CN1470643A - Primer sequence for pat gene containing transgenic crop nucleic acid amplification - Google Patents

Abstract

The present invention provides the primer sequences for nucleic acid amplification of Pat gene contained transgenic crop. These sequences are distributed in the extended regional range of two pairs of optimal primerw, in which a pair of optimal primers is the primer pair formed from upstream pimer PaTlu and downstream primer PaT173r, in the upstream primer position of said primer pair 10 bases is backward extended, and in the downstream primer position of said primer pair 10 bases is forward extended and 10 bases is backward extended, in the regional range of upstream extended position of said primer pair the primer sequence can be obtained another primer pair is formed from Patn33u and Patn 150, and in their extended regional range the primer sequence also is obtained.

Description

Contain Pat gene transgenic crop nucleic acid amplification primer sequence

Technical field

The present invention relates to a kind of Pat of containing gene transgenic crop nucleic acid amplification primer sequence

Background technology

Over nearest 3 or four years, the detection of transgenic product becomes a domestic and international milestone, causes the extensive concern and the attention of various circles of society.Though United Nations's subsidiary organ (FAO, WHO etc.) and some provincialism international organizations set up unified detection technique in the world and method standard convening, but because inconsistent for the aspects such as security, risk management measure and other interests of transgenic product, the still difficult suggestion of reaching an agreement in various countries at present.The detection technique of comprehensive countries in the world transgenic product, mainly be divided into following three types according to detecting target: detect the foreign gene that inserts, detect exogenous gene expression thing (RNA or protein), detect insert foreign gene to the influence of receptor biological genetic expression (mainly detect foreign gene to insert near the effect gene site and to the influence of whole meta-bolites).Because detection cost height, the required time of the 3rd type are long, and it is lower to be considered to importance, present detection shorter mention in real work to this respect.Related detection target comprises three types in preceding two types testing: DNA, RNA and protein.Mainly use serological method for proteinic detection, because some transgenic product not marking protein or expression amount instability, the serology detection method is only used in indivedual transgenic product detect.Gene diagnosis technology such as PCR and direct nucleic acid hybridization are mainly adopted in detection for DNA and RNA.Up to the present the gene amplification diagnostic method has experienced the development of the following aspects: PCR/ electrophoresis detection, conventional hybridization or order-checking; PCR-ELISA; Real-time fluorescence PCR.

Both at home and abroad all detection methods do not solve the detection problem of transgenic product fully, and new detection method is in continuous appearance, and continue perfect among.At first, a few cover screening primers commonly used both at home and abroad at present can not detect commercial at present transformed variety fully; The generation that the difficult control of traditional round pcr is polluted; In addition, the detection reagent that quality does not pass a test often influences the judgement of detected result and the detection work of coming to testify.

Up to the present, the most rising detection technique is the real-time fluorescence PCR technology.The real-time fluorescence PCR technology has lot of advantages: used hybridization probe, improved the accuracy that detects; The highly sensitive of fluoroscopic examination; Need not reduce the pollution in the testing process preferably to PCR product post-processed; The amplification edges frontier inspection is surveyed, and has improved detection speed; Can use international standard substance that test sample is carried out quantitatively.The core link of this technology is that at first will obtain can be efficient, special and the primer of the purpose segment DNA that increases delicately.

Use consultative centre (ISAAA) statistics according to international Agricultural biotechnologies, calendar year 2001, whole world genetically modified crops cultivated area was 5,260 ten thousand hectares, more than ten country planted genetically modified crops, wherein 99% genetically modified crops are planted in the U.S., Argentina, Canada and Chinese, and approved commercialization genetically modified crops have soybean, corn, rape, cotton, tomato, potato, pimento, summer squash, pawpaw, beet, Dianthus caryophyllus L., petunia, flax, tobacco, watermelon, witloof etc.According to estimates, the food whole world with these genetically modified crops process for processing has nearly ten thousand kinds.

