CN1462804A - Filtering out non essential segment in copying adenovirus of birds, and its gene engineering products - Google Patents

Abstract

A process for screening the unnecessary fragment in copying aviadenovirus Group I separated in china includes such steps as amplifying terminal L fragment and r fragment and ITR fragment, cloning into pHC cosmid vector, inserting the intensified green fluorescin (eGFP) gene between said r and ITR fragments, configuring transfer plasmid carrier pFA-eGFP, transfect it to the kidney cell of chicken embryo infected by wild virus, homogeneous recombination, and screening recombinant virus to obtain the recombinant aviadenovirus expressing eGFP, so determining that the site between r and ITR fragments is necessary fragment. It can be used to develop associated genetically engineering products.

Description

Aviadenovirus duplicates nonessential segmental screening and gene engineering product thereof

Technical field

The invention belongs to the technical field that the genetically engineered in the biological-pharmacy is produced the vaccine medicine.

Background technology

Adenovirus is found in nineteen fifty-three the earliest, owing to they tend to infects epithelial be named as adenovirus (Adenovirus, Adv).Adenovirus is in Adenoviridae (Adenoviridae), and is widely distributed at occurring in nature.Can be divided into two genus according to its morphological structure, immunological characteristic and host range: mastadenovirus (Mastadenovirus) and Aviadenovirus (Aviadenovirus).

Adenovirus is simple in structure, can produce a large amount of viral DNAs in course of infection, is the good model of eukaryotic gene expression regulatory mechanism research, and the adenovirus host range is extensive, and the infection rate height is easy to cultivate and purifying; Insert foreign gene in adenoviral gene group specific region, do not influence virus replication and can make the foreign gene good representation; Adenovirus is used as living vaccine, relatively safety.Present adenoviral gene group structure, the feature of duplicating, transcribing have also been studied quite clearly, particularly success of some adenovirus and animal construction of recombinant adenovirus containing and successful Application clinically thereof make adenovirus more be subjected to general attention as the research of carrier.

Making up adenovirus carrier comprises and foreign DNA is inserted in the adenoviral gene group disappearance E1 district or E3 district when inserting usually.Adenovirus hominis E1 district disappearance virus can be bred in 293 cells, and for the survival of virus, the disappearance in E1 or E3 district does not influence packaging signal.In addition, assisting down of corresponding clone, the disappearance carrier of scleroproein gene also occurred, or even lacked the carrier of all encoding viral genes.Because the replication of adenovirus has stronger kind specificity, therefore, need to make up different types of adenovirus carrier for fear of using unaccommodated carrier.The animal construction of recombinant adenovirus containing is mainly based on the structure of adenovirus hominis carrier.The animal adenovirus major of studying morely at present has ox, dog, mouse, pig etc.Wherein porcine adenovirus 3 types (PAV-3) are applied in clinical for the carrier on basis.Monteil etc. will contain the replication defective adenoviral recon clinical application of pseudorabies virus protective antigen gene in newborn piglet, and the result confirms to produce neutralizing antibody, and not be subjected to female anti-influence, to the protection of piglet for 16 weeks.The recombined porcine adenovirus (rPAV) that Hammond JM etc. will contain swine fever gp55 (E2) with dosage immunity newborn piglet after, also can produce limited provide protection.

The bird adenovirus has 10 serotypes at least, wherein CELO virus (CELO) is the analysis that aviadenovirus 1 type, aviadenovirus 10 types, goose source adenovirus, egg drop syndrome virus etc. have all been finished structure, complete sequence analysis or the important sequence of physical map, lays the foundation for making up bird gland virus expression carrier.Represent the CELO virus of serum I type aviadenovirus to study relatively thoroughly, its genome total length is 438048bp, has finished the mensuration work of complete sequence at present.

The homologous recombination technique of utilizations such as Anne-Isabelle Michou virus in E.coli made up the CELO virus vector.Its result of study has identified that one of a series of virus replication required area and right end is duplicated nonessential region, filtered out AIM46 CELO carrier, this carrier is applied to the research and development of bird vaccine, the more important thing is the zone of having identified a trans-acting, provide experiment basis for setting up auxiliary cell line.Equally, therefore also the same with the Ad5 carrier mammalian cell of transduceing of CELO carrier has shown also that development CELO carrier is used for human gene therapy's potentiality.Francois A etc. utilizes the point mutation technology to determine the nonessential region that duplicates of CELO virus, has made up rf CELO virus vector on this basis.The proteic cDNA of this carrier portability coding IBDV, and can use as the vaccine of chicken.Sheppard M etc. place the VP2 gene of IBDV in the downstream of FAV-10 major late promoter (MLP), insert the NotI site (this site is unique) at the right terminal 99.5mu of viral genome place then on genome, be built into genome and do not have disappearance, contained the reorganization FAV-10 virus of foreign gene.This recombinant virus inoculation SPF chicken can produce antibody response, is highly resistant to the infection of IBDV.

