CN1484029A - Method for detecting prawn virus by compound polymerase Chain -enzyme-linked immune reaction - Google Patents
Method for detecting prawn virus by compound polymerase Chain -enzyme-linked immune reaction Download PDFInfo
- Publication number
- CN1484029A CN1484029A CNA031252028A CN03125202A CN1484029A CN 1484029 A CN1484029 A CN 1484029A CN A031252028 A CNA031252028 A CN A031252028A CN 03125202 A CN03125202 A CN 03125202A CN 1484029 A CN1484029 A CN 1484029A
- Authority
- CN
- China
- Prior art keywords
- virus
- syndrome virus
- prawn
- reaction
- biotin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a compound polymerase chain-ELSA reaction prawn virus detecting method. Its steps: 1. design and synthesis of catch probe and amplifying primer; 2. extraction of tissue total nucleic acid; 3. labeling digoxigenin with compound polymerase chain reaction; 4. solid-phase cross; 5. enzyme linked coloration. It is adapted to diagnosis of white spot syndrome virus, taola syndrome virus and hepatopancreatic minute virus and monitoring of the health state of the prawn.
Description
Technical field
The invention belongs to shrimps disease detection technique field, more specifically relate to the method that a kind of compound polymerize chain reaction-enzyme linked immunoassay detects prawn ' s virus, be applicable to the diagnosis of shrimp white spot syndrome virus, taura syndrome virus and hepatopancreatic parvovirus cause of disease.
Background technology
(White Spot Syndrome Virus WSSV) is the main virus causing disease that causes Southeast Asia prawn culturing fulminant death the beginning of the nineties to shrimp white spot syndrome virus, can infect most prawn kinds, and fatal rate is up to 90-100%.Cardinal symptom is that the prawn body colour is rubescent, and white dot appears in subcutaneous, crust and appendage.(Zhang Jianhong etc. 1994 can also to infect other crustacean of fresh water and seawater; Takahashi et al., 1994; Lo et al., 1996; Wang et al., 1995; Corbel et al., 2001).(Taura Syndrome Virus TSV) at first found in Penaeus Vannmei (Penaeusvannamei) body in 1992 taura syndrome virus, at present the main disease of culturing for China's Penaeus Vannmei.Taura syndrome virus infects the young shrimp of prawn, young shrimp and juvenile prawn, and the cumulative mortality that causes is at 40-90%.Morbidity prawn afterbody and appendage is rubescent, crust is softening, features such as black splotch appear in horny layer of epidermis, pathological symptom shows as position horny layer of epidermis, hypodermis necrosis such as the disease shrimp gill, appendage, body surface, back stomach, karyopyknosisization (Hasson etal., 1999).The prawn hepatopancreatic parvovirus (Hepatopancreatic parvovirus HPV) find as far back as China, but its spread scope is very wide, in recent years, and in the Asia, all there is relevant report in Africa, Australia, South America with North America.The target tissue of this virus infection is prawn hepatopancrease and midgut back segment epithelial cell, is slowed down by the growth of the prawn of virus infections, and causes certain cumulative mortality (Bonami et al., 1995, Xiao Lianchun etc., 1995).These three kinds of cause of diseases all are listed in the disease that need are declared to OIE.Know to have only report (Durand et al., 1996, the Hasson et al. of single virus or two kinds of compound polymerase chain reaction,PCR detection techniques of virus from present document and patent Query Result, 1997, Lightner, 1996, Lightner etal., 1993, Nadala Jr.﹠amp; Loh, 2000, Tsai et al., 2002), do not have relevant report about shrimp white spot syndrome virus, taura syndrome virus and hepatopancreatic parvovirus compound detection technology.
List of references:
1 Xiao Lianchun stone is beautiful Gao Wei etc. (1995) just. separation purification of a kind of spherical viruses of Chinese prawn and nucleic acid-protein The Characteristic Study.China's virology, 10 (4): 356-361.
Build (1994) such as red Chen Di Hua Xiaolianchun for 2. infection and the generation in vivo of the non-inclusion body baculoviral of Chinese prawn. Chinese virology, 9 (4): 362-365.
