CN1451751A - Thermophilic esterase/phosphatidase gene, engrg. bacteria, enzyme and use thereof - Google Patents

Abstract

A gene of the thermophilic lipase/phosphatidase A2, the engineering bacterium expressed by its recombinant vector in host, the thermophilic lipase/phosphatidase constructed with said engineering bacterium and the industrial use of said enzyme are disclosed. Said enzyme A2 is prepared from the thermophilic Aeropyrum pernix K1 through constructing engineering bacterium, fermenting, centrifugal separation, collecting deposit, freeze thawing, ultrasonic breaking, heat treating, and affinity chromatography.

Description

Thermophilic esterase/phosphatidase gene, engineering bacterium, enzyme and application thereof

The technical field is as follows:

the invention belongs to the field of bioengineering, and particularly relates to thermophilic esterase/phospholipase A₂The gene of (a), an engineering bacterium expressed by the gene recombinant vector in a normal-temperature host, and a thermophilic esterase/phospholipase A constructed by using the engineering bacterium₂And the use of the enzyme in industry.

Background art:

since the first thermophilic enzyme, TaqDNA polymerase, was successfully used in Polymerase Chain Reaction (PCR) in 1985, microorganisms growing in a particularly high heat environment have been gaining increasing attention. A number of thermophilic enzymes (55-80 ℃) having hydrolase activity have been developed in succession and have played an important role in many fields. In recent years, people separate and obtain super thermophilic enzyme (80-113 ℃) from thermophilic archaea in seabed heat flow, andthe super thermophilic enzyme has a new application prospect for modern enzyme engineering technology (King BX Jing and the like, microbiological report 2002, 42: 259-. The thermophilic enzyme not only has incomparable advantages of chemical catalysts, such as high catalytic efficiency and strong substrate specificity, but also has excellent enzyme stability. The method can overcome the phenomenon that the biological properties of mesophilic enzyme (20-55 ℃) and low-temperature enzyme (2-20 ℃) are often unstable in the application process, so that a plurality of high-temperature chemical reactions are realized, the development of the biotechnology industry is greatly promoted, and the technical level and the life quality are improved.

The use of the thermophilic enzyme as the biocatalyst has the following advantages: (1) the preparation cost of the enzyme preparation is reduced. Because the stability of the thermophilic enzyme is high, the thermophilic enzyme can be separated, purified, packaged and transported at room temperature, and the activity can be maintained for a long time; (2) the kinetic reaction is accelerated. Along with the increase of the reaction temperature, the molecular movement speed is accelerated, and the enzyme catalysis capability is enhanced; (3) the energy consumption is reduced. Because the reaction is carried out at high temperature, the requirement standard of a cooling system of the reactor is reduced; (4) the purity of the product is improved. Under the condition of the thermophilic enzyme catalysis reaction (over 70 ℃), few mixed bacteria exist, and therefore, the pollution of bacterial metabolites to final products is reduced. Due to the high-temperature reaction activity of the thermophilic enzyme and the strong resistance to organic solvents, detergents and denaturants, the thermophilic enzyme has wide application potential in the aspects of food, medicine, tanning, petroleum exploitation, waste treatment and the like.

Esterases (Esterases, EC 3.1.1.1) are a class of serine hydrolases that are widely distributed in tissues and organs and hydrolyze many endogenous and exogenous substances containing carboxylic ester, thioester, and amide bonds. Its main functions in the organism are to participate in lipid metabolism, signal transduction and maintain the integrity of the structure of the biological membrane; mainly used for ester hydrolysis in vitro and completing a plurality of reactions such as esterification, ester exchange and the like in an organic phase (Klibanov A M.2001, Nature, 409: 241-. By utilizing the stereospecificity of esterase, asymmetric reaction can be catalyzed, and a plurality of chiral compounds (such as liquid crystal, optically active drugs, pesticides and the like) which are difficult to synthesize by utilizing a chemical method can be prepared. Recently, with the rapid development of molecular biology techniques, cloning of esterase genes has been actively studied abroad, several microbial esterase genes have been controlled and expressed, and enzymes have been molecularly modified by using site-directed mutagenesis and directed evolution techniques in order to improve thermostability and substrate specificity of esterases (Giver JC, Arnold FH, Proc. Natl. Acad. Sci. USA.1998, 95: 12809-13; Henke E, Bornscheluer. UT, biol. chem., 1999, 380: 1029-33). Thermophilic esterases have been studied only rarely because of the harsh conditions under which thermophilic microorganisms are cultured.

Phospholipase A₂(PLA₂) The system is known under the name phosphatidyl 2-acylhydrolase (phosphatidyl 2-acylhydrolase), which enzymatically hydrolyzes the second position of the diacyl bond of glycerophospholipids to form lysophospholipids and lipidsFatty acids, as shown in the formula:

(lecithin) lyso (lecithin) fatty acids

PLA₂Has many biological functions, such as neurotoxin, muscle toxin and cardiotoxin, and participates in many physiological activities, such as lipid digestion and metabolism, signal transduction and elimination of inflammatory processes, thereby drawing extensive attention from researchers at home and abroad. At present, the domestic main focus is on snake PLA₂The study of (1); foreign venom PLA₂The cloning, expression and crystal structure simulation of (A) have been reported in detail, and bee venom PLA has been reported₂The DNA recombination and structure of (2) were also preliminarily studied, but most of these enzymes belong to mesophilic enzymes. While thermophilic PLA₂In particular the archaea thermophilic enzyme PLA₂The study of (A) was also in the initial stage, and to date, thermophilic PLA was found only in Pyrococcus horikoshii₂Activity of (Feng, Y., et al. American Oil Chemistry Society, 2000, 77: 1147-₂The engineering bacterium of (1).

PLA₂Has important application value in the grease industry. In the production process of high-quality oil, it is necessary to perform a process of degumming oil to decompose fat-soluble phospholipid molecules mixed in the oil into water-soluble phospholipid derivatives, thereby removing the phospholipids and improving the purity and quality of the oil. At present, the production of high-quality grease such as salad oil and the like is usually degummed by a chemical method and a physical method, but the method has complex process, high cost and serious pollution. In the last decade, Europe et al, such as Germany, have attempted to modify this process using enzymatic methods (K.Dahlke and H.Buchold, Information, 1995, 6 (12): 1284-1291). They obtained good effect by using porcine pancreatic phospholipase to transform phospholipid molecules. Not only improves the production efficiency, but also reduces the production cost by 43 percent. Because of the safety and high efficiency of enzyme preparation production, the method is widely noticed, and the national trade is XianThe research on the enzyme process has been conducted by the institute of oil and fat science and design and the oil and fat company, Inc., of Tianjin Ming group (Liu Ching Feng, Gaozui, the new development of oil and fat refining technology, China oil and fat 1998, 23 (2): 3). But the production scale is not reached yet at presentStay in the study phase. The main problem is that the used porcine pancreatic phospholipase has poor heat resistance (the best catalytic activity is shown within 60 ℃), and the oil and fat degumming process needs higher temperature (70-80 ℃). The conventional enzyme can not reach the optimal degree of production efficiency and cost of the degumming process due to the limitation of reaction temperature.

Therefore, in order to be applied to a reaction system with higher temperature, the esterase and the phospholipase A which still have higher catalytic activity under the high-temperature environment are searched₂Is very important, and the development of the functional protein of the thermophilic archaea is beneficial to discovering and preparing novel high-temperature hydrolase.

Disclosure of Invention

One of the purposes of the invention is to extract a thermophilic esterase/phospholipase A from thermophilic archaea₂A gene;

another object of the present invention is to utilize the above-mentioned thermophilic esterase/phospholipase A₂The gene constructs a thermophilic esterase/phospholipase A through a bioengineering technology₂Engineering bacteria;

it is still another object of the present invention to utilize the above-mentioned thermophilic esterase/phospholipase A₂Engineering bacteria for preparing thermophilic esterase/phospholipase A with good stability, strong heat resistance and high catalytic efficiency₂。

A final object of the invention is the use of a thermophilic esterase/phospholipase A enzyme₂Provides a thermophilic esterase/phospholipase A₂And can be used in industrial production.

The thermophilic archaea Aeropyrum pernix K1 comes from deep sea crater of Japan, and the optimal growth temperature is 95 ℃. We found in earlier work that the protein expressed by the strain has both thermophilic esterase and phospholipase A₂So that the expression of the thermophilic esterase/phospholipase A in the DNA molecule can be performed₂The active gene sequence is called thermophilic esterase/phosphatidase A₂A gene. Due to the difficulty of artificial culture of thermophilic archaea (including thermophilic archaea from deep sea crater of Japan), long growth period, and contained thermophilic esterase/phospholipase A₂The amount of the enzyme is very low, so that the archaea culture cannot be directly utilized for producing the thermophilic esterase/phospholipase A₂. Thermophilic esterase/phospholipase A₂The gene is transferred into normal temperature host such as colibacillus which can propagate rapidly and has simple culture condition, and the problems can be solved effectively.

The thermophilic archaea Aeropyrum pernix K1 from Japanese deep-sea crater is cultured and the target gene is fished to obtain the thermophilic protein gene, and the nucleotide sequence of the thermophilic protein gene is shown in a sequence table SEQ ID NO.1 by entrusting Baoji bioengineering (Dalian) Co., Ltd.

The thermophilic enzyme gene is loaded on a pET system vector and then transferred into an Escherichia coli host to obtain an engineering bacterium (named as JDA 1). The engineering bacterial strain is preserved in China general microbiological culture Collection center (CGMCC) at 12 months and 02 days in 2002, and the preservation number is CGMCC No. 0844. And (3) classification and naming: escherichia coli (Escherichia coli).

The expression product of the engineering bacteria is cell soluble protein, and the thermophilic protein can be obtained by separating and purifying the escherichia coli hybrid protein through cell ultrasonic disruption and heating inactivation.

The thermophilic protein expressed by the Escherichia coli engineering bacteria (JDA1) is identified by activity experiments, and not only has phospholipase A₂Activity, also esterase activity; the thermophilic protein is the thermophilic esterase/phospholipase A₂Amino group ofThe sequence is shown in a sequence table SEQ ID NO.2, and the lipase has common esterase and phospholipase A₂The catalyst has the advantages of capability of catalyzing reaction at high temperature (80-100 ℃) and strong high temperature resistance and chemical substance denaturation resistance; when the method is applied to production, the method has the advantages of low storage and transportation cost, accelerated kinetic reaction, low requirement standard on a reactor cooling system and the like. The recombinant enzyme can catalyze ester synthesis, ester exchange and ester hydrolysis reaction in situThe method has important application potential in the fields of biochemical engineering, grease degumming, tool enzyme and the like.

The thermophilic esterase/phospholipase A of the invention₂The gene is recombined with an expression vector to form a recombinant expression vector, the invention is not limited to a specific expression vector, a preferred expression vector adopts a eukaryotic or prokaryotic expression vector, and a further preferred expression vector is pET15 b.

The recombinant expression vector can be introduced into suitable host cells including prokaryotic cells and eukaryotic cells according to a conventional method. The present invention is not limited to any particular host cell as long as it is capable of expressing the recombinant expression vector. In a preferred embodiment, the invention uses the e.coli BL21(DE3) codon plus strain.

All basic molecular biology procedures in the above technical schemes refer to "molecular cloning guidelines" (third edition, scientific Press, 2002).

The thermophilic esterase/phospholipase A of the invention₂The substrate used in the catalytic reaction is not limited to any specific ester, phospholipid, organic acid, alcohol, etc., as long as it can participate in hydrolysis, synthesis, and transesterification. In a preferred embodiment, the present invention uses p-nitrophenol fatty acid ester and NBD-lecithin (1-hexadecanoyl-2- [ N- (7-nitrobenzez-2-oxa-1, 3-diazol-4-yl) aminohexanoyl]-sn-glycero-3-phosphocholine, NBD-PC) as substrate.

The substrate of the enzyme is not limited to any specific ester, phospholipid, organic acid, alcohol, etc., and any chemical substance that can participate in ester hydrolysis, ester synthesis, and transesterification is suitable as a substrate for the enzyme.

Drawings

FIG. 1 thermophilic esterase/phospholipase A₂A gene sequencing spectrogram;

FIG. 2 is a schematic representation of a recombinant expression vector;

FIG. 3 purification of the resulting thermophilic esterase/phospholipase A₂(ii) an electropherogram of (a);

FIG. 4 thermophilicesterase/phospholipase A₂Temperature ofA vitality curve;

FIG. 5 thermophilic esterase/phospholipase A₂The pH-activity curve of (1);

FIG. 6 thermophilic esterase/phospholipase A₂Temperature and pH stability curves of (a);

detailed description example 1: construction of thermophilic enzyme engineering bacteria and expression of enzyme thereof

(1) Culturing of thermophilic archaea Aeropyrum pernix K1 and extracting its chromosome DNA.

37.4g of Bacto marine broth 2216(Difco) (culture medium) is dissolved in 990ml of distilled water,performing damp-heat sterilization; collecting 1.0g of Na₂S₂O₃·5H₂O (nutritive salt) was dissolved in 10ml of distilled water, sterilized by filtration through a 0.45m filter and added to the sterilized medium. Adding stem cells of archaea Aeropyrum pernix K1 into 0.5mL of culture medium, transferring the dissolved stem cells into a test tube filled with 5mL of the culture medium, and uniformly mixing; from this, 0.5ml was transferred to a test tube containing 5ml of fresh medium and cultured at 90 ℃ for 7 days with standing. Then transferred to a conical flask filled with 100ml of culture medium and cultured for 3 days at 90 ℃ by shaking, and the thalli are preserved at-40 ℃ for standby.

Collecting 1.5ml of archaea culture, resuspending the collected thallus in 200. mu.L of 25mmol/L Tris-HCl buffer (pH8.0, containing 50mmol/L glucose and 10mmol/L EDTA), adding 50. mu.l of 50mg/ml lysozyme, and digesting at 4 deg.C for 1 hr; adding 125. mu.l of SDS solution (final concentration: 2%) to react for 10 minutes; equal volume of phenol was added: chloroform: isoamyl alcohol, mixing evenly, centrifuging for 5 minutes, and transferring the supernatant into another centrifugal tube; adding 2 times volume of absolute ethyl alcohol into the sediment, precipitating the thallus DNA, centrifuging at 12000rpm for 5 minutes, pouring out the supernatant, and washing the DNA by using 70% ethyl alcohol; after centrifugation, the supernatant was removed, redissolved in TE solution, and the resulting chromosomal DNA solution was stored in a refrigerator at 4 ℃ for further use.

(2) Primer design and recombinant vector prepared by gene of fishing enzyme by PCR method

The genome of the archaea Aeropyrum pernix K1 contains several possible lipase genes. By sequencing, we selected their nucleotide sequencesThe gene shown in the table SEQ ID NO.1 is used as a research object and is called as thermophilic esterase/phospholipase A₂A gene. The enzyme gene is obtained by amplifying the chromosomal DNA obtained in step (1) by a known PCR method. Two primers were designed based on the gene sequence and the multiple enzyme cleavage site of the expression vector, and were synthesized by Shanghai Biotech Co.

An upstream primer: TTTAGAATTCGCGCATATGGGTGTTAACGAGG, underlined is Nde I site;

a downstream primer: TTTTGGTACCTTAGGATCCAATTAGTGTTTAGCCTCCG, underlined is the BamH I site.

The restriction sites set by the two primers are matched with NdeI and BamHI of an expression vector pET15b, and the primers are suitable for high-efficiency expression in Escherichia coli.

And (3) PCR reaction: mu.l of Vent DNA polymerase, 10. mu.l of Vent DNA polymerase buffer, 1.5. mu.l of dNTP mix (each nucleotide concentration: 25nmol/L), 4. mu.l of chromosomal DNA, 1. mu.l of forward primer, 1. mu.l of reverse primer, and 81.5. mu.l of ultrapure water were contained in 100. mu.l of the reaction system. Each cycle consisted of denaturation at 94 ℃for 0.5 min, annealing at 55 ℃ for 0.5 min, extension at 72 ℃ for 1 min, and extension to 10min for the last cycle, for 35 cycles. The PCR product was detected by 2.0% agarose gel electrophoresis and the molecular weight was consistent with that expected (474 bp). The amplified product was purified using a PCR product purification kit.

The purified PCR product was digested with the restriction enzyme BamH I, incubated at 37 ℃ for 1 hour, then 1. mu.l of 0.5M NaCl, 2. mu.l of Nde I were added, and further incubated at 37 ℃ for 1 hour. After the enzyme digestion, the mixture is electrophoresed on 2.0% agarose gel, and a DNA fragment after the enzyme digestion is recovered by applying a DNA gel detection kit.

The pET15b vector was cleaved by a similar method, and then treated with alkaline phosphatase (CAP), and the linear vector was detected in 0.7% agarose gel and the cleaved vector was purified. T4DNA polymerase was used at 16 ℃ to ligate the esterase gene fragment and the vector. The ligation vector was transferred into E.coli BL21(DE3) Codon Plus and screening and identification of monoclonal strains were performed using ampicillin-containing agarose plates. The vector was picked from the colony and acted on by restriction enzymes Nde I and BamH I to give two fragments of a size corresponding to the esterase gene and the size of the fragment pET15b/NdeI + BamHI, respectively. The construction process of the recombinant vector is shown in FIG. 2.

(3) The recombinant vector can be transformed into host cells such as E.coli BL21(DE3) and E.coli BL21(DE3) Codon Plus, and the content of the expressed thermophilic enzyme in E.coli BL21(DE3) Codon Plus is higher. The preparation of competent Escherichia coli cells and the transformation method of the vector thereof are referred to the book of molecular cloning experimental guidelines. The positive transformation bacteria are picked upand put into 5ml of culture solution containing ampicillin to be cultured with shaking at 37 ℃ overnight, and then inoculated into 100ml of fresh LB culture medium the next day to be cultured for 4 hours continuously at 37 ℃. The initially amplified seed solution was inoculated into 2L of the culture solution at a ratio of 1%, and shake-cultured on an air shaker (37 ℃ C., 120 rpm/min). When the thallus grows to A₆₀₀When the concentration is 0.6-1.0, adding 100mM isopropyl thio β -D-galactoside (IPTG) to the final concentration of 1mM, reducing the culture temperature to 25 ℃, inducing the thalli to generate a large amount of target protein, culturing for 10-12 hours, and then harvesting the thalli to obtain the engineering bacteria strain disclosed by the invention, wherein the engineering bacteria strain is stored in the common microorganism center of China general microbiological culture Collection for culture Collection of microorganisms (CGMCC No0844) in 12 months and 12 months 2002, and the preservation number is CGMCC No0844.

Freezing thallus at-30 deg.C for 1 hr, thawing, adding 50mM Tris-HCl (pH8.0) buffer solution 5-10 times the volume of thallus, and ultrasonicating for 10 min; the disruption solution was subjected to heat treatment at 85 ℃ for 30 minutes, and the denatured E.coli hetero-protein was removed by centrifugation (12000rpm, 20min), and the supernatant was collected to obtain a crude enzyme solution.

Since the N-terminus of the recombinant thermophilic enzyme contains His-Tag, the recombinant protein was separated using a nickel affinity Column (Ni-Chelating Column), and eluted with 100mM imidazole and bound to a chromatography Column to give the thermophilic enzyme. The purity of the recombinant protein was checked by SDS-PAGE (12%) electrophoresis, which showed an electrophoretic band around 18000Da, as shown in FIG. 3. Example 2: recombinant thermophilic esterase/phospholipase A₂Is a characteristic of

(1) Optimum reaction temperature

Reaction temperatureThe degree is an important factor affecting the catalytic activity of the enzyme. In general, thermophilic esterase/phospholipase A enzymes₂The reaction activity at high temperature is much higher than that at low temperature. The maximum temperature at which the enzyme catalytic activity is detected is only 100 ℃ taking into account the stability of the substrate.

Measuring phospholipase A at 50-100 deg.C with NBD-PC as reaction substrate₂And (4) vitality. As can be seen from FIG. 4(a), the activity increased with increasing temperature in the temperature range of 50-90 ℃ and decreased with an optimum temperature of 90 ℃ above 90 ℃.

We also investigated the esterase activity of this recombinase at different temperatures using p-nitrophenol propionate as substrate. As a result, as shown in FIG. 4(b), the enzyme exhibited the maximum catalytic activity when the temperature reached 90 ℃.

Thermophilic esterase/phospholipase A₂And (3) activity determination: activity of the enzyme can be detected by a thin plate scanner (WALLAC ARTHUR, England, 1442MULTI-WAVELEN GTH FLUOROIMAGER) by observing fluorescence generated from NBD derivatives using lecithin with NBD fluorescent label as a substrate.

20ul of NBD-PC (0.1mg/ml in chloroform) was taken in a 2ml glass bottle and the chloroform was evaporated by blowing nitrogen. 1.5ml of Tris-HCl buffer (pH8.0, final concentration 50mmol/L) and 20ul of the enzyme solution of the present invention were added, reacted at 90 ℃ for 1 hour, and then placed in an ice bath to terminate the reaction. 3ml of ethyl acetate/acetone (2: 1, v: v) were added to the above reaction solution, and themixture was shaken to extract the residual substrate and the product NBD-acid. The mixture was centrifuged at 2500rpm for 10 minutes, and the upper layer solution (2.5ml) was collected and the sample was dried with nitrogen. The residual solid was dissolved in 150. mu.l of methanol/chloroform (1: 1, v/v), 10. mu.l of the sample was spotted on a plate, dried naturally, and then NBD lecithin-and NBD acid were isolated using chloroform/methanol/water (35: 65: 4, v/v/v) as a spreading agent.

Detection of esterase activity: using p-nitrophenol propionate as lipase hydrolysis substrate, reaction system is 1ml, buffer system is 50mM Tris-HCl (pH8.0), final concentration of p-nitrophenol caprylate is 0.2mM, 20ul enzyme is added, and every 70 deg.C, every 557Type ultraviolet spectrophotometer measures the light absorption value at 420 nm. 1 enzyme activity unit is that the substrate is hydrolyzed to generate 1 mu mol of p-nitrophenol (epsilon is 0.016 mu M)^-1.cm^-1) The amount of enzyme required.

(2) Optimum pH

The environmental pH affects the dissociation state of charged amino acids in the enzyme molecule and the conformation of the enzyme, which in turn affects the catalytic activity of the enzyme. The specific activity of the thermophilic enzyme at the pH range of 5-11 (pH5.0-7.0, phosphate buffer, pH7.5-8.8, Tris-HCl buffer, pH9.0-11.0, Gly-NaOH buffer) was determined at 70 ℃ by using p-nitrophenol propionate as a substrate, and the experimental results show that the hydrolysis of p-nitrophenol propionate can be effectively catalyzed between the pH value of 7.5 and 8.5, and the optimum pH of the enzyme of the invention is 8.0, as shown in FIG. 5.

(3) Substrate specificity

Weighing various p-nitrophenol fatty acid esters, respectively dissolving the p-nitrophenol fatty acid esters in acetonitrile to prepare a substrate solutionof 10mmol/L, and performing enzyme activity determination according to the esterase determination conditions.

As can be seen from Table 1, the thermophilic esterase/phospholipase A₂The p-nitrophenol palmitate and the p-nitrophenol stearate do not show catalytic activity on substrates; the p-nitrophenol caprylate and the p-nitrophenol lauric acid ester are taken as substrates and have partial activity; the highest activity was shown when p-nitrophenol propionate was used as substrate. It can thus be seen that short chain fatty acid esters are suitable substrates for enzymes. Short-chain fatty acid ester is widely present in grease and chemical products, so that the enzyme disclosed by the invention has wide application in the fields of biochemical engineering, grease processing, tool enzyme and the like.

TABLE 1 substrate specificity of the thermophilic enzymes

Relative substrate Activity (%)

P-nitrophenol propionate 100.0

P-nitrophenol octanoate 79.5

P-nitrophenol laurate 23.7

P-nitrophenol palmitate 0

P-nitrophenol stearate 0

(4) Temperature and pH stability

The purified enzyme was incubated at various temperatures (50-100 ℃ C.) (pH8, Tris-HCl) for one hour, then rapidly cooled, and the residual enzyme activity was measured. The result is shown in FIG. 6(a), which shows that the residual enzyme activity of the enzyme is still 76.64% after the enzyme is subjected to heat preservation at 80 ℃; the residual enzyme activity at 90 ℃ is 68.23%; the residual enzyme activity at 95 ℃ is 53.56%, which indicates that the thermal stability of the enzyme is higher.

The enzyme solution obtained in the present invention was placed in 50mM buffers (pH5.0-7.0, phosphate buffer; pH7.5-8.8, Tris-HCl buffer; pH9.0-11.0, Gly-NaOH buffer) of different pH, and left at room temperature for 24 hours, and the residual activity was measured at 70 ℃. As can be seen from FIG. 6(b), the enzyme has high stability in the alkaline (pH6-10) range, and the residual enzyme activity is above 60%.

(5) Effect of Metal ions on enzyme Activity

5 inorganic ions (Na) were tested⁺、K⁺、Ca²⁺、Mg²⁺And Zn²⁺) The effect on the enzyme activity at a concentration of 1mmol/L (Table 2). The results show that all metal ions have no obvious activation effect. Zn²⁺Has strong inhibiting effect on enzyme, and other ions also have certain inhibiting effect. Therefore, when using the enzyme, the presence of high concentrations of metal ions should be avoided.

2. Effect of Metal ions on enzyme Activity

Relative activity of Metal ion (U/mg) (%)

Control 171.89100.00

Na⁺100.58 58.51

K⁺135.58 78.88

Ca²⁺141.28 82.11

Mg²⁺123.23 71.60

Zn ²⁺0 0

The present disclosure is believed to provide those skilled in the art with a full range of applicability. The foregoing preferred embodiments are therefore to be understood as merely illustrative and not limiting of the scope of the invention in any way. Various alterations and modifications may be made by those skilled in the art without departing from the spirit and scope of the invention.

Attached: the invention relates to a nucleotide sequence of a thermophilic esterase/phospholipase A2 gene and an amino acid sequence of the thermophilic esterase/phospholipase A2 gene (1), a nucleotide sequence table of a thermophilic esterase/phospholipase A2 gene of SEQ ID NO.1, a thermophilic esterase/phospholipase gene and engineering bacteria of<110>Jilin university<120>, enzyme and its application<160>2<210>1<211>477<212>DNA<213>archaea (Aerobic Hyper-thermophilic crenarchaeon, Aeropyrum pernix K1)<220>CDS<221>(222). (1). -. (477)<400>1GTG GGT GTT AAC GAG GCT TAC GAG GCG CTG CTC CGA GCC TGT GGC GACVal Gly Val Asn Glu Ala Tyr Glu Ala Leu Leu Arg Ala Cys Gly Asp 151015 GGG GAT TTT GAA GAG TGC AGG AGC GGC TAC CAA AGG TTT CTA GAA GAGGly Asp Phe Glu Glu Cys Arg Ser Gly Tyr Gln Arg Phe Leu Glu Glu.

20 25 30GCG TGC AGG GAG GCT GGC ACG TGT CCT AAG AGG AGG TCC TCG GGC GCTAla Cys Arg Glu Ala Gly Thr Cys Pro Lys Arg Arg Ser Ser Gly Ala

35 40 45GGC CGG GGG AAA TAC GTG TGG GTG GAG AGC ATA ATC AGG TCT GGA GTGGly Arg Gly Lys Tyr Val Trp Val Glu Ser Ile Ile Arg Ser Gly Val

50 55 60CCC GAC GGG CGC TCT AGG CTG ATA CTC TAC GTT ATA AGC AGG TAT CTTPro Asp Gly Arg Ser Arg Leu Ile Leu Tyr Val Ile Ser Arg Tyr Leu65 70 75 80GTC AAC GTT AAG GGT CTA GAG CCC GGT GAG GCT GAG GCT GTC ATA GACVal Asn Val Lys Gly Leu Glu Pro Gly Glu Ala Glu Ala Val Ile Asp

85 90 95GAG TTC CTG AGG GTC TGC TGC GAG AAG CAC GGC AAC TGC AGG AAA ATCGlu Phe Leu Arg Val Cys Cys Glu Lys His Gly Asn Cys Arg Lys Ile

100 105 110TAC AAA TCA TGG ATT AGG AAC GTG CTC AGG AGG GTT AGG GAG GGT GGGTyr Lys Ser Trp Ile Arg Asn Val Leu Arg Arg Val Arg Glu Gly Gly

105 120 125TGG AGG CCC TGG ACG CTG GAG AGA ATC AGG AGC GAG GAC CCG GAG CTCTrp Arg Pro Trp Thr Leu Glu Arg Ile Arg Ser Glu Asp Pro Glu Leu

130135140 TAC AGG ATT ATA GAG CCT ATA GTG TCC GCC GGC GGA GGC TAA 477Tyr Arg Ile Ile Glu Pro Ile Val Ser Ala Gly Gly Gly (. about.) -145150155 (2) SEQ ID N0.2 thermophilic esterase/phospholipase A2 amino acid sequence Listing<210>2<211>157<212>PRT<213>archaea (Aerobic Hyper-thermophilic crenarchaeon, Aeropyrum pernix K1)<400>2Val Gly Val Asn Glu Ala Tyr Glu Ala Leu Leu Arg Ala Cys Gly Asp l 51015 Gly Asp Phe Glu Glu Cys Arg Ser Gly Tyr Gln Arg Phe Leu Glu Glu

20 25 30Ala Cys Arg Glu Ala Gly Thr Cys Pro Lys Arg Arg Ser Ser Gly Ala

35 40 45Gly Arg Gly Lys Tyr Val Trp Val Glu Ser Ile Ile Arg Ser Gly Val

50 55 60Pro Asp Gly Arg Ser Arg Leu Ile Leu Tyr Val Ile Ser Arg Tyr Leu65 70 75 80Val Asn Val Lys Gly Leu Glu Pro Gly Glu Ala Glu Ala Val Ile Asp

85 90 95Glu Phe Leu Arg Val Cys Cys Glu Lys His Gly Asn Cys Arg Lys Ile

100 105 110Tyr Lys Ser Trp Ile Arg Asn Val Leu Arg Arg Val Arg Glu Gly Gly

105 120 125Trp Arg Pro Trp Thr Leu Glu Arg Ile Arg Ser Glu Asp Pro Glu Leu

130 135 140Tyr Arg Ile Ile Glu Pro Ile Val Ser AlaGly Gly Gly(*)145 150 155

Claims (11)

1. Thermophilic esterase/phospholipase A₂The nucleotide sequence of the gene is shown in SEQ ID NO. 1.

2. Thermophilic esterase/phospholipase A₂The engineering bacteria are preserved in China general microbiological culture Collection center (CGMCC) at 12 months and 02 days in 2002, and the preservation number is CGMCC No 0844.

3. Thermophilic esterase/phospholipase A₂The construction method of engineering bacteria includes 4 steps of archaea culture, target gene fishing, expression vector construction and vector transformation into host cell

4. The thermophilic esterase/phospholipase A of claim 3₂The construction method of the engineering bacteria is characterized by comprising the following steps: the vector used is a eukaryotic or prokaryotic expression vector.

5. The thermophilic esterase/phospholipase A of claim 4₂The construction method of the engineering bacteria is characterized by comprising the following steps: the vector used was pET15 b.

6. The thermophilic esterase/phospholipase A of claim 3₂The method for constructing the engineered bacterium, wherein the host cell used is not limited to any particular host cell, as long as it can express the recombinant expression vector.

7. The thermophilic esterase/phospholipase A of claim 6₂The construction method of the engineering bacteria is characterized by comprising the following steps: the host cell used was E.coli BL21(DE3) CodonPlus.

8. Thermophilic esterase/phospholipase A₂The amino acid sequence is shown in SEQ ID NO. 2.

9. The thermophilic esterase/phospholipase A of claim 8₂The method is characterized in that:

(1) the catalytic activity is shown at 50-100 ℃, and the optimal reaction temperature of the enzyme activity is 90 ℃;

(2) can effectively catalyze the hydrolysis of p-nitrophenol propionate, p-nitrophenol caprylate, p-nitrophenol laurate or NBD-lecithin;

(3) the enzyme has high stability within the pH range of 6-10, and the residual enzyme activity is above 60%.

10. The thermophilic esterase/phospholipase A of claim 8 or 9₂The method can be applied to the fields of biochemical engineering, oil processing, tool enzyme and the like.

11. Preparation of the thermophilic esterase/phospholipase A enzyme of claim 8 or 9₂The method comprises the steps of fermentation and centrifugation of engineering bacteria, collection and precipitation, freeze thawing, ultrasonic crushing, heat treatment, affinity chromatography and the like.

Images