CN1451763A - Method for hybrid detecting nucleic acid complex point of shrimp viral - Google Patents
Method for hybrid detecting nucleic acid complex point of shrimp viral Download PDFInfo
- Publication number
- CN1451763A CN1451763A CN 03119088 CN03119088A CN1451763A CN 1451763 A CN1451763 A CN 1451763A CN 03119088 CN03119088 CN 03119088 CN 03119088 A CN03119088 A CN 03119088A CN 1451763 A CN1451763 A CN 1451763A
- Authority
- CN
- China
- Prior art keywords
- hybridization
- hybond membrane
- probe
- nucleic acid
- add
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A method for detecting the virus of prawn by nucleic acid hybridization includes preparing probes, treating specimen, pre-hybridizing, hybridizing, washing, closing, antibody-antigen reaction, washing, two-step color development reaction, and terminating reaction. It can detect two kinds of virus at same time. Its advantages are high sensitivity and low cost.
Description
Technical field
The invention belongs to shrimps disease detection technique field, be specifically related to the method that a kind of prawn ' s virus nucleic acid spot hybridization detects, be applicable to the diagnosis of prawn white spot syndrome and Tuo La syndromes cause of disease.
Background technology
Prawn (Penaeus) white spot syndrome virus (White Spot Syndrome Virus, WSSV) at first find at TaiWan, China the nineties, be one of main virus causing disease that causes in the prawn culturing serious financial loss, can infect most prawn kinds, lethality rate is up to 90-100%.Cardinal symptom is that the prawn body colour is rubescent, and white dot appears in subcutaneous, crust and appendage.Can also infect other crustacean of fresh water and seawater.Syndrome virus is drawn in holder, and (Taura Syndrome Virus TSV) at first found in Penaeus vannamei (Penaeus vannamei) body in 1992, and the cumulative mortality that the young shrimp of infection breed Penaeus vannamei, young shrimp and juvenile prawn cause is at 40-90%.The main prawn kind that infects western hemisphere breed, morbidity prawn afterbody and appendage is rubescent, crust is softening, features such as black splotch appear in horny layer of epidermis, pathological symptom shows as position horny layer of epidermis, subcutis necrosis such as the disease shrimp gill, appendage, body surface, back stomach, karyopyknosisization.Two kinds of cause of diseases all are listed in the disease that need are declared to OIE.The detection method of these two kinds of viruses, bibliographical information dot blot, polymerase chain reaction (PCR), in situ hybridization etc. are arranged respectively; The compound detection of these two kinds of viruses has round pcr (Anil et al., 2002, Hasson et al., 1997, Kiatpathomchai et al., 2001, Liu et al., 2002, Tsai et al., 2002, Zhang et al., 2001).The patent Query Result shows have the PCR of white spot syndrome virus to detect patent, still unmatchful prawn disease poison compound detection technology patent.
Reference:
1.Anil，T.M.，Shankar，K.M.&?Mohan，C.V.(2002).Monoclonal?antibodies?developed?forsensitive?detection?and?comparison?of?white?spot?syndrome?virus?isolates?in?India.?Dis?AquatOrgan?51，67-75.
2.Hasson，K.W.，Hasson，J.，Aubert，H.et?al.(1997).A?new?RNA-friendly?fixative?for?thepreservation?of?penaeid?shrimp?samples?for?virological?detection?using?cDNA?genomicprobes.J?Virol?Methods?66，227-36.
3.Kiatpathomchai，W.，Boonsaeng，V.，Tassanakajon，A.，et?al.(2001).?A?non-stop，single-tube，semi-nested?PCR?technique?for?grading?the?severity?of?white?spot?syndrome?virus?infectionsin?Penaeus?monodon.Dis?Aquat?Organ?47，235-9.
4.Liu，W.，Wang，Y.T.，Tian，D.S.，et?al.(2002).Detection?of?white?spot?syndrome?virus(WSSV)of?shrimp?by?means?of?monoclonal?antibodies(MAbs)specific?to?an?envelopeprotein(28kDa).?Dis?Aquat?Organ?49，11-8.
5.Tsai，J.M.，Shiau，L.J.，Lee，H.H.，et?al.(2002).Simultaneous?detection?of?white?spotsyndrome?virus(WSSV)and?Taura?syndrome?virus(TSV)by?multiplex?reversetranscription-polymerase?chain?reaction(RT-PCR)in?pacific?white?shrimp?Penaeusvannamei.Dis?Aquat?Organ?50，9-12.