3?Bonami，J.R.，Mari，J.，Poulos，B.T.&?Lightner，D.V.(1995).Characterization?ofhepatopancreatic?parvo-like?virus，a?second?unusual?parvovirus?pathogenic?forpenaeid?shrimps.J?Gen?Virol?76，813-7.
4?Corbel，V.，Zuprizal，Shi，Z.，Huang，C.，Arcier，J.M.&?Bonami，J.R.(2001).Experimental?infection?of?European?crustaceans?with?white?spot?syndrome?virus(WSSV).J?Fish?Diseases?24，377-382.
5?Durand，S.，Lightner，D.V.，Nunan，L.M.，Redman，R.M.，Mari，J.&Bonami，J.R.(1996).Application?of?gene?probes?as?diagnostic?toolsfor?White?Spot?Baculovirus(WSBV)of?penaeid?shrimp.Dis?Aquat?Organ27，59-66.
6?Hasson，K.W.，Lightner.D.V.，Mohney，L.L.，Redman，R.M.，Poulos，B.T.&Brenda，W.M.(1999).Taura?syndrome?Virus(TSV)lesion?development?and?thedisease?cycle?in?the?pacific?white?shrimp?Penaeus?vannmei.Dis?Aquat?Org?36，81-93.
7?Hasson，K.W.，Hasson，J.，Aubert，H.，Redman，R.M.&?Lightner，D.V.(1997).A?new?RNA-friendly?fixative?for?the?preservation?of?penaeidshrimp?samples?for?virological?detection?using?cDNA?genomic?probes.J?Virol?Methods?66，227-36.
8?Lightner，D.V.(1996).A?handbook?of?shrimp?pathology?and?diagnosticprocedures?for?di?seases?of?cultured?penaeid?shrimp.In?Specialpublica?tion?of?the?World?Aquaculture?Society.Baton?Rouge，LA.
9?Lightner，D.V.，Redman，R.M.，Moore，D.W.&?Park，M.A.(1993).Development?and?application?ot?a?simple?and?rapid?diagnostic?methodto?studies?on?hepatopancreatic?parvovirus?of?panaeid?shrimp.Aquaculture?116，15-23.
10?Lo，C.F.，Ho，C.H.，Peng，S.E.，Chen，C.H.，Hsu，H.C.，Chiu，Y.L.，Chang，C.F.，Liu，K.F.，Su，M.S.，Wang，C.H.&?Kou，G.?H.(1996).White?spot?syndromebaculovirus(WSBV)detected?in?cultured?and?captured?shrimp，crabs?and?otherarthropods.Dis?Aquat?Organ?27，215-225.
11?Nadala?Jr.，E.C.B.&?Loh，P.C.(2000).Dot-blot?nitrocel?lulose?enzymeimmunoassays?for?the?detection?of?white-spot?virus?and?yellow-headvirus?of?penaeid?shrimp.Journal?of?Virological?Methods?84，175-179.
12?Takahashi，Y.，Itami，T.，Kondo，M.，Maeda?M，Fujii，R.，Tomonaga，S.，Supamattaya，K.&?Boonyaratpalin，S.(1994).Electron?microscopy?evidence?ofbacilliform?virus?infection?in?Kuruma?shrimp(Penaeus?japonicus).FishPathology?29，121-125.
13?Tsai，J.M.，Shiau，L.J.，Lee，H.H.，Chan，P.?W.&?Lin，C.Y(2002).Simultaneousdetection?of?white?spot?syndrome?virus(WSSV)and?Taura?syndrome?virus(TSV)by?multiplex?reverse?transcription-polymerase?chain?reaction(RT-PCR)in?pacificwhite?shrimp?Penaeus?vannamei.Dis?Aquat?Organ?50，9-12.