Security to transgenic product, particularly genetically modified food is to the health of humans and animals and to the influence of ecotope, since transgenic technology occurs, it just is the focal issue that international organizations such as countries in the world and United Nations are concerned about always, United Nations had passed through " Biosafety Protocol " in 2000, this protocol is passed in and out to except medicine all, and active genetically modified organisms are relevant to pass by, examine, detect, risk assessment and management, liability for damage etc. have been made detailed regulation, wherein one of most important measure will be tested to transgenic product exactly, with clear and definite its kind, determine whether to be transgenic product approved or that secured permission, to prevent that some transgenic product with risk from spreading arbitrarily, causes irremediable loss.Calendar year 2001, European Union required genetically modified food is carried out identity management, and proposed so long as not intentional pollution, contained in the food to be no more than 1% transgenic product (threshold value) and then need not to identify, and the transgenic product detection not only needs qualitatively like this, also needs detection by quantitative.The country variant threshold size is different, does not wait from 1-5%.China announces and implements " agriculture genetically modified organism security control regulations " May 9 calendar year 2001, and has announced agriculture genetically modified organism safety evaluation, sign and three supporting management ways of import security management on January 5th, 2002.The relevant laws and regulations of various transgenic product have been put into effect in 36 countries and regions, the whole world at present.In a word, the research of transgenic product, producing and selling all will be carried out in particular environment and place under the permission and supervision of relevant government department.

In fact, successively find to occur in transgenic product research, production and the import and export process safety and supervision accident recent years, have various transgenic product diffusions, pollution and potential safety hazard, the detection supervision that strengthens transgenic product is very important.

European Union carried out new transgenic product laws and regulations on the management in 2002, required transgenic product is carried out omnidistance " tracking " from producing, transport, preserve, selling, detected, and did not pollute the non-transgenic product with the assurance transgenic product.The U.S. has proposed kind " individual character preservation " scheme, different is that requirement detects from producing, transport, preserve, sell " tracking " of carrying out whole process the non-transgenic product, to guarantee that the non-transgenic product is not polluted (in fact not contaminated fully is impossible, but will be controlled within certain tolerance band) by transgenic product.Many countries require the exporter to provide qualified after testing non-transgenic product to prove to import non-transgenic food.

In sum, genetically modified food all needs the check monitoring from links such as research, production, storage, transportation, sale, import and export, not only requires to detect whether contain transgenosis, and will detect the content of transgenic product.

To the detection of transgenic product, mainly want to solve the problem of following several aspects: whether be transgenic product; If contain transgenic product, be the commercial transgenic product of certain state's approved again, whether the content that then will detect transgenic product reaches permissible value; If still unratified transgenic product does not allow import or sale in principle.All these be unable to do without infallible GMO detection method.

A good 6MO detection method at first will have GMO specific aim more widely.The acquired character of different genetically modified crops is varied, BAR gene (or its artificial reconstruction sequence) is as a kind of anti-herbicide gene, not only can be used as goal gene and change crop over to, and can be used as screening-gene in the transgenosis process, be a kind of common insertion sequence, ubiquity in genetically modified crops.Therefore, the BAR gene becomes the important dna sequence dna that CMO detects.

Purpose of the present invention will provide good, the highly sensitive amplimer of specificity at Pat (screening) gene order exactly, is used for the detection of the PCR of genetically modified crops.

For achieving the above object, the present invention by the following technical solutions:

A kind of Pat of containing gene transgenic crop nucleic acid amplification primer sequence, described primer sequence comprises: by upstream primer PaT1u sequence is GTCGACATGTCTCCGGAGAG and downstream primer PaT173r, sequence is that the primer of GCAACCAACCAACCAAGGGTATC composition is right, behind the right upstream primer position of this primer, prolong 10 bases and obtain Pat20, obtain Pat163 and prolong 10 bases before the downstream primer position, after prolong 10 bases and obtain Bar183, the primer sequence that in the regional extent of the right upstream and downstream extended position of above-mentioned primer, obtains.