6.Zhang，X.，Xu，L.&Xu，X.(2001).Detection?of?prawn?white?spot?bacilliform?virus?byimmunoassay?with?recombinant?antigen.J?Virol?Methods?92，193-7.
7.Lo, C.F., Ho, C.H., Peng, S. E.et al.White spot syndrome baculovirus (WSBV) detected incultured and captured shrimp, crabs and other arthropods..Dis.Aquat.Org., 1996,27:215-225. document 1,3,4,6,7th, the immunity of relevant white spot syndrome virus (WSSV) and PCR detection technique; Document 2 is in situ hybridization detection techniques that virus is drawn in the prawn holder; Document 5 is composite PCR detection techniques of these two kinds of viruses.Immunoassay technology is easy and simple to handle, quick, but at the bottom of the sensitivity.The PCR detection technique is a kind of detection method of sensitive, could improve its sensitivity but need do to handle early stage to sample.In situ hybridization is highly sensitive, but the schedule of operation complexity is fit to location in the viral cell.
Summary of the invention
The method that the object of the present invention is to provide a kind of prawn ' s virus nucleic acid spot hybridization to detect.Complete sequence according to prawn white spot syndrome and Tuo La syndrome virus gene, preparation is marked with the specific nucleic acid probe of digoxin (Digoxigenin) and vitamin H (biotin), method with dot blot, infection state to prawn white spot syndrome and Tuo La syndrome virus detects. and this method is easy and simple to handle, highly sensitive, as to be fit to a large amount of samples detection is suitable for diagnosis and close shrimp, seedling and the health monitoring that becomes shrimp of above two kinds of virus causing diseases.
In order to reach above purpose, the present invention takes following technical scheme:
(1) preparation test kit: test kit contains the neccessary composition in all trace routines, the nucleic acid probe, sample preparation liquid, the hybridization solution that comprise two kinds of virus-specifics, confining liquid, anti digoxin antibody, anti-biotin antibodies, washings, developer, judging criterion, positive control, negative control, 1.5ml centrifuge tube, Hybond membrane, hybridization bag, grinding spillikin.
(2) set up best hybridization system.Comprise the tissue position of drawing materials, best concentration and probe concentration, hybridization temperature, hybridization solution system.
(3) set up best detection architecture.Comprise the selection of chromogenic substrate, colour developing order and developing time definite.
Technical difficult points of the present invention:
(1) preparation of specificity virus nucleic acid probe.
Polymerase chain reaction,PCR amplification (PCR) method.The preparation of digoxigenin-probe: in 100 μ l reaction volumes, add 10 μ l 10x damping fluids, 7 μ l 25mM magnesium chlorides, 10 μ l digoxin nucleic acid mixtures, upstream and downstream special primer (the upstream primer ACCACAATGACCGTAAGG of 2 μ l, 10 μ M; Downstream primer TGTACCTACAAGAGTGATTGG), the high temperature resistant Ribonucleotide polysaccharase of 1 μ l (Tag archaeal dna polymerase), 1 μ l contain the plasmid DNA (10-50ng) of white spot syndrome virus genomic fragment.The preparation of biotinylated probes: in 100 μ l reaction volumes, add 10 μ l 10x damping fluids, 7 μ l 25mM magnesium chlorides, 10 μ l biotin labeling nucleic acid mixtures, the upstream and downstream special primer of 2 μ l, 10 μ M (upstream primer: AAC GCGCAT TGC TTC TTT T; Downstream primer: TCC TCC ACT GGT TGT TGT AT), the high temperature resistant Ribonucleotide polysaccharase of 1 μ l (Tag archaeal dna polymerase), 1 μ l contain the plasmid DNA (10-50ng) that syndrome virus genome (cDNA) drawn in holder.After PCR finishes, in the PCR product, add the dehydrated alcohol precipitation and the dry DNA of 10 μ l 4M lithium chlorides and 2 times of volumes, be dissolved in then in the sterile distilled water of 50 μ l.
Random primering.Purified virus genomic library cloned sequence, put into the aseptic deionized water of 16 microlitres, add 4 microlitre digoxin immediately the primer mark mixture (contain 1mM dATP, dCTP and dGTP, 0.65mMdTTP, 0.35mM the dUTP of digoxigenin labeled, 6 oligonucleotide mixtures, the Klenow enzyme of 1 unit of every microlitre), hatched 12-20 hour at 37 ℃, add the dehydrated alcohol precipitation and the dry DNA of 2 μ l 4M lithium chlorides and 2 times of volumes then, be dissolved in then in the sterile distilled water of 50 μ l.