14?Wang，C.H.，Lo，C.F.，Leu，J.H.，Chou，C.M.，Yeh，P.Y.，Chou，H.Y.，Tung，M.C.，Chang，C.F.，Su，M.S.&?Kou，G.H.(1995).Purification?and?genomicanalysis?of?baculovirus?associated?with?White?Spot?Syndrome(WSBV)ofPenaeus?monodon.Dis?Aquat?Organ?23，239-242
Document 1,3 and 10 has been reported the characteristic and the in situ hybridization detection technique thereof of hepatopancreatic parvovirus.Document 2,4,5,11,12 and 14 have reported fundamental characteristics and in situ hybridization, polymerase chain reaction,PCR and the enzyme linked immunoassay detection technique of white spot syndrome virus.Document 6,7, report be the fundamental characteristics and the detection technique thereof of taura syndrome virus.Document 8 has been reported the detection method of several main prawn ' s virus that comprise hepatopancreatic parvovirus, white spot syndrome virus, taura syndrome virus etc.Document 13 has been reported taura syndrome virus and the compound polymerase chain reaction,PCR detection technique of two kinds of viruses of white spot syndrome virus.
Summary of the invention
The object of the present invention is to provide a kind of compound polymerize chain reaction-enzyme linked immunoassay to detect the method for prawn ' s virus.To extract the total nucleic acid semifinished product of organizing is template, make capture probe by the oligonucleotides that the biotin-streptavidin bridge is fixed on 96 microwell plates, digoxin detection probe with mark behind polymerase chain reaction,PCR, reach the purpose that detects viral nucleic acid in conjunction with anti digoxin antibody and enzyme linked immunoassay, this method is easy and simple to handle, highly sensitive, be suitable for diagnosis and close shrimp, seedling and the health monitoring that becomes shrimp of prawn ' s virus cause of disease.
In order to reach above purpose, the present invention takes following technical scheme:
(1) design of specific oligonucleotide capture probe and amplimer screening.
According to the whole genome sequence of shrimp white spot syndrome virus, taura syndrome virus and hepatopancreatic parvovirus, the oligonucleotide probe and the virus nucleic acid amplification primer (seeing sequence table) of design screening virus-specific.The capture probe length of shrimp white spot syndrome virus, taura syndrome virus and hepatopancreatic parvovirus end mark biotin is 15 base-pairs, sequence respectively with the normal chain complementation of shrimp white spot syndrome virus, taura syndrome virus and hepatopancreatic parvovirus, be positioned the centre of detector probe.The amplified production probe length that detects white spot syndrome virus, hepatopancreatic parvovirus, taura syndrome virus is respectively 331 base-pairs, 194 base-pairs and 236 base-pairs.All primers are according to the peculiar genome sequence design of shrimp white spot syndrome virus, taura syndrome virus and hepatopancreatic parvovirus, and are synthetic by professional biotech firm.
(2) reverse transcription system
Organizing total nucleic acid with extraction is template, get the total nucleic acid semifinished product of 2 μ g, the taura syndrome virus downstream primer that adds 1 μ g: TTTTCGATGCAGATGGGTAAC, 70 ℃ of temperature are bathed 5min, the reverse transcription damping fluid, 5 μ ldNTP (10mM), 25 RNA of unit enzyme inhibitors and the 200 unit reverse transcriptase that add 5 μ l immediately behind the ice bath 5min successively, distilled water to the cumulative volume that replenishes the processing of coke acid tetra-ethyl ester is 25 μ l, and 42 ℃ of temperature are bathed 1h.
(3) foundation of compound polymerase chain reaction,PCR labeled reactant system.
The DNA of white spot syndrome virus, hepatopancreatic parvovirus and through the taura syndrome virus nucleic acid of reverse transcription digoxin on the mark in amplification procedure.Whole mark amplification system carries out in 50 μ l reaction systems, the reverse transcription product that contains 2 μ l is made template, one times polymerase chain reaction,PCR damping fluid, one times digoxigenin labeled dNTP potpourri, mix shrimp white spot syndrome virus in 1: 2: 2 ratio, the specific amplimer of taura syndrome virus and hepatopancreatic parvovirus (the white spot syndrome virus upstream and downstream amplimer of 30pmol: TGATTTGTTGTGCCCTTTTG, ACGTAGGGTCGATGTTGGTG, the hepatopancreatic parvovirus upstream and downstream amplimer of 60pmol: ACACAGCAATATGATCAAGAGAAA, the taura syndrome virus upstream and downstream amplimer of GCACTGGCCATCGTATCTT and 60pmol: TCGCTGCATGAGAAGGGTTAT, TTTTCGATGCAGATGGGTAAC), the Taq enzyme of 2 units.Reaction cycle is 94 ℃ of 30s, 53 ℃ of 30s, and 72 ℃ of 1min carry out 30 circulations altogether.Last 72 ℃ are extended 10min.
