CN1259106C

CN1259106C - Preparation of target gene virus medicine against cancers

Info

Publication number: CN1259106C
Application number: CN 02157662
Authority: CN
Inventors: 邹卫国; 罗春霞; 邱松波; 张紫莱; 孙兰英; 顾锦法; 裴子飞; 刘新垣
Original assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Current assignee: Center for Excellence in Molecular Cell Science of CAS
Priority date: 2002-12-23
Filing date: 2002-12-23
Publication date: 2006-06-14
Anticipated expiration: 2022-12-23
Also published as: CN1509764A

Abstract

The present invention provides a method for preparing an anticancer targeting gene virus medicine, which belongs to the field of biotechnology. The present invention constructs adenovirus with 55Kda gene deletion and carries an extraneous source anticancer gene which is named as an Ad5-ZD55-gene, the defect that an ONYX-015 virus can not carry the extraneous anticancer gene is overcome, and the anticancer effect is enhanced. Adenovirus mutant constructed by the present invention can develop a novel anticancer medicine for effectively treating tumors.

Description

A kind of preparation method of anti cancer target gene viruses medicine

Technical field:

The invention belongs to biological technical field.Be specifically related to a kind of preparation method of anti cancer target gene viruses medicine.

Background technology:

The malignant tumor serious harm mankind's life and health.China's annual cancer neopathy number surpassed for 1,600,000 (cancer patient's total number of persons surpasses 1,000 ten thousand).Cancer surpasses cardiovascular and cerebrovascular disease possibly and forms lethal first reason into the mankind.

Gene therapy is nearly 10 years a kind of biological high-technology schemes of rising, and the therapy of tumor scheme accounts for more than 60% in whole gene therapy scheme, may be that the treatment malignant tumor is hopeful one of scheme most.Be divided into virus and two types of non-virus types as Vectors in Gene Therapy at present.Non-virus carrier comprises: the DNA of naked DNA liposome and other material parcel; Viral vector comprises: retrovirus, adenovirus, adeno-associated virus and herpesvirus etc.Virus-mediated DNA transfer method is being developed rapidly in recent years, the still adenovirus vector of wherein comparatively using always in genetic treatment of tumor.

Adenovirus is a kind of double-stranded DNA virus, and genome length is 36kb, divides early stage and late transcription district.With the deletion of its E1 district (or E1 and E3 delete simultaneously), obtain traditional adenovirus vector, it is that 8kb is with interior exogenous gene that this carrier can insert and express length.Adenovirus vector can infect polytype cell, comprises the quiescent stage cell, and it can be cultivated and obtain the viral pure product of high titre on a large scale, and these characteristics make adenovirus become the common carrier of therapy of tumor.Traditional adenovirus vector not reproducible itself produces progeny virus, has obtained some zoopery result preferably although traditional adenovirus vector is used for therapy of tumor, does not also have clear and definite clinical efficacy so far.Adenovirus vector can not targeting transfection tumor cell, and this is considered to the limited main cause of its clinical efficacy.

Before 100 years, the someone phenomenon that tumor temporarily disappears occurs after finding only a few tumour patient infective virus, thereby has begun the trial of oncovirus treatment.Using gene engineering technique, change the genome of virus, make it in tumor cell, to duplicate specifically and propagate, and kill tumor cell thereupon, the progeny virus that discharges is diffused into the tumor cell that closes on, and causes a kind of chain reaction in tumor tissues, finally spreads to whole tumor and all eliminates it, but to not infringement of normal structure, the application of special virus of proliferation has brought new dawn to oncotherapy in tumor.

Genetic treatment of tumor does not have major progress clinically, and the viral therapy of tumor makes substantial progress.Sudden change adenovirus (the d11520 that U.S. ONXY pharmaceuticals develops, also be ONYX-015), be with the E1b55K protein gene of adenoviral gene group disappearance, make the adenovirus of this sudden change in the tumor cell of p53 disappearance, to carry out massive duplication, and in normal cell reproducible not.Use ONYX-015, the conventional chemotherapy of associating is treated the head and neck cancer patient of 30 routine chemotherapy recurrences, and wherein 8 examples are alleviated fully, and wherein the tumor that reaches more than 10 centimetres of 1 routine diameter also disappears fully, 11 routine tumors are dwindled over half, and total effective rate reaches 63% (Nature Medicine 2000).It is clinical to have entered the III phase at present, and the treatment case surpasses 200 patients, and this is the method for the most significant tumor biotherapy of present curative effect.ONYX-015 and chemotherapy are share, and treat head and neck cancer clinically and have obtained 63% curative effect, but use ONYX-015 (not combining with chemotherapy) separately, and then curative effect is very poor, has only 15-20%.In order to overcome the unfavorable shortcoming of independent use ONYX-015 curative effect, Liu Xin wall academician just proposed in 2000 (Chinese tumor biotherapy magazine, 8 (1), 2001, P1-), a kind of New Policy: the gene viruses therapeutic strategy of tumor.In the tumour-specific virus of proliferation, add antioncogene, genetic treatment of tumor and viral therapy are combined.This novel oncotherapy strategy has kept effective specificity of viral therapy on the one hand, utilize the massive duplication of virus on the other hand and make the also amplification in a large number of its entrained antioncogene, efficiently expressed, both synergism further improve anticancer therapeutic.

Summary of the invention:

Technical problem to be solved by this invention is to overcome in the therapy of tumor viral vector shortcoming of specific amplification in tumor effectively, improve ONYX-015 not carry exogenous gene and lack the present situation of lethality, the two advantage of genetic treatment of tumor and viral therapy is combined, provide a class can targeting in tumor cell, to duplicate and breed, and in normal cell, do not breed, can in tumor cell, efficiently express the recombinant adenovirus of antioncogene simultaneously.

The invention provides a kind of preparation method of anti cancer target gene viruses medicine.This method is the construction method of the adenovirus of the tumour-specific propagation of expression antioncogene, and it is characterized in that: (1) uses the fixed point PCR method, makes the 2269-3327bp disappearance of adenovirus.Behind E1B 19Kda gene, added SV40 polyA tail.Single endonuclease digestion site Bgl II in the adding of SV40 polyA tail; (2) antioncogene is cloned the into multiple clone site of plasmid pCA13, go out the expression cassette (it comprises HCMV promoter, antioncogene, SV40poly A tail) of therapeutic gene, insert in the adenovirus vector of reincarnate with the BglII enzyme action; (3) with the adenovirus vector and the big plasmid pBHGE of gland-containing virus of the antioncogene of reincarnate ₃Or pBHG ₁₀Transfection HEK-293 cell builds up the treatment recombinant adenovirus; (4) recombinant adenovirus used of separate therapy.

The present invention is according to the difference of the gene that inserts, with this viroid called after Ad5-ZD55-gene, and as Ad5-ZD55-sFLT-1, Ad5-ZD55-IL-12 etc.

The present invention makes up the adenovirus of disappearance 55Kda gene and carries the ZD55-gene of external source antioncogene, overcomes the shortcoming that the ONYX-015 adenovirus can not carry the external source antioncogene, has improved anticancer effect.The present invention uses the rite-directed mutagenesis round pcr, has lacked the 55Kda albumen of wild-type adenovirus, adds a restriction enzyme site simultaneously, can insert the expression cassette of antioncogene easily, and the back connects the termination signal of SV40 PolyA tail again.The present invention has lacked the bp2269-3327 of adenovirus, be maximum a kind of of disappearance 55Kda protein gene base in the sudden change adenovirus, for inserting the external source antioncogene, pZD55 provides more space, this is the another advantage of our carrier, and ONYX-015 not contains exogenous gene insertion site, so can't insert the external source antioncogene.

The recombinant virus that the present invention makes up not only can optionally duplicate propagation at specifically inside tumor cell, also has the antioncogene of kill tumor cell, and specificity virus makes the antioncogene copy number roll up again at the massive duplication of cancerous cell.Realized the tight synergism of genetic treatment of tumor and viral therapy.