(2) tissue sample is handled.(whole seedling or become appendage, the gill of shrimp) puts into the centrifuge tube of 1.5ml, adds sample preparation liquid (1: 1 weight/volume), grinds until organizing and ground with grinding spillikin.Get supernatant 1 μ l after 3000g is centrifugal by dilution in 1: 10, handle 10min and rapid the placement on ice for 95 ℃, point is on positively charged nylon membrane, and ultraviolet lamp is handled 3min down.
(3) optimization of dot blot program.At first be concentration and probe concentration and probe determination of ratio, suitable concentration and probe concentration is the 30-50ng/ml hybridization solution, and the ratio of digoxin and biotinylated probes is l: 1; Next is the selection of hybridization solution, and hybridization solution adopts 50% methane amide, 5x SSC, 1% confining liquid, 0.2% sodium lauryl sulphate (SDS), 0.1% sodium lauroyl sareosine; Be the selection of hybridization temperature once more, according to hybridization solution composition and viral nucleic acid character, 42 ℃ is best hybridization temperature.
(4) determining of color development system: at first select corresponding antibody: anti-digoxin alkaline phosphatase (AP) and streptavidin horseradish peroxidase (HRP-POD); Select different reaction substrates according to different antibody, selective chlorination nitro blue tetrazolium salt and 5-bromo-4 chloro-3 indoles phosphoric acid salt (NBT/BCIP) are as the reaction substrate of anti-digoxin alkaline phosphatase respectively, and diamino connects phenylamino (DAB) as streptavidin horseradish peroxidase chromogenic substrate.Again according to the depth of color and the order of viral nucleic acid character decision colour developing, earlier with DAB colour developing 30-60min.After the termination reaction again with NBT/BCIP colour developing 30-120min.
The present invention compared with prior art has following advantage: can detect two kinds of viruses simultaneously in same system; Highly sensitive, can detect the purified virus nucleic acid that is less than 100pg; Sample preparation is simple; Testing process does not need the instrument of special expensive; Cost is low; Can detect a plurality of samples simultaneously; Simple to operate being convenient to promoted.
Embodiment
Concrete steps are as follows:
(1) preparation test kit: test kit contains the neccessary composition in all trace routines, comprise viral nucleic acid probe, sample preparation liquid, hybridization solution, confining liquid, anti digoxin antibody, anti-biotin antibodies, washings, developer, positive control, negative control, 1.5ml centrifuge tube, Hybond membrane, hybridization bag, grinding spillikin.
(2) preparation of probe: the conventional PCR method of the preparation of digoxigenin-probe and biotinylated probes, with digoxin and vitamin H on the PCR product difference mark.The amplimer design is from the sequence of prawn white spot syndrome probe and the sequence of Tuo La syndrome virus probe, and amplification template is from viral nucleic acid.
(3) sample preparation: take by weighing sample (seedling whole or become the gill of shrimp), put into the centrifuge tube of 1.5ml, add sample preparation liquid (1: 1 weight/volume), sample preparation liquid is the damping fluid that diethylpyrocarbonate is handled, buffer formulation 0.03M Trisaminomethane-hydrochloric acid (Tris-HCl), pH7.5,0.04M magnesium acetate (MgAC), 1.0%NP-40% (V/V).Ground until tissue with the grinding of grinding spillikin,, got supernatant behind the low-speed centrifugal (3000g), use the TN damping fluid to press dilution in 1: 10, handled the also rapid placement of 10min on ice for 95 ℃ with 5M sodium acetate accent pH to 7.5.The TN buffer formulation is 0.05M Trisaminomethane-hydrochloric acid (Tris-HCl pH7.6), 0.4M sodium-chlor (Nacl).Get different dilution dot blot sample 1 μ l, point is on positively charged nylon membrane, and ultraviolet lamp is handled 3min down.
(4) prehybridization and hybridization: Hybond membrane is put into hybridization bag, adding prehybridization solution makes Hybond membrane be covered by solution, the prehybridization solution prescription is 50% methane amide, 5x SSC, 1% confining liquid, 0.2% sodium lauryl sulphate (SDS), 0.1% sodium lauroyl sareosine, sealed hybridization bag, at 42 ℃ of prehybridization 1-4 hours.With prehybridization solution dilution two kinds of probes (30-50ng/ml, 1: 1 ratio), add probe hybridization liquid in hybridization bag then, 42 ℃ of hybridization are spent the night.