Technology contents

The objective of the invention is to research and develop the reproducibility virus live vector that China is suitable for poultry immunity, development genes involved engineered vaccine is in the hope of playing a role aspect the important transmissible disease of control bird.

The present invention is a material with the isolating I group's aviadenovirus of Chinese chicken group, should virus genomic two terminal L fragments and r fragment by PCR method, the ITR fragment amplification comes out, the clone advances in the pHC cosmid vector, and be reporter gene with enhanced green fluorescence protein (eGFP) gene, between the r fragment and ITR fragment that insertion designs, make up transferring plasmid vector pFAV-eGFP, then transfection by wild virus infection chicken embryo kidney cell, carry out homologous recombination, by infinite dilution method recombinant celo virus, obtain to express the recombinant fowl adenovirus of enhanced green fluorescence protein.Thereby determine that the site between right terminal r fragment of genome and ITR fragment is the virus replication nonessential region, and develop the genes involved engineering product as carrier.

The present invention also is to screen the recombinant fowl adenovirus that obtains expression alien gene.

The present invention is that also the recombinant fowl adenovirus of above-mentioned screening acquisition expression alien gene is used for the producer gene engineered vaccine.

Specific embodiment

1.FAVI amplification and the extraction of viral DNA

Virus stock solution used is carried out inoculating 9 age in days SPF chicken embryos after 100 times of dilutions, and 37 ℃ of hatchings were got allantoic fluid after 6 days, did suitable processing back negative staining, observed morphology of virus, got the allantoic fluid protease K digesting then, and it is standby to extract virus genom DNA according to a conventional method.

2 design of primers

FAVI virus whole genome sequence according to having delivered has designed three pairs of primers, and they are respectively

PL1：5’ggggcggccgcgatgatgtataataacct3’；

PL2：5’gggtctagactcacgcgacatgactgtct3’

Pr1：5’gcgtctagaccagaaccattcttcagccg3’

Pr2：5’gcggaattcgtaccggactgttgtgcgga3’

PITR1：5’gcggaattcacacacggacaacttcaaag?3’

PITR2：5’gcggtcgacgatgatgtataataacctc?3’

I group's aviadenovirus genome left-end point L fragment, right terminal r fragment and right ITR fragment increase respectively.

3 pcr amplifications

The viral DNA of getting 0.1 μ g carries out pcr amplification, adopts the PCR system of 50 μ l: DNA, 0.1 μ g, 10 * PCRbuffer, 5 μ l, 25mM MgCl2 3 μ l, 10mM dNTP 1 μ l, each 25pmol of upstream primer and downstream primer, Taq enzyme 0.5U, add sterilization ultrapure water to 50 μ l, and undertaken: 1. 94 ℃ of 5min, 2. 94 ℃ of 1min, 3. 56 ℃ of 1min by following program, 4. 2. 5. 72 ℃ of 2min repeat-4. go on foot 6. 7. 8. end of 4 ℃ of forever of 72 ℃ of 10min of 30 circulations.

4.PCR the recovery of product, connection and order-checking

The PCR product is passed through 0.8% agarose gel electrophoresis, downcut the purpose fragment, and reclaim test kit with sepharose and reclaim purifying, fetch and receive product and be connected more than the 8hr in 4 ℃ with the pGEM-Teasy carrier in 3: 1 ratio, transform DH5 α competence bacterium, by X-Gal plate screening hickie, enzyme is cut evaluation, and three segmental positive plasmid pGEM-T-L, pGEM-T-r, pGEM-T-ITR are used for next step clone and order-checking.

5 contain the structure of eGFP gene FAVI transferring plasmid vector

At first with pGEM-T-r EcoRI, the SpeI enzyme is cut, reclaim the r fragment of 2kb, the clone advances in the PHC carrier of cutting with corresponding enzyme enzyme, and then with the ITR fragment among the pGEM-T-ITR with EcoRI, SalI is inserted into and contains in the segmental pHC-FAVI-r carrier of r, obtain carrier pHC-FAVI-r-ITR, the eGFP expression cassette that contains CMV promotor and SV40 polyA is inserted in EcoRI site at this carrier, acquisition contains the pHC-FAVI-r-ITR-eGFP transferring plasmid vector of reporter gene, in order to be beneficial to intracellular homologous recombination, also insert the L fragment of FAVI at last at pHC-FAVI-r-ITR-eGFP.