A kind of Bar of containing gene transgenic crop nucleic acid amplification primer sequence, described primer sequence comprises: by upstream primer Patn33u, sequence is that CAGTTGAGATTAGGCCAGCTACA and downstream primer Patn150r sequence are that the primer formed of AACCTCTCTAGATCTCAATCCA is right, before the right upstream primer position of this primer, prolong 10 bases, after prolong 10 bases, and prolong 10 bases before the downstream primer position, after prolong 10 bases, the primer sequence that in the regional extent of the right upstream and downstream institute extended position of above-mentioned primer, obtains.

Primer sequence has

PAT?1u

GTCGACATGTCTCCGGAGAG

PAT?173r

GCAACCAACCAAGGGTATC

Patn33u

CAGTTGAGATTAGGCCAGCTACA

Patn?150r

AACCTCTCTAGATCATCAATCCA

(Pat gene complete sequence is seen appendix one)

Embodiment:

Fig. 1 utilizes fluorescent PCR screening primer change in fluorescence collection of illustrative plates

Fig. 2 Pat1u/Pat173r (627U/816R) amplification transgenic rapeseed DNA electrophorogram

Design of primers:

The multiple Pat gene order of selecting for use among the GMO (comprise the native sequences of Pat gene and manually reconstruct sequence) is compared, and selection wherein lacks secondary structure and conservative gene regions designs many to primer.Primer length is generally about 20 bases, and GC content is 50%-60%, no secondary structure and repeatability in the primer, and with the interior no complementary sequence of primer, the melting temperature (Tm) between primer (Tm value) differs less than 5 ℃ between primer.As follows according to the primer that mentioned above principle is designed:

Upstream: PAT1u, PAT14, PAT43, PAT161, PAT173, PAT189, PAT202,

PAT353，PAT358，PAT413，Patn33u

Downstream: PAT173r, PAT216, PAT239, PAT243, PAT277, PAT461, PAT463,

PAT510，PAT512

Optimum primer sequence is as follows:

PAT?1u

GTCGACATGTCTCCGGAGAG

PAT?173r

GCAACCAACCAAGGGTATC

Patn33u

CAGTTGAGATTAGGCCAGCTACA

Patn?150r

AACCTCTCTAGATCATCAATCCA

The foundation of reaction system and optimization:

The target region template that is adopted in the foundation of reaction system and the optimization obtains with following method: with the transgenic rapeseed that changes this gene over to of having proved conclusively is material, extract genomic nucleic acids with Promega Purification kit, carry out pcr amplification with the primer of the longest amplified fragments in the above-mentioned detection sequence area respectively again.Amplified production carries out 10 times of gradient dilutions with 1 * TE, chooses 10 ^-3, 10 ^-4, 10 ^-5, 10 ^-6, 10 ^-7Totally 5 extent of dilution are serial positive template, and the template when getting Ct value 27 wherein the person is as reaction system optimization later between 29.

The screening of primer:

In the primer screening experiment above-mentioned upstream primer and any pairing of downstream primer are experimentized.

According to our company's the past experience, primer screening adopts fluorescent PCR, and is aided with agarose electrophoresis in conjunction with special probe, and the fluorescent PCR instrument adopts Roche Light-Cycler.The PCR reaction system that is adopted is as shown in table 1.

Table 1.PCR reaction system

Component	Final concentration
		10 * PCR reaction solution	????1×
DNTP (containing dUTP)	????0.2mmol/L
		The Taq enzyme	????2Unit
Mg2+ concentration	????2.5mmol/L

Primer (upstream) I	????0.2umol/L
		Primer (downstream)	????0.2umol/L
Probe	????20.1umol/L
		Template DNA	????2ul
Mend DEPC water extremely	????20ul

The selection of PCR condition: according to our company's experience in the past, the selection of PCR condition is as follows:

93℃：????3min；

40 circulations (fluorescence is collected at 60 ℃ of ends).