The adenoviral mutants that the present invention is constructed can be developed the PTS of effective treatment tumor, is used for the treatment of the tumor of p53 gene or p53 pathway deficiency.Can develop a kind of pharmaceutical composition, this drug regimen contains any one recombinant adenovirus that the present invention describes, as carry the A antioncogene and carry mutually combining of B antioncogene, also can form combination therapy: chemotherapeutic agent with one of following compounds; Biotoxin; Immunosuppressive compounds, monoclonal antibody etc.

The pZD55 carrier that the present invention makes up obtains the ZD55 adenovirus with it and the big plasmid pBHGE3 or the pBHG10 homologous recombination of the most gene of gland-containing virus, and it can special propagation increase in the tumor that p53 lacks, and does not breed in normal cell.Simultaneously, pZD55 can insert (dress) with the expression cassette of antioncogene very easily and go into turnover, and packs out the replicative adenovirus (Ad5-ZD55-gene) that can express antioncogene.This adenovirus of expressing antioncogene can specific cracking tumor cell, can efficiently express antioncogene simultaneously.Compare with the adenovirus vector of non-proliferative, can in tumor cell, improve the expression of antioncogene specifically greatly.The present invention is that example is illustrated with Ad5-ZD55-sFLT-1.

The present invention has following beneficial effect:

1. the invention provides a kind of saltant adenovirus of E1b 55Kda gene delection, prove, can optionally in tumor cell, breed, and not kill normal cell,, can be used for the treatment of kinds of tumors through animal experiment through cell experiment.

2. the invention provides a kind of construction method of adenovirus of E1b 55Kda gene delection.This method can be used for making up the novel mutation adenovirus, is easy to grasp, and has added the cloning site of being convenient to insert the external source antioncogene.

3. the sudden change adenovirus vector that makes up of the present invention, the external source antioncogene of can packing into very easily, can be in tumor cell propagation in a large number, we are referred to as gene-virus.This carrier can construction expression the several genes-virus of different antioncogenes, for the gene-viral therapy of tumor provides good basis.

4. gene-the virus of the present invention's structure is a kind of tumour-specific replicative adenovirus, optionally massive duplication propagation in tumor cell.Simultaneously the entrained antioncogene of this recombinant virus also along with virus at the massive duplication of tumor cell and a large amount of amplification, so this gene-virus has very high antitumaous effect.Realized the tight synergism of genetic treatment of tumor and viral therapy.

5. the several genes virus of the present invention's structure can optionally be killed oncocyte through the animal experiment proof, and does not influence normal cell.The antioncogene of gene-expressing viral can add the antitumous effect of strong virus.This novel gene viruses has been laid good basis for being used for the human tumor treatment from now on.

6, the gene viruses of the present invention's structure can be formed complex with one of following compounds: other gene-virus, chemotherapeutics; Biotoxin; Immunosuppressive compounds, monoclonal antibody etc.

The specific embodiment:

The structure of the plasmid vector pZD55 of example I .55Kda gene delection

Unless otherwise indicated, the technology used in the present invention all is this area routine techniquess, as molecule clone technology, and microbiological technique, cytobiology technology, these technology all are fully explained in the literature, as Sambrook " molecular cloning experiment guide " etc.

The PXC1 carrier is purchased in Canadian Microbix Biosystem Inc. (Toronto), and the PXC1 plasmid contains 5 type adenoviral sequence bp22-5790.

Utilize two round pcrs of positional mutation, make up the New-type adenovirus carrier of E1b 55Kda gene delection.The primer of PCR reaction:

Primer 1:5 ' gcc cga cat cac ctg tgt cta gag aat g 3 ' (containing bp1321-1348 pairing among Xba I site and the pXC1)

Primer 2: 5 ' tca gat ggg ttt ctt cac tcc att tat cct 3 ' (with bp 2040-2011 pairing among the pXC1)

Primer 3:5 ' ata aag gat aaa tgg agt gaa gaa acc cat ctg ag 3 ' (with bp 2007-2041 pairing among the pXC1, the 3rd codon mutation of 55Kda gene becomes termination codon, sudden change C2024T)

Primer 4:5 ' gaa gat cta tac agt taa gcc acc tat aca aca 3 ' (contain bp 2269-2245 among Bgl II site and the pXC1, the sudden change of E1B 55Kda gene reading frame, C2252T, G2261T have added two termination codoies)

With the PXC1 plasmid is the template of PCR reaction, and primer 1 carries out the PCR reaction first time with primer 2, and the 719bp fragment is reclaimed in the leakage of electricity swimming.With the PXC1 plasmid is the template of PCR reaction, and primer 3 carries out the PCR reaction second time with primer 4, and the 270bp fragment is reclaimed in the leakage of electricity swimming.The product of twice PCR reaction has the matched sequence of 34bp, mixes as template with the twice PCR product, carries out PCR reaction for the third time with primer 1 and primer 4, and the 955bp fragment is reclaimed in the leakage of electricity swimming.With the PCR product of Xba I+Bgl II enzyme action 955bp, the clone advances the pXC1 plasmid that Xba I+BglII enzyme action is crossed, called after pXC1-D55.PXC1-D55 compares with PXC1, lacked the bp2269-bp3327 of PXC1 carrier, the 3rd codon mutation of E1b 55Kda gene become termination codon, and, added two termination codoies for E1b 55Kda gene reading frame again in E1b 19Kda albumen termination codon back.

The pCA13 plasmid is purchased in Canadian Microbix Biosystem Inc (Toronto), PCA13 contains 5 type adenoviral sequence bp22-5790, and disappearance E1 district 342 to 3523bp fragments, distinguish in the E1 disappearance and to have inserted Human Cytomegloviru (HCMV) IE promoter (299-+72) and SV40 polyA tailing signal.With BamH I+Bgl II enzyme action PCA13 carrier, the 160bp fragment is reclaimed in the leakage of electricity swimming, promptly reclaims SV40 polyA tail, and fragment cloning is advanced the pXC1-D55 that Bgl II enzyme action is crossed, and enzyme action is identified, forward is cloned called after pZD55.Added SV40 polyA tail in E1b19Kda protein gene back.Has only a BglII site among the pZD55.Front, BglII site is a SV40 polyA tail, and the BglII site also not in adenovirus promoter, can be used for inserting gene expression frame and do not influence other expression of gene in the adenovirus not in the reading frame of adenoviral gene, does not influence duplicating of adenovirus.But contain the left arm sequence of carrying out homologous recombination with adenovirus among the pZD55.

The PZD55 plasmid is checked order, and sequencing result is consistent with expected results, shows the vector construction success.

……GATTTTCTGGCCATGCATCTGTGGAGAGCGGTTGTGAGACA

CAAGAATCGCCTGCTACTGTTGTCTTCCGTCCGCCCGGCGATAA

TACCGACGGAGGAGCAGCAGCAGCAGCAGGAGGAAGCCAGGC

GGCGGCGGCAGGAGCAGAGCCCATGGAACCCGAGAGCCGGCC

TGGACCCTCGGGAATGAATGTTGTA TAGGTGGCT TAACTGTA

T

AGATCTGGAAGGTGCTGAGGTACGAT

GAGACCCGCACCAGGTGCAGACCCTGCGAGTGTGGCG……

It in the square frame SV4O poly A tail sequence.

AGATCT is Bgl II site.

TAG, TAABe the termination codon of E1b 55K Da gene reading frame.

Example II. the expression cassette of antioncogene is inserted pZD55, make up the gene viruses plasmid

(the gene here can be suicide gene CD, TK product to pZD55-gene; Gene Trail, the Blys that antitumaous effect is very strong, Smae product; Cytokine 1L-12,1L-2, IFN, GM-CSF; Apoptosis gene ICF, Caspase-3, Caspase-8, Caspase-9, Bax product; The blood vessel life is at suppressor gene, sflt-1, Angicstatin, Endcstatin, TIMP-4, PAI product.Any gene, existing is that example is illustrated with the sFLT-1 gene only).

The pCA13 carrier is purchased in Canadian Microbix Biosystem Inc. (Toronto), PCA13 contains 5 type adenoviral sequence bp22-5790, and disappearance E1 district's 342 to 3523bp fragments (but wherein containing adenovirus left arm recombination sequence), inserted Human Cytomegloviru (HCMV) IE promoter in E1 disappearance district (299-+72) and SV40 polyA tailing signal, between IE and tailing signal, contain a plurality of multiple clone site, Sal I, Hind III, EcoRI, EcoR V, Xba I, Xho I, BamH I.With above-mentioned any gene, forward be inserted into the multiple clone site of pCA13 by the method for genetic manipulation, be built into plasmid pCA13-gene.With plasmid pCA13-gene Bgl II enzyme action, can cut out the expression cassette of this gene.This expression cassette comprises hCMV promoter, antioncogene and SV40 polyA tail.Then this expression cassette is cloned the pZD55 plasmid of Bgl II single endonuclease digestion into and dephosphorization, be built into plasmid pZD55-gene.

Be that example is illustrated only now with the sFLT-1 gene.FLT-1 is the receptor of human vascular endothelial growth factor VEGF, sFLT-1 is the extracellular region of receptor, it can combine with VEGF, thereby suppress the VEGF activity, so the high expressed of sFLT-1 can suppress the promotion angiogenic growth effect of VEGF, thereby suppress the nutrition supply of tumor, reach the purpose of killing tumor.

Use polymerase chain reaction,PCR (PCR) technology, in people's myocardial cell cDNA library, amplify the extracellular region cDNA (sFLT-1) of the FLT-1 gene of 1014bp, and at terminal EcoR I and two restriction enzyme sites of BamH I introduced of gene

Primer 5:5 ' tag aat tca tgg tca gct act ggg ac 3 '

(containing EcoRI site and FLT-1 bp1-18 pairing)

Primer 6:5 ' tga gga tcc tta atg ttt cac agt gat gaa tgc 3 '

(containing BamHI site and FLT-1 bp1014-994 pairing)

After the PCR reaction, reclaim the 1029bp fragment, use EcoR I+BamH I double digestion, this genetic fragment that obtains is inserted the plasmid of pCA13, name pCA13-sFLT-1.Measure wherein sFLT-1 sequence, result's following (consistent) with gross data:

Gaattcatggtcagctactgggacaccggggtcctgctgtgcgcgctgctcagctgtctgcttctcacag

gatctagttcaggttcaaaattaaaagatcctgaactgagtttaaaaggcacccagcacatcatgcaagca

ggccagacactgcatctccaatgcaggggggaagccagcccataaatggtctttgcctgaaatggtgagt

aaggaaagcgaaaggctgagcataactaaatctgcctgtggaagaaatggcaaacaattctgcagtact

ttaaccttgaacacagctcaagcaaaccacactggcttctacagctgcaaatatctagctgtacctacttca

aagaagaaggaaacagaatctgcaatctatatatttattagtgatacaggtagacctttcgtagagatgtac

agtgaaatccccgaaattatacacatgactgaaggaagggagctcgtcattccctgccgggttacgtcac

ctaacatcactgttactttaaaaaagtttccacttgacactttgatccctgatggaaaacgcataatctggga

cagtagaaagggcttcatcatatcaaatgcaacgtacaaagaaatagggcttctgacctgtgaagcaaca

gtcaatgggcatttgtataagacaaactatctcacacatcgacaaaccaatacaatcatagatgtccaaata

agcacaccacgcccagtcaaattacttagaggccatactcttgtcctcaattgtactgctaccactcccttg

aacacgagagttcaaatgacctggagttaccctgatgaaaaaaataagagagcttccgtaaggcgacga

attgaccaaagcaattcccatgccaacatattctacagtgttcttactattgacaaaatgcagaacaaagac

aaaggactttatacttgtcgtgtaaggagtggaccatcattcaaatctgttaacacctcagtgcatatatatg

ataaagcattcatcactgtgaaacattaaggattc

With Bgl II digested plasmid pCA13-sFLT-1, reclaim the fragment of 1583bp, this fragment comprises hCMV promoter, human sFLT-1 gene and SV40 polyA tail.Then this expression cassette is cloned the pZD55 plasmid of Bgl II single endonuclease digestion into and dephosphorization, be built into plasmid pZD55-sFLT-1.

The plasmid that makes up with similar approach also has pZD55-Trail, pZD55-TK, pZD55-CD, pZD55-IL12, pZD55-Smac, pZD55-IFN β, pZD55-Endostatin, pZD55-Angiostatin and derivant thereof or the like.

The recombination virus formulation of the adenovirus of EXAMPLE III .E1b 55Kda gene delection:

293 cell strains are purchased in Canadian Microbix Biosystem Inc. (Toronto), are to transform the human embryonic kidney cell by the 5 type adenovirus DNAs of shearing to form.It contains and expresses the E1 district of 5 type adenoviruss, and adenovirus DNA has high transfection efficiency to it.We are with any pZD55-gene (it contains the left arm sequence with the adenovirus homologous recombination) and the plasmid pBHGE3 that contains the adenovirus right arm, with the two cotransfection to 293 cell strain, its concrete grammar is referring to the operating instruction of Qigen company by Effectene.The PBHG-E3 plasmid is purchased in Canadian Microbix Biosystem Inc. (Toronto), contains the right arm of 5 type adenoviruss, and contains other gene of exhausted major part of E3 district and gland-containing virus.Behind pZD55-gene and pBHGE3 cotransfection 293 cells, virus plaque appearred in 10-14 days, through 2 virus plaque purification, increase, extract the DNA of recombinant adenovirus, carry out the DNA restriction analysis, pcr analysis, determine the adenopathy strain that reorganization is correct, promptly obtain 55Kda gene delection and insert the adenovirus of destination gene expression frame, called after Ad5-ZD55-gene (abbreviating ZD55-gene sometimes as).

With the sFLT-1 gene is example, with plasmid pZD55-sFLT1 and pBHGE3 cotransfection 293 cells, chooses virus plaque after 10-14 days, and through 2 virus plaque purification, viral DNA is extracted in amplification in a small amount.PCR identifies the recombinant adenovirus strain, identifies used primer:

Primer 7:5 ' Aga gcc cat gga acc cga ga 3 ' (with Ad5 bp 2200-2219 pairing)

Primer 8:5 ' Cat cgt acc tca gca cct tcca 3 ' (with Ad5 bp 3353-3332 pairing)

Primer 9:5 ' Tcc gac tgt ggt tgc ttc atg 3 ' (with Ad5 bp 2999-3019 pairing)

With the viral DNA is template, and primer 7 carries out the PCR reaction with primer 8, amplifies the fragment of 1840bp, and is template with wild-type virus DNA, can amplify the fragment of 1153bp.With the viral DNA is template, and primer 9 carries out the PCR reaction with primer 8, can not amplify dna fragmentation, and is template with wild-type virus DNA, can amplify the fragment of 354bp.The adenovirus clone that PCR reaction proof is chosen is correct, has removed E1b 55Kda gene, and has added sFLT-1 expression of gene frame.With this E1b 55Kda gene delection and insert the adenovirus of sFLT-1 gene expression frame, called after Ad5-ZD55-sFLT-1.Ad5-ZD55-sFLT-1 is 5 type adenoviruss, the E1b 55Kda gene of adenovirus lacks (bp2269-bp3327 disappearance), added the SV40polyA tail in E1b 19Kda protein gene back, SV40polyA tail back has added a Bgl II site, and has inserted the gene expression frame that contains the CMV promoter, contains people sFLT-1 gene and SV40polyA tail in this restriction enzyme site.Other DNA sequence of virus are identical with 5 type adenoviruss.

Adenovirus Ad5-ZD55-sFLT-1 is breeding in a large number in 293 cells, uses the caesium chloride density gradient centrifugation purification of adenoviral.Concrete operation method is seen the operating instruction of Microbix Biosystem Inc. (Toronto).

The recombinant adenovirus that makes up with similar approach also has Ad5-ZD55-Trail, Ad5-ZD55-TK, and Ad5-ZD55-CD, Ad5-ZD55-IL 12, Ad5-ZD55-Smac, Ad5-ZD55-Endostatin, Ad5-ZD55-Angiostatin and derivant thereof etc.

EXAMPLE IV. detect recombinant adenovirus in external kill capability to tumor cell

With Ad5-ZD55-sFLT-1 is example.With Ad5-ZD55-sFLT-1, ONYX-015, wild type 5 type adenovirus Ad5 difference viral infection 293 cells, hepatoma cell strain Hep3B cell, colorectal cancer cells strain SW620 and normal human embryonic lung cell.Cell is by 2 * 10 ⁵6 orifice plates are inoculated in/hole, infect respectively Ad5-ZD55-sFLT-1, ONYX-015, Ad5 each 1 * 10 ⁵Pfu collects whole cell culture fluid after 48 hours, measure its virus titer with 293 cell strains after 3 freeze thawing.Concrete grammar is referring to the operating instruction of Microbix Biosystem Inc. (Toronto).The result is:

	293	Hep3B	SW620	The normal chick embryo pneumonocyte
	293	Hep3B	SW620	The normal chick embryo pneumonocyte	Ad5 ONYX-015 Ad5-ZD55-sFLT-1	1×10 ⁵ 1×10 ⁵ 1×10 ⁵	1×10 ⁵ 8×10 ⁴ 8×10 ⁴	2×10 ⁵ 6×10 ⁴ 7×10 ⁴	5×10 ⁴ ＜1×10 ¹ ＜1×10 ¹

Proof Ad5-ZD55-sFLT-1 can specificly duplicate in tumor cell and (reaches 8 * 10 ⁴), and in normal cell, do not duplicate (only 1 * 10 ¹).The adenovirus of the E1b 55Kda gene delection of the expression antioncogene that makes up can specificly duplicate in tumor cell and breed, and the kill tumor cell.

EXAMPLE V. detect the ability of recombination virus at the vivoexpression antioncogene

Ability and expression for the gland virus expression antioncogene of identifying E1b55Kda gene delection, with above-mentioned similar method, make up luciferase gene virus of A d5-ZD55-Luciferase, and made up the adenovirus Ad5-CA13-Luciferase that can not in tumor, duplicate of E1 district disappearance.The Luciferase gene is a luciferase reporter gene, purchases the company in Promega.The quantitative measurement of luciferase gene is with reference to the product description of Promega company.

Ad5-ZD55-Luciferase, Ad5-CA13-Luciferase are infected hepatoma cell strain Hep3B cell respectively, colorectal cancer cells strain SW620, breast carcinoma cell strain Bcap-37 and normal human embryonic lung cell.In 24 plates, by every hole inoculation 2 * 10 ⁴Pfu virus infects Ad5-ZD55-Luciferase, Ad5-CA13-Luciferase 1 * 10 respectively ²Pfu, collecting cell after 24 hours, 48 hours, 72 hours, 96 hours behind the cell lysis, is surveyed the intensity of luciferase.After the result shows 24 hours, Ad5-ZD55-Luciferase is identical with Ad5-CA13-Luciferase, after 48 hours, 72 hours, 96 hours in Hep3B, SW620, Bcap-37 cell, Ad5-ZD55-Luciferase is much higher than Ad5-CA13-Luciferase, and does not have significant difference at normal human embryonic lung cell Ad5-ZD55-Luciferase and Ad5-CA13-Luciferase.Infect cancerous cell, the peak value of Ad5-ZD55-Luciferase was at 96 hours, and it is long that prolongation in time forms multiplication.And the peak value of Ad5-CA13-Luciferase is at 48 hours, and expression begins to descend after 48 hours.

Experiment shows that the Ad5-ZD55 carrier can expression alien gene, and along with the duplicating, breeding of carrier, gene expression amount improves.Compare the expression of raising gene in tumor cell that the Ad5-ZD55 carrier can thousandfold with the adenovirus vector Ad5-CA13 that can not breed.

Example VI. recombinant adenovirus is in nude mouse internal therapy tumor cell transplantation tumor

With the 4-5 nude mice subcutaneous vaccination breast carcinoma cell strain Bcap-37 in age in week, laggard action thing grouping in 12 days.The treatment group gives 1 * 10 ⁹The gene viruses Ad5-Zd55-sFLT-1 of pfu treats, contrast divides 3 groups: 1 group is the PBS processed group, 2 groups of ONYX-015 viruses with same dose, 3 groups of virus of A d5-CA13-sFLT-1 with the non-propagation of same dose, result of the test shows effectively kill tumor cell of Ad5-ZD55-sFLT-1, therapeutic effect is better than ONYX-015, and is better than Ad5-CA13-sFLT-1.

Above result fully proves the synergism that can be realized gene therapy effect and viral therapy by the tumour-specific replicative adenovirus Ad5-ZD55-gene that carries antioncogene of pZD55 plasmid construction, and its therapeutic effect is all better than simple applying gene treatment or viral therapy effect.Treat tumor with Ad5-pZD55-Trail, preliminary observation, effect is more obvious.

Claims

1, a kind of preparation method of anti cancer target gene viruses medicine is characterized in that this method comprises the following steps:

I: the construction method of the adenovirus of the tumour-specific propagation of expressing tumor therapeutic gene, it is characterized in that: (1) uses the fixed point PCR method, make the 2269-3327bp disappearance of adenovirus, behind E1B 19Kda gene, added SV40 polyA tail, at the single endonuclease digestion site Bgl II of SV40 polyA tail adding; (2) antioncogene is cloned the into multiple clone site of plasmid pCA13, go out the expression cassette of therapeutic gene with Bgl II enzyme action, it comprises HCMV promoter, antioncogene, SV40 poly A tail, inserts in the adenovirus vector of reincarnate; (3) adenovirus vector of the antioncogene of reincarnate and the big plasmid pBHGE3 of gland-containing virus or pBHG10 transfection HEK-293 cell are built up the treatment recombinant adenovirus; (4) recombinant adenovirus used of separate therapy;

II: the recombinant adenovirus that step I is made prepares medicine according to a conventional method.

2, the preparation method of a kind of anti cancer target gene viruses medicine according to claim 1 is characterized in that the antioncogene of the adenovirus insertion of wherein said tumour-specific propagation is reporter gene GFP, EGFP, Luciferase product.

3, the preparation method of a kind of anti cancer target gene viruses medicine according to claim 1 is characterized in that the antioncogene of the adenovirus insertion of wherein said tumour-specific propagation is antioncogene p53, p21, RB, NF1, VHL, APC product.

4, the preparation method of a kind of anti cancer target gene viruses medicine according to claim 1 is characterized in that the antioncogene of the adenovirus insertion of wherein said tumour-specific propagation is suicide gene CD, TK product.

5, the preparation method of a kind of anti cancer target gene viruses medicine according to claim 1 is characterized in that the antioncogene of the adenovirus insertion of wherein said tumour-specific propagation is antitumaous effect very strong gene Trail, Blys, Smac product.

6, the preparation method of a kind of anti cancer target gene viruses medicine according to claim 1 is characterized in that the antioncogene of the adenovirus insertion of wherein said tumour-specific propagation is cytokine IL-12, IL-2, IFN, GM-CSF.

7, the preparation method of a kind of anti cancer target gene viruses medicine according to claim 1 is characterized in that the antioncogene of the adenovirus insertion of wherein said tumour-specific propagation is apoptosis gene ICE, caspase-3, caspase-8, caspase-9, Bax product.

8, the preparation method of a kind of anti cancer target gene viruses medicine according to claim 1, the antioncogene that it is characterized in that the adenovirus insertion of wherein said tumour-specific propagation is angiogenesis suppressor gene sflt-1, Angiostatin, Endostatin, TIMP-4, PAI product.

9, a kind of pharmaceutical composition contains the recombinant adenovirus that with good grounds claim 1 method makes up.