(5) washing: Hybond membrane is placed in the clean plate, washs at ambient temperature 2 times with washings I, washings I prescription is: 2x SSC, 0.1%SDS, each 15min.Hybond membrane is put back in the clean hybridization bag again, added washings 68 ℃ of washings 2 times, washings is: 0.1x SSC, 0.1%SDS, each 15min.
(6) sealing: abandon washings, add damping fluid, damping fluid is: hatch 30min under 1% confining liquid, room temperature.
(7) antibody antigen reaction: dilute anti digoxin antibody (dilution in 1: 5000) and anti-biotin antibodies (1: 1000) with damping fluid, damping fluid is: 1% confining liquid, put into hybridization bag, and hatch 30min under 37 ℃.
(8) washing: take out Hybond membrane and be placed in the clean plate, with damping fluid continuous washing 2 times at room temperature, damping fluid is: 100mM toxilic acid (Maleic acid), 150mM Nacl, pH7.5 (20 ℃), each 15min.
(9) colour developing: dispose chromogenic substrate (the 1ml damping fluid adds concentrated diamino and connects aniline) with damping fluid.Damping fluid contains 0.1% H
2O
2Hybond membrane is placed in the clean hybridization bag, puts into chromogenic substrate and cover Hybond membrane, in lucifuge place colour developing (30min-1hr).The visual inspection result shows brown positive reaction.
(10) termination reaction: abandon colour developing liquid, add stop buffer.Stop buffer is: 100mM Tris-Hcl; 1mM ethylenediamine tetraacetic acid (EDTA) (EDTA); PH8.0 (20 ℃).And with a large amount of damping fluid rinsings, damping fluid is: 100mM toxilic acid (Maleicacid), 150mM Nacl, pH7.5 (20 ℃), record result.
(11) colour developing once again: dispose chromogenic substrate with damping fluid and (add 10ul chlorination nitro blue tetrazolium salt (NBT) and 7ul 5-bromo-4 chloro-3 indoles phosphoric acid salt (BCIP) in the 2ml damping fluid.Damping fluid is: 100mMTris-HCl, 100mM NaCl, 50mM MgCl
2, pH9.5 is placed on Hybond membrane in the clean hybridization bag, puts into chromogenic substrate and covers Hybond membrane, lucifuge colour developing (30min-2hr).The visual inspection result, only infecting WSSV is bluish voilet, the positive findings that infects two kinds of viruses simultaneously is brown and hepatic stack.
(12) termination reaction: abandon colour developing liquid, add stop buffer.Stop buffer is: 100 mM Tris-Hcl; 1mM ethylenediamine tetraacetic acid (EDTA) (EDTA), pH9.5 (20 ℃).The record result.Hybond membrane is can prolonged preservation colour-fast in containing the sealing bag of stop buffer.
＜110〉＜120〉＜160〉6＜170〉PatentIn3.1＜210〉1＜211〉2245＜212〉DNA＜213〉 ( White Spot Syndrome Virus )＜400〉1taaactgact gatattgctt tccttgcccg tgaaaaatca cgtgtcgagg gttcgagatt 60ctacaacgat atgaagattg gacctataac agcctacaaa ttgaatttga tgtgtaataa 120attcatagag tctgttgtgc aaaaggtgaa ggcagaaata tccccatttg ttgaagttag 180tgtatcaagt gaacttgaag ggtcaccttt ttgggatttc aagcaaagaa tagtaaaaca 240cacctagaat attgtaccat ttttatgttg ttgaataacc ctttatcggg caagagttga 300tataccacaa tgaccgtaag gtcgaaaata gcatacttct catccttcag ggctacgcca 360ctatttcact agtgacacga gttttttaca tcctattctc aggcaactcg aataaagtga 420tacttcaacg gcatcttgtc tttcttttcc attaactttt tatcccaaaa ccctagaaat 480ttatgaacaa tattggtgct tgcattgaag tccctgtcga cgaattttcc tcccaagaca 540catgtaatgg aagtaggagt acaaaaggaa gaggaagtgg aagaaggtac tggcgtttcc 600atagagatat ctcctgtcga tacttttcgg tttgaactgt aaccgaattg cgtcttttcg 660gacgagcatc ttctggtatc tctattttct ctgagaggtg tagccttctt ccattttcca 720ttttcttcgt cttcttctgt tgttgttgtt gttgtggttg ttactattgt cggcggtttt 