(4) foundation of hybridization detection architecture.
The damping fluid that the hybridization system is selected is 5x SSC, 5x Denhardt, 0.1% sodium lauroyl sarcosine, 0.02% lauryl sodium sulfate.Characteristic according to oligonucleotide probe and hybridization chain is screened 25 ℃ as hybridization temperature.The enzyme linked immunoassay detection architecture is selected phosphate buffer.
The present invention compared with prior art has following advantage: can detect shrimp white spot syndrome virus, taura syndrome virus and hepatopancreatic parvovirus simultaneously in same system; Technology is easy, and is easy to operate, highly sensitive, can detect the viral nucleic acid that is less than 0.01pg.The etiological diagnosis and close shrimp, seedling and the health monitoring that becomes shrimp that are fit to multiple virus.
Embodiment
Concrete steps are as follows:
(1) design of specific oligonucleotide probe and amplimer and screening: according to the virus genome sequence design, the sequence capture probe of shrimp white spot syndrome virus, taura syndrome virus and hepatopancreatic parvovirus end mark biotin is: biotin-ACTGTCACTGTTGCT; Biotin-AGTTAGAACGGATAG; Biotin-AGCAAGGTAGAGCTG, the upstream and downstream primer sequence of amplification white spot syndrome virus is: TGATTTGTTGTGCCCTTTTGACGTAGGGTCGATGTTGGTG; The upstream and downstream sequence of amplification hepatopancreatic parvovirus is: ACACAGCAATATGATCAAGAGAAA, GCACTGGCCATCGTATCTT; The upstream and downstream primer sequence of amplification taura syndrome virus is: TCGCTGCATGAGAAGGGTTAT, TTTTCGATGCAGATGGGTAAC.The amplified production probe length that detects white spot syndrome virus, hepatopancreatic parvovirus, taura syndrome virus is respectively 331 base-pairs, 194 base-pairs and 236 base-pairs (sequence table).All primers are synthetic by professional biotech company.
(2) the tissue total nucleic acid is extracted: total nucleic acid extracting method: get the infection white spot syndrome virus, the tissue of hepatopancreatic parvovirus and taura syndrome virus (gill and hepatopancrease) 15-20mg, seedling is then removed the individuality of eyeball, add lysate 600 μ l (100mM sodium chloride after the homogenate, the 10mM ethylenediamine tetraacetic acid, 50mMTris alkali, 0.5% lauryl sodium sulfate) and 15 μ l Proteinase Ks (20mg/ μ l), 55 ℃ of temperature are bathed 1h, 10min shakes once at interval, behind the ice bath 3-5min with the centrifugal 10min of 12000g, get the isopropyl alcohol of resetting and adding 0.5-1 times of volume precooling, place behind the 30rmin with the centrifugal 15min of 12000g 70% ethanol washing precipitation, the resuspended precipitation of distilled water that handle with coke acid tetra-ethyl ester dry back for-20 ℃.Gained is the semifinished product that contains shrimp white spot syndrome virus, taura syndrome virus and hepatopancreatic parvovirus nucleic acid (DNA and RNA).