Under same template amount, same reaction conditions, the Ct value and the Rn value that are obtained with the specific fluorescence probe signals of Pat gene order are index (the two can reflect pulsating amount of amplification and matter), the amplification situation of more different primers to making up; Simultaneously more same PCR product is carried out agarose electrophoresis.Select the single person of amplified band and Ct value and the high person of Rn value, right as the primer that DNA/PCR to be selected detects.See Fig. 1

Among Fig. 1,2 is that the Pat14u/173r primer is right, and Ct is 27.20,5 is that the Pat14u/216r primer is right, Ct32.79, and 6 is that the Pat14u/239r primer is right, Ct is 27.79,10 to be that the Pat111u/173r primer is right, and Ct is 26.85,15 is that the Pat43u/173r primer is right, Ct is 32.95,29 to be that the Pat43u/216r primer is right, Ct29.94,31 is that the Pat430/239r primer is right, and Ct is 34.39.

As can be seen from Figure 1 this amplification line Ct value smaller (26.85) of pat1u/173r to primer, its fluorescence intensity Rn also has certain altitude, and it is tentatively selected that it is right as primer that stand-by DNA/PCR detects.

The best primer that filters out the Pat gene that can increase at first is to being: upstream Pat1 and downstream Pat173; Its Ct value is 26.85.For whether near other primer location investigating this zone has same expanding effect, satisfy again on the basis of this primer position (Pat1), obtain Pat20 with prolonging 10 bases before the upstream primer; In like manner change downstream primer position (Pat173) and obtain Pat163, Pat183.Pass through the screening of doing fluorescent PCR with aforementioned similarity condition, primer is 27.48 to the Ct value of Pat20/Pat163; Primer is 27.69 to the Ct value of Pat20/Pat183.These results suggest are respectively extended in the regional extent of 10 bases in the right upstream and downstream of the best primer of primary dcreening operation, still can choose the amplimer of good bar gene.

Two upstream primers after extend the back:

Pat20：CTCCGGAGAGGAGACCAGTTT

Two downstream primers after the forward and backward extension:

Pat163：CAAGGGTATCTATCTTGCAA

Pat183：CTCAACCTCAGCAACCAA

With the best upstream and downstream primer of selecting to carrying out the optimization of PCR reaction system

A. the optimization of primer concentration

In the experiment primer concentration is increased progressively with 0.1umol/L from 0.1umol/L to 0.8umol/L.Proportioning to the primer different concns compares.Best primer final concentration result is as follows:

Sequence to be checked

The primer title

Best final concentration (μ M)

The Pat gene	Upstream primer Pat1u	????0.2
			Downstream primer Pat173r	????0.2

B. the optimization of magnesium ion concentration

In the experiment magnesium ion concentration is increased progressively with 0.5mmol/L from 1.0mmol/L to 2.5mmol/L.

Selected 2.5mmol/L MgCl2 is a test kit reaction system magnesium ion concentration from repeated experiments repeatedly.

The optimization of c.Taq archaeal dna polymerase (Taq enzyme) consumption

The optimization experiment result of Taq enzyme dosage (in the U of unit), selected 2U Taq enzyme is as using Taq enzyme amount in the test kit.

The optimization of d.dNTPs concentration

Selected 0.2mmol/L is as the final concentration of test kit dNTPs in the optimization experiment of dNTPs concentration.

E. comprehensive above reaction system optimization experimental result, the PCR reaction system after the optimization sees Table 2.

PCR reaction system after table 2 is optimized

Component	Final concentration
			10 * PCR reaction buffer (pH=8.9)	????1×
Mg2+ concentration	????2.5mmol/L
		DNTPs (containing dUTP)	????0.2mmol/L
The Taq enzyme	????2U
		Primer (upstream)	????0.2umol/L
Primer (downstream)	????0.2umol/L
		Probe	????0.1umol/L
Template	????2ul
		Moisturizing extremely	????20ul

4. Fa Ming effect: through repeated screening, this is right to best primer to obtain pat1u/173r.Its purposes comprises and is used for that conventional PCR (agarose electrophoresis), PCR/ELISA detect or fluorescent PCR detects.Use it for when doing the fluorescent PCR detection, the DNA that extracts with 0.1% transgenic rapeseed does template, and the Ct value that obtains is between 31.0-32.0, and this is the reliable detection lower limit of present different fluorometric assay instruments; And 0.1% detection sensitivity has reached the examination criteria of present international like product.