780cttttcttat tcggtgaaaa acaatccttc tccagcatat ttaaaggttg attgcagcga 840tggcatactt ttgacgtata tttctcgtcc acgaaagtaa acctcttatc acctccgact 900ctttccttta tcttcttggc gaaaatcctg gcaggtgatg cgtattgctc acctcttccc 960gtgcaggcaa atttcgcatc cccaaaagca atgtggtaat cttcaatttt atccctttta 1020gggattaatt catctataaa gttagatatg cacttttgtt ttctagagta tactttcatg 1080gcatttttcc tgtacttttt ctttcccttt tcgttccaca gtaacctgta gtgctcgttc 1140actaccttca agtaagcttc gaatttttta gtgggtgtag aagtatcacc gttaccatca 1200tttataattt cttcgccatt atcgtaccta gttatttcct ctaacgcctc tttgtactct 1260ttattgttct tcttgtacgt ttcgtttgcc tttcttctat ctgtcatcca agattcttga 1320tagtattgtt tcgcagtcat tctgtgtttt ctcactaccc ttttttgacg ggtatcaaat 1380accgaacagg aaacgacatt agttcttccc ggatctacac ccactacgta cttggcatta 1440gtgggcgggt aatttctcct atcctcatct cctctaggtt ttttattttt cttacttttc 1500ttggaaacag tctctacttc ttccacttct ctggaaaata gtacagagac gccttcgccg 1560tccgtctgga tagagtgaaa gttccagttt ggacgcaatt tcttaatctt tttaacgtcg 1620aataataggt accatccttg cttgtaaagt atatcttctg attgtttgtg tcgttcttcc 1680atatccttcc acactcccaa atctttacaa attccttgaa tggtcgtttg gtcaaacgta 1740caatagtgta tctttagttt gtgttttggg acaactatca ttttctgtat tttcttgttt 1800tgtggatact ctgtttgtag aaacttgtaa taatttagta ttgagggtat cggatatttc 1860tcttcaggtg aataggaaat tgtaccattc ttcttatcac taataacaca taaatgtttc 1920ctatgaagag tcacgaaatt tttcgttcct tcttttaccc tttccaaatc accactgtcc 1980acccaatcac tcttgtaggt acatccaatt atccagtgtt gtacgagttt cgtatacttt 2040ttatcgaacc cgttttcagc taaccatcca gatatggccc tctgttgtcg tgtccggaaa 2100tgggtgcgta ggtttgtttc gaagcaagtt tttagttgtt tggcggcgta ggtgatggta 2160ttgaaatcca tgagatgtct ctttatggga ttatttcctt ctccttgctg ggataggaat 2220gtttcttgga cgatggggga attc 2244＜210〉2＜211〉468＜212〉DNA＜213〉 ( Taura Syndrome Virus )＜400〉1aacgcgcatt gcttcttttg aggcttcgct gcatgagaag ggttatttct taatgttctg 60cgatgtcatt aagatagcgt gtaggaacgc agggtacaag gaagcatgtt tacatgagtt 120ggattgtaag agcttccttt tggcccagca aggtagagct ggagctcatg atagtgagtt 180cctaagtcag ctattggact taaactaata gcaccacccg atcgtaaact ccatgtattg 240gttacccatc tgcatcgaaa actctccgaa cactaggtgc agtaaggctt tcatggagtg 300gtttgctatt tagcgtacgt gtaccatagg cagccccaaa aacacgtgtg aggagaaagt 360cccagtcact ttgggcaaag tagacagccg cgcttgcgtg gtgggactta attaatgcct 420gctaacccag ttgaaattga taattttgat acaacaacca gtggagga 468＜210〉3＜211〉18＜212〉DNA＜213〉 ( White Spot Syndrome Virus )＜400〉1accacaatga ccgtaagg 18＜210〉4＜211〉21＜212〉DNA＜213〉 ( White Spot Syndrome Virus )＜400〉1tgtacctaca agagtgattg g 21＜210〉5＜211〉19＜212〉DNA＜213〉 ( Taura Syndrome Virus )＜400〉1aacgcgcatt gcttctttt 19＜210〉6＜211〉20＜212〉DNA＜213〉 ( Taura Syndrome Virus )＜400〉1tcctccactg gttgttgtat 20
Claims (3)
1, a kind of method of prawn ' s virus nucleic acid spot hybridization detection comprises the following steps:
(1) preparation test kit: comprise viral nucleic acid probe, sample preparation liquid, hybridization solution, confining liquid, anti digoxin antibody, washings, developer, positive control, negative control, 1.5ml centrifuge tube, Hybond membrane, hybridization bag, grinding spillikin;
(2) preparation of probe: the conventional PCR method of the preparation of digoxigenin-probe and biotinylated probes, with digoxin and vitamin H on the PCR product difference mark, the amplimer design is from the sequence of prawn white spot syndrome probe and the sequence of Tuo La syndrome virus probe, and amplification template is from viral nucleic acid;
(3) sample preparation: take by weighing sample, put into the centrifuge tube of 1.5ml, add sample preparation liquid, ground until tissue with grinding the spillikin grinding, transferred pH to 7.5, got supernatant behind the low-speed centrifugal,, handle 10min for 95 ℃ and also place on ice by dilution in 1: 10 with the TN damping fluid;
(4) prehybridization and hybridization: Hybond membrane is put into hybridization bag, add prehybridization solution Hybond membrane is covered by solution, sealed hybridization bag, at 42 ℃ of prehybridization 1-4 hours, add probe hybridization liquid then in the hybridization bag, 42 ℃ of hybridization are spent the night;
(5) washing: Hybond membrane is placed in the clean plate, washs at ambient temperature 2 times, Hybond membrane is put back in the clean hybridization bag again, add washings 68 ℃ of washings 2 times, each 15min with washings;
(6) sealing: abandon washings, add 1% confining liquid, hatch 30min under the room temperature;
(7) antibody antigen reaction: with damping fluid dilution anti digoxin antibody and biotin antibody, put into hybridization bag, hatch 30min under 37 ℃;
(8) washing: take out Hybond membrane and be placed in the clean plate, with damping fluid continuous washing 2 times at room temperature;
(9) colour developing: dispose chromogenic substrate with damping fluid, Hybond membrane is placed in the clean hybridization bag, put into chromogenic substrate and cover Hybond membrane, in the colour developing of lucifuge place, the visual inspection result shows brown positive reaction;
(10) termination reaction: abandon colour developing liquid, add stop buffer, and with the damping fluid rinsing, the record result;
(11) colour developing once again: dispose chromogenic substrate with damping fluid, Hybond membrane is placed in the clean hybridization bag, put into chromogenic substrate and cover Hybond membrane, the lucifuge colour developing, the visual inspection result, only infecting WSSV is bluish voilet, the positive findings that infects two kinds of viruses simultaneously is brown and hepatic stack;
(12) termination reaction: abandon colour developing liquid, add stop buffer, the record result.
2, the method for a kind of prawn ' s virus nucleic acid spot hybridization detection according to claim 1 is characterized in that the prawn white spot syndrome probe sequence is:
taaactgact?gatattgctt?tccttgcccg?tgaaaaatca?cgtgtcgagg?gttcgagatt 60
ctacaacgat?atgaagattg?gacctataac?agcctacaaa?ttgaatttga?tgtgtaataa 120
attcatagag?tctgttgtgc?aaaaggtgaa?ggcagaaata?tccccatttg?ttgaagttag 180
tgtatcaagt?gaacttgaag?ggtcaccttt?ttgggatttc?aagcaaagaa?tagtaaaaca 240
cacctagaat?attgtaccat?ttttatgttg?ttgaataacc?ctttatcggg?caagagttga 300
tataccacaa?tgaccgtaag?gtcgaaaata?gcatacttct?catccttcag?ggctacgcca 360ctatttcact?agtgacacga?gttttttaca?tcctattctc?aggcaactcg?aataaagtga 420tacttcaacg?gcatcttgtc?tttcttttcc?attaactttt?tatcccaaaa?ccctagaaat 480ttatgaacaa?tattggtgct?tgcattgaag?tccctgtcga?cgaattttcc?tcccaagaca 540catgtaatgg?aagtaggagt?acaaaaggaa?gaggaagtgg?aagaaggtac?tggcgtttcc 600atagagatat?ctcctgtcga?tacttttcgg?tttgaactgt?aaccgaattg?cgtcttttcg 660gacgagcatc?ttctggtatc?tctattttct?ctgagaggtg?tagccttctt?ccattttcca 720ttttcttcgt?cttcttctgt?tgttgttgtt?gttgtggttg?ttactattgt?cggcggtttt 780cttttcttat?tcggtgaaaa?acaatccttc?tccagcatat?ttaaaggttg?attgcagcga 840tggcatactt?ttgacgtata?tttctcgtcc?acgaaagtaa?acctcttatc?acctccgact 900ctttccttta?tcttcttggc?gaaaatcctg?gcaggtgatg?cgtattgctc?acctcttccc 960gtgcaggcaa?atttcgcatc?cccaaaagca?atgtggtaat?cttcaatttt?atccctttta 1020gggattaatt?catctataaa?gttagatatg?cacttttgtt?ttctagagta?tactttcatg 1080gcatttttcc?tgtacttttt?ctttcccttt?tcgttccaca?gtaacctgta?gtgctcgttc 1140actaccttca?agtaagcttc?gaatttttta?gtgggtgtag?aagtatcacc?gttaccatca 1200tttataattt?cttcgccatt?atcgtaccta?gttatttcct?ctaacgcctc?tttgtactct 1260ttattgttct?tcttgtacgt?ttcgtttgcc?tttcttctat?ctgtcatcca?agattcttga 1320tagtattgtt?tcgcagtcat?tctgtgtttt?ctcactaccc?ttttttgacg?ggtatcaaat 1380accgaacagg?aaacgacatt?agttcttccc?ggatctacac?ccactacgta?cttggcatta 1440gtgggcgggt?aatttctcct?atcctcatct?cctctaggtt?ttttattttt?cttacttttc 1500ttggaaacag?tctctacttc?ttccacttct?ctggaaaata?gtacagagac?gccttcgccg 1560tccgtctgga?tagagtgaaa?gttccagttt?ggacgcaatt?tcttaatctt?tttaacgtcg 1620aataataggt?accatccttg?cttgtaaagt?atatcttctg?attgtttgtg?tcgttcttcc 1680atatccttcc?acactcccaa?atctttacaa?attccttgaa?tggtcgtttg?gtcaaacgta 1740caatagtgta?tctttagttt?gtgttttggg?acaactatca?ttttctgtat?tttcttgttt 1800tgtggatact?ctgtttgtag?aaacttgtaa?taatttagta?ttgagggtat?cggatatttc 1860tcttcaggtg?aataggaaat?tgtaccattc?ttcttatcac?taataacaca?taaatgtttc 1920ctatgaagag?tcacgaaatt?tttcgttcct?tcttttaccc?tttccaaatc?accactgtcc 1980acccaatcac?tcttgtaggt?acatccaatt?atccagtgtt?gtacgagttt?cgtatacttt 2040ttatcgaacc?cgttttcagc?taaccatcca?gatatggccc?tctgttgtcg?tgtccggaaa 2100tgggtgcgta?ggtttgtttc?gaagcaagtt?tttagttgtt?tggcggcgta?ggtgatggta 2160ttgaaatcca?tgagatgtct?ctttatggga?ttatttcctt?ctccttgctg?ggataggaat 2220gtttcttgga?cgatggggga?attc 2244
3、1,：aacgcgcatt gcttcttttg aggcttcgct gcatgagaag ggttatttct taatgttctg 60cgatgtcatt aagatagcgt gtaggaacgc agggtacaag gaagcatgtt tacatgagtt 120ggattgtaag agcttccttt tggcccagca aggtagagct ggagctcatg atagtgagtt 180cctaagtcag ctattggact taaactaata gcaccacccg atcgtaaact ccatgtattg 240gttacccatc tgcatcgaaa actctccgaa cactaggtgc agtaaggctt tcatggagtg 300gtttgctatt tagcgtacgt gtaccatagg cagccccaaa aacacgtgtg aggagaaagt 360cccagtcact ttgggcaaag tagacagccg cgcttgcgtg gtgggactta attaatgcct 420gctaacccag ttgaaattga taattttgat acaacaacca gtggagga 468
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03119088 CN1197977C (en) | 2003-05-19 | 2003-05-19 | Method for hybrid detecting nucleic acid complex point of shrimp viral |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03119088 CN1197977C (en) | 2003-05-19 | 2003-05-19 | Method for hybrid detecting nucleic acid complex point of shrimp viral |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1451763A true CN1451763A (en) | 2003-10-29 |
| CN1197977C CN1197977C (en) | 2005-04-20 |
Family
ID=29222842
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 03119088 Expired - Fee Related CN1197977C (en) | 2003-05-19 | 2003-05-19 | Method for hybrid detecting nucleic acid complex point of shrimp viral |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1197977C (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100402668C (en) * | 2006-10-19 | 2008-07-16 | 天津市水产研究所 | Primer sequence and detecting reagent kit for detecting prawn white spot syndrome virus |
| CN102823525A (en) * | 2012-08-21 | 2012-12-19 | 江苏省海洋水产研究所 | Ecological healthy culture method of Palaemon carinicauda |
| CN107523611A (en) * | 2016-06-22 | 2017-12-29 | 南京大学 | A kind of non-amplification type nucleic acid hybrid capture system and its application in detection of nucleic acids |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101372714B (en) * | 2008-09-07 | 2010-11-10 | 中国水产科学研究院黄海水产研究所 | Prawn white spot syndrome virus nucleic acid isothermal amplification detection reagent kit and detecting method |
-
2003
- 2003-05-19 CN CN 03119088 patent/CN1197977C/en not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100402668C (en) * | 2006-10-19 | 2008-07-16 | 天津市水产研究所 | Primer sequence and detecting reagent kit for detecting prawn white spot syndrome virus |