6 contain the structure of eGFP gene recombination FAVI

In the 60mm culture dish, cultivate former generation CEK to forming 80% individual layer, infect CEK, 37 ℃ of effect 2h with 100 TCID50wt-FAVI; Simultaneously, the DMEM that in 2 eppendorf pipes, respectively adds 100 μ l serum-frees, the FAVI transferring plasmid DNA that adds 7-8 μ l Lipofectin and 1.5-4 μ g then respectively, put room temperature 45min, 2 pipes are mixed, room temperature effect 15mins, the DMEM that adds 800 μ l serum-frees, gently this transfection mixed solution is transferred on the CEK that infects FAVI, at 37 ℃, 5%CO2 effect 6h, transfection liquid is removed in suction, add the DMEM that contains 8% calf serum, cultivated 2-3 days, and observed fluorescence every day for 37 ℃ until the recombinant virus fluorescent spot occurring.

The results of 7 fluorocytes and contain going down to posterity of eGFP gene recombination FAVI

(2 * cell culture maintenance medium mixes with 1.6% agar equal-volume, 5ml/dish), treats that agar solidifies back upset culture dish, 37 ℃, 5%CO2 continuation cultivation 24-48hr to cover nutrient agar medium in the culture dish of fluorescence occurring.The cell and the cell colony that occur fluorescence in the nucleus are performed mark under fluorescent microscope, then with suction pipe with its sucking-off, place the 1ml cell culture maintenance medium, after the freeze thawing 3 times, get supernatant, infect CEK on the 24 porocyte culture plates with different extension rates, after waiting fluorescence to occur, carry out fluorescence again and choose spot.

Claims (8)

1, aviadenovirus duplicates nonessential segmental screening, it is characterized in that mainly being finished by following steps:

1) be material with the isolating I group's aviadenovirus of Chinese chicken group, by PCR method virus genomic two terminal L fragments and r fragment, ITR fragment amplification are come out, the clone advances carrier, and inserts between the r fragment and ITR fragment that designs with reporter gene, makes up transferring plasmid vector;

2) with the aviadenovirus transferring plasmid vector transfection that makes up by wild virus infection chicken embryo kidney cell, carry out homologous recombination, recombinant celo virus.

2,, it is characterized in that respectively aviadenovirus gene DNA genome left-end point L fragment, right terminal r fragment and right ITR fragment being carried out pcr amplification with PCR according to the described method of claim 1.

3,, it is characterized in that the segmental upstream and downstream of amplification gene group left-end point L primer is respectively PL1:5 ' ggggcggccgcgatgatgtataataacct3 ' according to the described method of claim 2; PL2:5 ' gggtctagactcacgcgacatgactgtct3 '.

4,, it is characterized in that the segmental upstream and downstream of the right terminal r of amplification gene group primer is respectively Pr1:5 ' gcgtctagaccagaaccattcttcagccg3 ' according to the described method of claim 2; PL2:5 ' gcggaattcgtaccggactgttgtgcgga 3 '.

5,, it is characterized in that the segmental upstream and downstream of the right ITR of amplification gene group primer is respectively: PITR1:5 ' gcggaattcacacacggacaacttcaaag 3 ' according to the described method of claim 2; PITR2:5 gcggtcgacgatgatgtataataacctc 3.

6, according to the described method of claim 2, it is characterized in that method that carrier cloning in the step 1) makes up transferring plasmid vector is at first the r fragment cloning of 2kb to be advanced in the PHC carrier of cutting with corresponding enzyme enzyme, and then the ITR fragment is inserted into contains in the segmental pHC-FAVI-r carrier of r, obtain carrier pHC-FAVI-r-ITR, the eGFP expression cassette that contains CMV promotor and SV40polyA is inserted in EcoRI site at this carrier, acquisition contains the pHC-FAVI-r-ITR-eGFP transferring plasmid vector of reporter gene, in order to be beneficial to intracellular homologous recombination, also insert the L fragment of FAVI at last at pHC-FAVI-r-ITR-eGFP.

7, screen the recombinant fowl adenovirus that obtains expression alien gene according to claim 1.

8, screen the recombinant fowl adenovirus producer gene engineered vaccine that obtains expression alien gene according to claim 1.