Embodiment 1

Qualitative detection: choose transgenosis and not genetically modified agricultural-food such as soybean, corn, rape, tomato, potato, extract genomic dna with the Promega paramagnetic particle method, be specially: the l00mg vegetable material of weighing places the 2ml centrifuge tube; Add 500ul Lysis Buffer A and 5ul RNase A, with the material mixing; Add 250ulLysis Buffer B, mixing, room temperature was placed 10 minutes; Add 750ul precipitation buffering liquid, high speed centrifugation behind the mixing (13000 * g) 10 minutes; Draw supernatant in clean 2ml centrifuge tube, add the 50u1 magnetic powder fluid, mixing; Add 0.8 volume Virahol in the mixed solution, mixing, room temperature was placed 5 minutes; Centrifuge tube is placed magnet stand last 1 minute, remove clear liquor; Take out centrifuge tube, add 250ul Lysis Buffer B again, mixing is placed on magnet stand last 1 minute, removes clear liquor; Clean magnetic with 1ml 70% ethanol, place magnet stand last 1 minute, remove clear liquor; Step repeats 2 times; Take out centrifuge tube, in 65 ℃ of dried baths under dry 5 minutes or the room temperature dry 15-30 minute; Add the 100ul deionized water in the centrifuge tube, in 65 ℃ of dried baths, hatched 5 minutes behind the mixing, move to magnet stand last 1 minute again, draw clear liquor in the clean centrifuge tube of 0.5ml, standby as dna profiling.

Do fluorescent PCR with the Pat1u/Pat173r primer and detect, be specially: in the 20ul reaction system, contain plant genome DNA 2ul, carry out fluorescent PCR and detect, concrete reaction conditions is the same.After testing, above-mentioned genetically modified crops are as containing Pat gene (as the GMO canola) amplification that all is positive, and its detection sensitivity all can reach 0.1%; Not genetically modified agricultural-food or the transgene agricultural product that does not contain the Pat gene then do not have amplified signal, point out this primer to having good sensitivity and specificity.

Embodiment 2

Electrophoresis detection: getting the transgenic rapeseed standard substance that meet international standard is material, and genome DNA extracting method is the same, carries out pcr amplification with Pat1u/Pat173r primer primer, and the pcr amplification condition is as follows:

93 ℃: 1 circulation of 3min

93 ℃: 15 sec; 60 ℃: 30 sec; 72. 40 circulations of ℃ 1min

Get above-mentioned amplified production, adopt 1% agarose, 2V/CM electrophoresis one hour, EB working fluid soak 15min, and observations is as seen under the ultraviolet lamp: all visible amplified band clearly of positive sample, and negative sample does not have any amplified band, specifically sees Fig. 2.

Among Fig. 2,

1) 0.1% transgenic rapeseed 0.0% transgenic rapeseed 2)

3) 2.0% transgenic rapeseed 0.5% transgenic rapeseed 4)

M)2000?ladder

Advantage of the present invention: Pat1u/Pat173r primer provided by the invention is done fluorescent PCR and is detected, its detection sensitivity can reach 0.1%, and the transgene agricultural product or not genetically modified agricultural product soybean, the corn etc. that do not contain Pat1u/Pat173r all do not have amplified signal, illustrate that these primers have good sensitivity and specificity. Its detection efficiency can reach the world level of this project in the field of nucleic acid amplification. Appendix one: Pat gene complete sequence PAT:GTCGACATGTCTCCGGAGAGGAGAC CAGTTGAGATTAGGCCAGCTACAGCAGCTGATATGGCCGCGGTT