| CN102823525A (en) * | 2012-08-21 | 2012-12-19 | 江苏省海洋水产研究所 | Ecological healthy culture method of Palaemon carinicauda |
| CN102823525B (en) * | 2012-08-21 | 2014-05-28 | 江苏省海洋水产研究所 | Ecological healthy culture method of Palaemon carinicauda |
| CN107523611A (en) * | 2016-06-22 | 2017-12-29 | 南京大学 | A kind of non-amplification type nucleic acid hybrid capture system and its application in detection of nucleic acids |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1197977C (en) | 2005-04-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | The genetic sequence, origin, and diagnosis of SARS-CoV-2 | |
| Martenot et al. | Comparison of two real-time PCR methods for detection of ostreid herpesvirus 1 in the Pacific oyster Crassostrea gigas | |
| Zhang et al. | Molecular detection of Diaporthe phaseolorum and Phomopsis longicolla from soybean seeds | |
| Sharifi et al. | Rapid diagnostics of coronavirus disease 2019 in early stages using nanobiosensors: challenges and opportunities | |
| Monpoeho et al. | Application of a real-time polymerase chain reaction with internal positive control for detection and quantification of enterovirus in cerebrospinal fluid | |
| Caipang et al. | Development of a real-time PCR assay for the detection and quantification of red seabream iridovirus (RSIV) | |
| ES2084167T3 (en) | DETECTION PROCEDURE OF A NUCLEOTIDIC SEQUENCE ACCORDING TO THE SANDWICH HYBRIDIZATION TECHNIQUE. | |
| WO2022095731A1 (en) | Kit and method for detecting sars-cov-2 | |
| CN102115794A (en) | Internal-reference-containing HCMV fluorescence quantitative PCR detection kit | |
| CN101550452B (en) | Human bocavirus real-time fluorescence PCR detection reagent kit | |
| CN111088401A (en) | Multi-virus detection primer and kit thereof | |
| Stevens et al. | Comparison of quantitative competitive PCR with LightCycler-based PCR for measuring Epstein-Barr virus DNA load in clinical specimens | |
| CN1451763A (en) | Method for hybrid detecting nucleic acid complex point of shrimp viral | |
| CN104388588A (en) | NASBA-ELISA (nucleic acid sequence-based amplification-enzyme-linked immuno sorbent assay) detection primer, probe and kit for type II grass carp reovirus | |
| CN1873024A (en) | Fluorescence quantitative kit PCR for quick testing fine | |
| CN103060453A (en) | Kit for detecting neisseria gonorrheae (NG) | |
| CN113801963B (en) | Primer probe combination, kit and method for detecting coronavirus | |
| CN113604609B (en) | Primer combination for detecting SARS-CoV-2 and D614G mutant strain thereof and application thereof | |
| US20220065869A1 (en) | Methods, Compositions, and Systems for Detecting Coronavirus Neutralizing Antibodies | |
| Loyprasert-Thananimit et al. | Production of a polyclonal antibody to the VP26 nucleocapsid protein of White Spot Syndrome Virus (WSSV) and its use as a biosensor | |
| KR20220166458A (en) | Kit For Diagnosing SARS-CoV-2 and Method of Detecting SARS-CoV-2 Using the Same | |
| CN101429545A (en) | Method for detecting Shigella by using suspension chip technology | |
| CN2909246Y (en) | Investigating kit of hepatitis five integral gene | |
| CN1484029A (en) | Method for detecting prawn virus by compound polymerase Chain -enzyme-linked immune reaction | |
| CN1873025A (en) | Fluorescence quantitative PCR kit for detecting eye chlamydia and Urealpasma parvum synchronistically |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |