCCTCTGCCGACAGTGGT AT, and the downstream primer sequence is TTGAAGACGTGGTTGGAAC.

Images