  PAT 1u                           Patn33u TGTGATATCGTTAACCATTACATTGAGACGTCTACAGTGAACTTTAGGACAGAGCCACAAACACCACAA GAG TGGATTGATGATCTAGAGAGGTTGCAAGATA GATACCCTTGGTTGGTTGCTGAGGTTGAGGGTGTT

    Patn 150r                        PAT 173r GTGGCTGGTATTGCTTACGCTGGGCCCTGGAAGGCTAGGAACGCTTACGATTGGACAGTTGAGAGTACT GTTTACGTGTCACATAGGCATCAAAGGTTGGGCCTAGGATCCACATTGTACACACATTTGCTTAAGTCT ATGGAGGCGCAAGGTTTTAAGTCTGTGGTTGCTGTTATAGGCCTTCCAAACGATCCATCTGTTAGGTTG CATGAGGCTTTGGGATACACAGCCCGGGGTACATTGCGCGCAGCTGGATACAAGCATGGTGGATGGCAT GATGTTGGTTTTTGGCAAAGGGATTTTGAGTTGCCAGCTCCTCCAAGGCCAGTTAGGCCAGTTACCCAG ATCTGA

Sequence table＜110〉PiJi Biology Engineering Co., Ltd., Shenzhen City National Entry-Exit Inspection and Quarantine Bureau Animals and Plants Quarantine Laboratory＜120〉contain Pat gene transgenic crop nucleic acid amplification with primer sequence＜130〉＜160〉4＜170〉PatentIn version 3.1＜210〉1＜211〉20＜212〉DNA＜213〉artificial synthetic＜400〉1gtcgacatgt ctccggagag 20＜210〉2＜211〉19＜212〉DNA＜213〉artificial synthetic＜400〉2gcaaccaacc aagggtatc 19＜210〉3＜211〉23＜212〉DNA＜213〉artificial synthetic＜400〉3cagttgagat taggccagct aca 23＜210〉4＜211〉23＜212〉DNA＜213〉artificial synthetic＜400〉4aacctctcta gatcatcaat cca 23

Claims (4)

1, a kind of Pat of containing gene transgenic crop nucleic acid amplification primer sequence, it is characterized in that described primer sequence comprises: by upstream primer PaT 1u sequence is GTCGACATGTCTCCGGAGAG and downstream primer PaT173r, sequence is that the primer of GCAACCAACCAACCAAGGGTATC composition is right, behind the right upstream primer position of this primer, prolong 10 bases and obtain Pat20, obtain Pat163 and prolong 10 bases before the downstream primer position, after prolong 10 bases and obtain Bar183, the primer sequence that in the regional extent of the right upstream and downstream extended position of above-mentioned primer, obtains.

2, a kind of Pat of containing gene transgenic crop nucleic acid amplification primer sequence according to claim 1, it is characterized in that described primer sequence is: the upstream primer sequence is GTCGACATGTCTCCGGAGAG, and the downstream primer sequence is GCAACCAACCAACCAAGGGTATC.

3, a kind of Bar of containing gene transgenic crop nucleic acid amplification primer sequence, it is characterized in that described primer sequence comprises: by upstream primer Patn33u, sequence is that CAGTTGAGATTAGGCCAGCTACA and downstream primer Patn150r sequence are that the primer formed of AACCTCTCTAGATCTCAATCCA is right, before the right upstream primer position of this primer, prolong 10 bases, after prolong 10 bases, and prolong 10 bases before the downstream primer position, after prolong 10 bases, the primer sequence that in the regional extent of the right upstream and downstream institute extended position of above-mentioned primer, obtains.

4, a kind of containing according to claim 3 with Pat gene transgenic crop nucleic acid amplification primer sequence, it is characterized in that described primer sequence is: above-mentioned primer sequence is CAGTTGAGATTAGGCCAGCTACA, and the downstream primer sequence is AACCTCTCATAGATCTCAATCCA.

Images