(3) compound polymerase chain reaction,PCR mark digoxin: the total nucleic acid semifinished product of getting prawn ' s virus, the taura syndrome virus downstream primer TTTTCGATGCAGATGGGTAAC that adds 1 μ l, 70 ℃ of temperature are bathed 5min, the reverse transcription damping fluid, 5 μ l dNTP (10mM, 25 RNA of unit enzyme inhibitors and the 200 unit reverse transcriptase that add 5 μ l immediately behind the ice bath 5min successively, distilled water to the cumulative volume that replenishes the processing of coke acid tetra-ethyl ester is 25 μ l, 42 ℃ of temperature are bathed 1h, and product can not made the template that any processing is directly increased as polymerase chain reaction,PCR.The DNA of white spot syndrome virus, hepatopancreatic parvovirus and be prawn ' s virus nucleic acid digoxin on the mark in amplification procedure through the taura syndrome virus of reverse transcription.Whole mark amplification system carries out in 50 μ l reaction systems, the reverse transcription product that contains 2 μ l is made template, one times polymerase chain reaction,PCR damping fluid, one times digoxigenin labeled dNTP potpourri, shrimp white spot syndrome virus, the specific amplimer potpourri of taura syndrome virus and hepatopancreatic parvovirus (the white spot syndrome virus upstream and downstream amplimer (TGATTTGTTGTGCCCTTTTG of 30pmol, ACGTAGGGTCGATGTTGGTG), the hepatopancreatic parvovirus upstream and downstream amplimer (ACACAGCAATATGATCAAGAGAAA of 60pmol, GCACTGGCCATCGTATCTT) and the taura syndrome virus upstream and downstream amplimer (TCGCTGCATGAGAAGGGTTAT of 60pmol, TTTTCGATGCAGATGGGTAAC), the Taq enzyme of 2 units.Reaction cycle is 94 ℃ of 30S, 53 ℃ of 30S, and 72 ℃ of 1min carry out 30 circulations altogether.Last 72 ℃ are extended 10min.
(4) immobilization of oligonucleotide probe: by 96 hole micro reaction plates of good streptavidin, the capture probe of biotin is anchored on the microwell plate through biotin-streptavidin bridge on the end mark with bag in the solid-phase hybridization reaction.Will be to phosphate buffer (pH7.4) dilution (final concentration be 10pmol/ml) of capture probe to contain 0.1% bovine serum albumin(BSA) of shrimp white spot syndrome virus, taura syndrome virus and hepatopancreatic parvovirus nucleic acid, be added in the reacting hole with the every hole of 100 μ l, 22-25 ℃ of temperature bathed 30-60min, wash plate 5 times with phosphate buffer (pH7.4) the 250 μ l immersion that contains 0.1% bovine serum albumin(BSA), keep 1min at every turn.Bag is standby 4 ℃ of preservations by 96 hole micro reaction plates of good capture probe.
(5) solid-phase hybridization: get amplified production 10 μ l thermal denaturation 10min, ice bath 3-5min immediately, add in the micro reaction plate that is combined with the specific oligonucleotide capture probe, and add hybridization buffer (5x SSC, 5xDenhardt, 0.1% sodium lauroyl sarcosine, 0.02% lauryl sodium sulfate) to 100 μ l, fully bathe 1-2h in 25 ℃ of temperature behind the mixing., washing plate 5 times with the phosphate buffer 250 μ l that contain 0.1% Tween-20, each 1min blots with fiberless thieving paper.
(6) enzyme connection colour developing: after the hybridization, dilute the anti digoxin antibody that (1: 5000) is coupled alkaline phosphatase with the phosphate buffer (pH7.4) that contains 0.1% bovine serum albumin(BSA), 100 μ l add in each reacting hole.After bathing 30-60min, 37 ℃ of temperature wash plate 5 times, each 1min with the phosphate buffer 250 μ l that contain 0.1% Tween-20.With p-nitrophenyl phosphate (p-nitrophenyl phosphate, p-NPP) as substrate, (pH9.6) is diluted to 1mg/ml with the Tris hydrochloride buffer, and 100 μ l add in each reacting hole, lucifuge colour developing 30-60min is with 40 μ l NaOH (2M) cessation reactions.Do to qualitatively judge or read 405nm absorbance (A with visual inspection with microplate reader
405nmValue) doing sxemiquantitative judges.
(7) result judges: visual inspection, and colour developing is yellow positive; Or with sample/this determining method of negative control ratio as positive criterion, at the A that draws sample (S) and negative control (N)
405nmAfter the value, calculate the S/N value, positive greater than 1.0 conducts.
＜110〉＜120〉-＜160〉12＜170〉PatentIn 3.1＜210〉1＜211〉331＜212〉DNA＜213〉 ( White spot syndrome virus )＜400〉1tgatttgttg tgcccttttg caaggcatag gattgtacat ttcttataaa aaataaaaca 60atatataaaa ttcagttgta tttttattgc tcaaataagt tactacaccc aattctcccc 120cctctctagt gagagatccc aatcactttc tactgtcact gttgctgctg tttgttgttc 180ctcttcttcc tcctcttctt cctcttcatc ttcatcttct ttagttcgtt cttcattata 240tgctttaatt atcctcaata catttaaaat ggtgcgctct tctcggttaa acttctgatt 300ctttccctca ccaccaacat cgaccctacg t 331＜210〉2＜211〉236＜212〉DNA＜213〉 ( Taura syndrome virus )＜400〉1tcgctgcatg agaagggtta tttcttaatg ttctgcgatg tcattaagat agcgtgtagg 60aacgcagggt acaaggaagc atgtttacat gagttggatt gtaagagctt ccttttggcc 120cagcaaggta gagctggagc tcatgatagt gagttcctaa gtcagctatt ggacttaaac 180taatagcacc acccgatcgt aaactccatg tattggttac ccatctgcat cgaaaa 236＜210〉3＜211〉194＜212〉DNA＜213〉 ( Hepatopancreatic parvovirus )＜400〉1acacagcaat atgatcaaga gaaaactcca gcagtcaaaa gagctctaga actaactcaa 60gaagaagaac agttagaacg gatagaaaac gctaagaaat atattgagga agttatagag 120gagacaaaca gagaatttga aagtgaagta agacaagaga caagtgcgga ggcggaagat 180acgatggcca gtgc 194＜210〉4＜211〉20＜212〉DNA＜213〉 ( White spot syndrome virus )＜400〉1tgatttgttg tgcccttttg 20＜210〉5＜211〉20＜212〉DNA＜213〉 ( White spot syndrome virus )＜400〉1acgtagggtc gatgttggtg 20＜210〉6＜211〉21＜212〉DNA＜213〉 ( Taura syndrome virus )＜400〉1tcgctgcatg agaagggtta t 21＜210〉7＜21l〉21＜212〉DNA＜213〉 ( Taura syndrome virus )＜400〉1ttttcgatgc agatgggtaa c 21＜210〉8＜211〉24＜212〉DNA＜213〉 ( Hepatopancreatic parvovirus )＜400〉1acacagcaat atgatcaaga gaaa 24＜210〉9＜211〉19＜212〉DNA＜213〉 ( Hepatopancreatic parvovirus )＜400〉1gcactggcca tcgtatctt 19＜210〉10＜211〉15＜212〉DNA＜213〉 ( White spot syndrome virus )＜400〉1actgtcactg ttgct 15＜210〉11＜211〉15＜212〉DNA＜213〉 ( Taura syndrome virus )＜400〉1agcaaggtag agctg 15＜210〉12＜211〉15＜212〉DNA＜213〉 ( Hepatopancreatic parvovirus )＜400〉1agttagaacg gatag 15
Claims (1)
1, a kind of compound polymerize chain reaction-enzyme linked immunoassay detects the method for prawn ' s virus, comprises the following steps:
(1) design of specific oligonucleotide probe and amplimer and screening: according to the virus genome sequence design, the sequence capture probe of shrimp white spot syndrome virus, taura syndrome virus and hepatopancreatic parvovirus end mark biotin is: biotin-ACTGTCACTGTTGCT; Biotin-AGTTAGAACGGATAG; Biotin-AGCAAGGTAGAGCTG, the upstream and downstream primer sequence of amplification white spot syndrome virus is: TGATTTGTTGTGCCCTTTTG, ACGTAGGGTCGATGTTGGTG; The upstream and downstream sequence of amplification hepatopancreatic parvovirus is: ACACAGCAATATGATCAAGAGAAA, GCACTGGCCATCGTATCTT; The upstream and downstream primer sequence of amplification taura syndrome virus is: TCGCTGCATGAGAAGGGTTAT, TTTTCGATGCAGATGGGTAAC;
(2) the tissue total nucleic acid is extracted: get and infect the prawn tissue, add lysate and Proteinase K after the homogenate, 55 ℃ of temperature are bathed 1h, 10min shakes once at interval, with the centrifugal 10min of 12000g, get the isopropyl alcohol of resetting and adding precooling behind the ice bath 3-5min, place behind the 30min with the centrifugal 15min of 12000g for-20 ℃, 70% ethanol washing precipitation, the resuspended precipitation of distilled water that handle with coke acid tetra-ethyl ester dry back;
(3) compound polymerase chain reaction,PCR mark digoxin: get prawn ' s virus total nucleic acid semifinished product, add taura syndrome virus downstream primer TTTTCGATGCAGATGGGTAAC, 70 ℃ of temperature are bathed 5min, add the reverse transcription damping fluid behind the ice bath 5min successively, dNTP, RNA enzyme inhibitor and reverse transcriptase, distilled water to the cumulative volume that replenishes the processing of coke acid tetra-ethyl ester is 25 μ l, 42 ℃ of temperature are bathed 1h, prawn ' s virus nucleic acid digoxin on the mark in amplification procedure, whole mark amplification system carries out in 50 μ l reaction systems, contain reverse transcription product and make template, one times polymerase chain reaction,PCR damping fluid, one times digoxigenin labeled dNTP potpourri, specific amplimer potpourri of prawn ' s virus and Taq enzyme, reaction cycle is 94 ℃ of 30S, 53 ℃ of 30S, 72 ℃ of 1min carry out 30 circulations altogether, and last 72 ℃ are extended 10min;
(4) immobilization of oligonucleotide probe: the solid-phase hybridization reaction is with wrapping by 96 hole micro reaction plates of good streptavidin, the capture probe of biotin is anchored on the microwell plate through the biotin-streptavidin bridge on the end mark, the capture probe of prawn ' s virus is to contain the phosphate buffer dilution of bovine serum albumin(BSA), 22-25 ℃ of temperature bathed 30-60min, wash plate with the phosphate buffer immersion that contains bovine serum albumin(BSA), 4 ℃ of preservations are standby;
(5) solid-phase hybridization: get amplified production thermal denaturation 10min, ice bath 3-5min adds in the micro reaction plate that is combined with the specific oligonucleotide capture probe, and adds hybridization buffer, bathes 1-2h in 25 ℃ of temperature behind the mixing, washes plate with the phosphate buffer that contains Tween-20;
(6) enzyme connection colour developing: after the hybridization, be coupled the anti digoxin antibody of alkaline phosphatase with the phosphate buffer dilution of bovine serum albumin(BSA), add in each reacting hole, after bathing 30-60min, 37 ℃ of temperature wash plate with the phosphate buffer that contains Tween-20, with the p-nitrophenyl phosphate as substrate, with the dilution of Tris hydrochloride buffer, lucifuge colour developing 30-60min is with the NaOH cessation reaction;
(7) result judges: visual inspection, colour developing is yellow positive.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03125202 CN1243981C (en) | 2003-07-30 | 2003-07-30 | Method for detecting prawn virus by compound polymerase chain -enzyme-linked immune reaction |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03125202 CN1243981C (en) | 2003-07-30 | 2003-07-30 | Method for detecting prawn virus by compound polymerase chain -enzyme-linked immune reaction |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1484029A true CN1484029A (en) | 2004-03-24 |
| CN1243981C CN1243981C (en) | 2006-03-01 |
Family
ID=34152959
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 03125202 Expired - Fee Related CN1243981C (en) | 2003-07-30 | 2003-07-30 | Method for detecting prawn virus by compound polymerase chain -enzyme-linked immune reaction |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1243981C (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100402668C (en) * | 2006-10-19 | 2008-07-16 | 天津市水产研究所 | Primer sequence and detecting reagent kit for detecting prawn white spot syndrome virus |
| CN100460518C (en) * | 2006-08-29 | 2009-02-11 | 中国科学院南海海洋研究所 | Reagent box for detecting prawn leucoplakia syndrome virus using isothermal branch augmentation and method therefor |
| CN102002539A (en) * | 2010-11-23 | 2011-04-06 | 中国农业大学 | Porcine parvovirus assay kit and application thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101942513B (en) * | 2010-08-27 | 2013-06-12 | 深圳博尔美生物科技有限公司 | Biochip and production method thereof |
-
2003
- 2003-07-30 CN CN 03125202 patent/CN1243981C/en not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100460518C (en) * | 2006-08-29 | 2009-02-11 | 中国科学院南海海洋研究所 | Reagent box for detecting prawn leucoplakia syndrome virus using isothermal branch augmentation and method therefor |
| CN100402668C (en) * | 2006-10-19 | 2008-07-16 | 天津市水产研究所 | Primer sequence and detecting reagent kit for detecting prawn white spot syndrome virus |
| CN102002539A (en) * | 2010-11-23 | 2011-04-06 | 中国农业大学 | Porcine parvovirus assay kit and application thereof |
| CN102002539B (en) * | 2010-11-23 | 2013-01-16 | 中国农业大学 | Porcine parvovirus assay kit and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1243981C (en) | 2006-03-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7167913B2 (en) | Virus test method and virus test kit | |
| Archard et al. | Characterization of Coxsackie B virus RNA in myocardium from patients with dilated cardiomyopathy by nucleotide sequencing of reverse transcription-nested polymerase chain reaction products | |
| CN108802374A (en) | Excretion body nucleic acid detection technique based on magnetic enrichment electrochemical luminescence | |
| Sridhar et al. | A systematic approach to novel virus discovery in emerging infectious disease outbreaks | |
| CN1827778A (en) | Real-time fluorescence quantitative PCR detection method for fish iridovirus | |
| CN101177701B (en) | Human papillomavirus gene parting detecting reagent case and method for preparing gene chip thereof | |
| Brechot | Hepatitis C virus 1b, cirrhosis, and hepatocellular carcinoma | |
| CN100460519C (en) | Reagent box for detecting prawn infectious subcutaneous and hemopoietic tissue necrosis virus and method thereof | |
| JP4358637B2 (en) | Amplification-hybridization method for detecting and identifying the type of human papillomavirus | |
| Safeena et al. | Molecular biology and epidemiology of hepatopancreatic parvovirus of penaeid shrimp | |
| Calabrese et al. | Cardiac infections: focus on molecular diagnosis | |
| CN1484029A (en) | Method for detecting prawn virus by compound polymerase Chain -enzyme-linked immune reaction | |
| KR20010041614A (en) | Oligonucleotides for the amplification and detection of epstein barr virus (ebv) nucleic acid | |
| Mantke et al. | High prevalence of cardiotropic viruses in myocardial tissue from explanted hearts of heart transplant recipients and heart donors: a 3-year retrospective study from a German patients’ pool | |
| Nambi et al. | In vitro white spot syndrome virus (WSSV) replication in explants of the heart of freshwater crab, Paratelphusa hydrodomous | |
| Tang et al. | In situ detection of Australian gill-associated virus with a yellow head virus gene probe | |
| Cruz et al. | Application of a focus formation assay for detection and titration of porcine epidemic diarrhea virus | |
| Li et al. | Detection of Panulirus argus Virus 1 (PaV1) in the Caribbean spiny lobster using fluorescence in situ hybridization (FISH) | |
| CN100460518C (en) | Reagent box for detecting prawn leucoplakia syndrome virus using isothermal branch augmentation and method therefor | |
| CN106929484B (en) | A kind of tagging and testing method of the 5- deoxyuridine of acetenyl -2 ' of hepatitis B virogene group DNA | |
| CN101760564A (en) | Cytomegalovirus detecting method and kit thereof by nucleic acid isothermal amplication | |
| CN1451763A (en) | Method for hybrid detecting nucleic acid complex point of shrimp viral | |
| CN108486279A (en) | A method of pigeon with newcastle disease is detected based on fluorescent quantitative PCR technique | |
| CN108130385A (en) | A kind of human cytomegalovirus kit for detecting nucleic acid | |
| Quadri et al. | Detection of the negative-strand hepatitis C virus RNA in tissues: implications for pathogenesis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |