CN100587072C

CN100587072C - Thermophilic esterase/phosphatidase gene, engineering bacteria, enzyme and use thereof

Info

Publication number: CN100587072C
Application number: CN03111700A
Authority: CN
Inventors: 冯雁; 曹淑桂; 卢冬梅; 高仁钧; 韩四平; 任晓东
Original assignee: Jilin University
Current assignee: Jilin University
Priority date: 2003-05-16
Filing date: 2003-05-16
Publication date: 2010-02-03
Anticipated expiration: 2023-05-16
Also published as: CN1451751A

Abstract

A gene of the thermophilic lipase/phosphatidase A2, the engineering bacterium expressed by its recombinant vector in host, the thermophilic lipase/phosphatidase constructed with said engineering bacterium and the industrial use of said enzyme are disclosed. Said enzyme A2 is prepared from the thermophilic Aeropyrum pernix K1 through constructing engineering bacterium, fermenting, centrifugal separation, collecting deposit, freeze thawing, ultrasonic breaking, heat treating, and affinity chromatography.

Description

Thermophilic esterase/phospholipase gene, engineering bacteria, enzyme and application thereof

Technical field:

The invention belongs to bioengineering field, be specifically related to a kind of thermophilic esterase/phospholipase A ₂Gene, the engineering bacteria of in the normal temperature host, expressing by this gene recombined vector, the thermophilic esterase/phospholipase A that utilizes this project bacterium to make up ₂And the application of this enzyme in industry.

Background technology:

From first kind of Zimadzhunt L 340 in 1985 was after the TaqDNA polysaccharase is successfully used to polymerase chain reaction (PCR), was grown in the positive paid more and more attention of microorganism under the special high thermal environment.Many Zimadzhunt L 340s (thermophilic enzyme, 55-80 ℃) with hydrolytic enzyme activities have obtained exploitation in succession, and have brought into play vital role in a lot of fields.In recent years, people separate from the thermophilic Archimycetes of oceanic heat flow and obtain super Zimadzhunt L 340 (hyperthermophilic enzyme, 80-113 ℃), for modern enzyme engineering technology has represented new application prospect (Wang Baijing etc., the microorganism journal, 2002,42:259-262; Fujiwara S, et al.J.Biosci.Bioeng.2002,94 (6): 518-525).Zimadzhunt L 340 not only has the incomparable advantage of chemical catalyst, and is strong as catalytic efficiency height and Substratspezifitaet, and the excellent stability of enzyme.Warm enzyme (mesophilic enzyme during it can overcome, 20-55 ℃) and cold-adapted enzyme (psychrophilic enzyme,-2-20 ℃) the unsettled phenomenon of biological property that in application process, usually occurs, thereby a lot of high-temperature chemical reactions are achieved, this will greatly promote the development of biotechnology industry, motivate technical transformation of the factory with financial strength the raising of level and quality of life.

Utilize Zimadzhunt L 340 as biological catalyst following advantage to be arranged: the preparation cost of (1) zymin reduces.Because the stability of Zimadzhunt L 340 is high, thereby can at room temperature separate and purify and packed and transported, and can keep active muchly; (2) accelerate kinetic reaction.Along with the raising of temperature of reaction, molecular motion speeds up, and the enzyme catalysis ability is strengthened; (3) reduced energy consumption.Because react under high-temperature condition, therefore the standard that requires to the reactor cooling system reduces; (4) improved degree of purity of production.Under the Zimadzhunt L 340 catalytic reaction condition (above 70 ℃), assorted bacterium existence is seldom arranged, thereby reduced the pollution of bacterium metabolite final product.Because the pyroreaction activity of Zimadzhunt L 340, and to the strong resistance of organic solvent, stain remover and denaturing agent, make its potentiality that all are widely used at aspects such as food, medicine, process hides, oil production and waste treatment.

Esterase (Esterases, EC 3.1.1.1) is the serine hydrolase class that a class is distributed widely in tissue and organ, can many endogenous and the exogenous materials that contain carboxylic ester bond, thioester bond, amido linkage of hydrolysis.Its major function in vivo is the integrity that participates in lipid metabolism, signal conduction and keep biofilm structure; External be mainly used in the ester hydrolysis and in organic phase, finish numerous reactions such as esterification, transesterify (Klibanov A M.2001, Nature, 409:241-246).Utilize the stereospecificity of esterase, can also the catalysis asymmetry react, prepare many chemical methods that utilize and be difficult to synthetic chipal compounds (as liquid crystal, optical activity medicine and agricultural chemicals etc.).In recent years, along with developing rapidly of Protocols in Molecular Biology, very active abroad to clone's research of esterase gene, controlled and the expression of existing several microorganism esterase genes, for thermostability and the substrate specificity that improves esterase, use rite-directed mutagenesis and orthogenesis technology and enzyme has been carried out molecular modification (Giver JC, Arnold FH, Proc.Natl.Acad.Sci.USA.1998,95:12809-13; Henke E, Bornscheuer UT, Biol.Chem., 1999,380:1029-33).Because thermophile bacteria microorganism culturing condition harshness, therefore also seldom for the research of thermophilic esterase.

Phospholipase A ₂(PLA ₂), systematic name is a phosphatidyl 2-ester acyl lytic enzyme (phosphatidylcholine-2-acylhydrolase), second ester acyl key of its energy enzymically hydrolyse glyceryl phosphatide generates lysophospholipid and lipid acid, is shown below:

(ovum) phosphatide haemolysis (ovum) lipoid fatty acid

PLA ₂Have a lot of biological functions,, participate in many physiological activities,, thereby cause domestic and international researcher's extensive concern as lipid digestion and metabolism, signal conduction and the process that diminishes inflammation as neurotoxin, myotoxin and cardiotoxin.At present, the domestic snake PLA that mainly concentrates on ₂Research; Abroad to snake venom PLA ₂Clone, expression and crystalline structure simulation etc. all have play-by-play, in addition to bee venom PLA ₂DNA reorganization and structure also carried out preliminary study, but these enzyme great majority belong in warm enzyme.And thermophilic PLA ₂, Archimycetes Zimadzhunt L 340 PLA particularly ₂Research also be in the starting stage, till now, only in Pyrococcus horikoshii, found thermophilic PLA ₂Vigor (Feng, Y., et al.American Oil Chemistry Society, 2000,77:1147-1152.), but because the complicacy of its molecular structure, the thermophilic PLA of construction expression successfully not also ₂Engineering bacteria.

PLA ₂Having important use in oil prodution industry is worth.In carrying out high-quality grease production process, need the processing of coming unstuck of grease be decomposed into water miscible phospholipid derivative with the fat-soluble phospholipid molecule that mixes in grease, thereby remove phosphatide, improve greasy purity and quality.In high-quality grease production such as salad oil, usually adopt chemical method and physics method to come unstuck at present, but this method not only complex process, cost height, and also seriously polluted.Over past ten years, ground such as Europe such as Germany have attempted using enzyme process that this technology is transformed (K.Dahlke and H.Buchold, Information, 1995,6 (12): 1284-1291).They use pig pancreas Phospholipid hydrolase conversion phospholipid molecule and have obtained good effect.Not only production efficiency improves, and production cost has also reduced by 43%.Because security and high efficiency that zymin is produced, this method has obtained noting widely, Xi'an Oil ﹠ Fat Sci. Research ﹠ Design Inst., Ministry of Domestic Trade and grease company limited of Tianjin the Zhengda Group also personnel of fabric study have carried out studying (Liu Zhifeng to enzyme method technique, Gao Zhongxia, the new development of fats and Oils Refining Technology, Chinese oil, 1998,23 (2): 3).But also do not reach industrial scale at present, still rest on conceptual phase.Main problem is used pig pancreas Phospholipid hydrolase poor heat resistance (at 60 ℃ with the interior catalysis activity of putting up the best performance), and the higher temperature (70-80 ℃) of fat degumming process need.Conventional enzyme is because the restriction of temperature of reaction makes the production efficiency of the process of coming unstuck and cost all not reach optimum extent.

So,, seek the esterase and the phospholipase A that under hot environment, still have the greater catalytic vigor for being applied to the reaction system of comparatively high temps ₂Be very important, and will help finding and preparation new type high temperature lytic enzyme the exploitation of thermophilic Archimycetes functional protein.

Summary of the invention

One of purpose of the present invention is to extract a kind of thermophilic esterase/phospholipase A in the thermophilic Archimycetes ₂Gene;

Another object of the present invention is to utilize above-mentioned thermophilic esterase/phospholipase A ₂Gene makes up a kind of thermophilic esterase/phospholipase A by biotechnology ₂Engineering bacteria;

A further object of the present invention is to utilize above-mentioned thermophilic esterase/phospholipase A ₂Engineering bacteria prepares a kind of good stability, thermotolerance is strong, catalytic efficiency is high thermophilic esterase/phospholipase A ₂

Last purpose of the present invention is by to thermophilic esterase/phospholipase A ₂The research of physico-chemical property, thermophilic esterase/phospholipase A is provided ₂Multiple use in industrial production.

Thermophilic Archimycetes Aeropyrum pernix K1 derives from crater, Japanese deep-sea, and optimum growth temperature is 95 ℃.We find that in previous work the expressed albumen of this bacterium has thermophilic esterase and phospholipase A simultaneously ₂Vigor, therefore can will express thermophilic esterase/phospholipase A in its dna molecular ₂Active gene order is called thermophilic esterase/phospholipase A ₂Gene.Because thermophilic Archimycetes (comprising the thermophilic Archimycetes that derives from crater, Japanese deep-sea) artificial culture difficulty, growth cycle is longer, contained thermophilic esterase/phospholipase A ₂Amount very low, therefore can not directly utilize the Archimycetes culture to produce thermophilic esterase/phospholipase A ₂With thermophilic esterase/phospholipase A ₂Gene changes over to and can breed fast, in the simple normal temperature host of culture condition such as the intestinal bacteria, can address the above problem effectively.

The thermophilic Archimycetes Aeropyrum pernix K1 that derives from crater, Japanese deep-sea is angled and gets by cultivation, goal gene; obtain thermophilic protein gene of the present invention; we entrust precious biotechnology (Dalian) company limited to carry out gene sequencing, and its nucleotide sequence is shown in sequence table SEQ ID NO.1.

We are loaded in the Zimadzhunt L 340 gene on the pET system carrier, are transferred to then in the escherichia coli host, obtain a strain engineering bacteria (called after: JDA1).This project bacteria strain is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center on December 02nd, 2002, and deposit number is CGMCC No.0844.Classification name: colon bacillus (Escherichia coli).

The engineering bacterium expression product is the cell soluble proteins, by cell ultrasonication, heated and inactivated intestinal bacteria foreign protein, can carry out separation and purification and obtain thermophilic protein.

Use the thermophilic protein of colibacillus engineering (JDA1) expression and identify not only have phospholipase A through activity experiment ₂Activity also has esterase activity; This thermophilic protein is thermophilic esterase/phospholipase A of the present invention ₂, its aminoacid sequence is shown in sequence table SEQ ID NO.2, and it has common esterase and phospholipase A ₂Not available advantage can have the ability of very strong high temperature resistance and chemical substance sex change in catalyzed reaction under the hot conditions (80-100 ℃); Apply in the production, have carrying cost low, accelerate kinetic reaction, to advantages such as the reactor cooling systematic requirement criteria are low.This recombinase is can catalysis ester synthetic, transesterify and ester hydrolysis reaction, all has the important use potentiality in fields such as biochemical industry, fat degumming, toolenzymes.

With thermophilic esterase/phospholipase A of the present invention ₂The reorganization of gene and expression vector forms recombinant expression vector, the invention is not restricted to specific expression vector, and preferred expression vector adopts eucaryon or prokaryotic expression carrier, further pET15b carrier preferably.

Above-mentioned recombinant expression vector can import suitable host cells according to a conventional method, and suitable host cells comprises prokaryotic cell prokaryocyte and eukaryotic cell.The present invention is not limited to any specific host cell, as long as it can express described recombinant expression vector.In a preferred embodiment, the present invention uses E.coli BL21 (DE3) codon plus bacterial strain.

All basic molecular biology operations are all with reference to " molecular cloning experiment guide " (third edition, Science Press, 2002) in the above technical scheme.

Thermophilic esterase/phospholipase A of the present invention ₂The substrate scope that catalyzed reaction is utilized is not limited to materials such as any specified ester class, phospholipid, organic acid, alcohol, as long as can participate in hydrolysis, chemical substance synthetic, that transesterification reaction takes place can.In a preferred embodiment, the present invention uses p-NP fatty acid ester and NBD-Yelkin TTS (1-hexadecanoyl-2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) aminohexanoyl]-sn-glycero-3-phosphochol ine, NBD-PC) as substrate.

The substrate of this enzyme is not limited to materials such as any specified ester, phosphatide, organic acid, alcohol, all is the suitable substrates of this enzyme as long as can participate in ester hydrolysis, ester chemical substance synthetic and transesterification reaction.

Thermophilic Archimycetes Aeropyrum pernix K1, e. coli bl21 (DE3) the Condon Plus and the pET15b carrier that derive from crater, Japanese deep-sea that reaches of the present invention is the public raw material of biotechnology those of ordinary skill, can obtain from multiple channel.

The thermophilic Archimycetes Aeropyrum pernix K1 that reaches described in the present invention is a kind of known bacterial classification, it is found near the submarine volcano mouth Japan Kagoshima in 1993, and be stored in 1996 Japan " the RIKEN microorganism preserve and arrange (Japan Collection of Microorganisms; RIKEN (The Institute ofPhysical and Chemical Research) .2-1 Hirosawa; Wako; Saitama 351-0198, Japan; Phone:+81 48,467 9560, Fax:+81 48 462 4617) ", preservation is encoded to JCM9820 ^TAt document (Complete GenomeSequence of an Aerobic Hyper-thermophilic Crenarchaeon, Aeropyrum pernix K1, DNAResearch 6,83-101 (1999)) 90-101 page or leaf play-by-play the whole genome sequence of this thermophilic Archimycetes, the 83-85 page or leaf of the document has been described characteristics such as this bacteria growing temperature, having put down in writing is to obtain employed experiment material of whole genome sequence and method, and experimental result and data analysis discussion etc.This area any grinds the personnel of making internal disorder or usurp and can fully understand Aeropyrum pernix K1 bacterial classification by the document, so this bacterial classification has been a kind of known products, and anyly can buy from Japanese RIKEN with the form of commodity per capita.Document (Heterogeneous yet similar introns reside in identical positions of the rRNA genesin natural isolates of the archaeon Aeropyrum pernix, Gene 295 (2002) 43-50) then reported and use thermophilic Archimycetes Aeropyrumpernix K1 to carry out the research work of rDNA aspect, mentioned this place, bacterium source equally for first section of 44 pages of right hurdles of article, envrionment temperature, the pH value, some basic information such as cultivation and acquisition mode, the while has also been pointed out the preservation unit and the numbering (JCM9820) of this bacterial classification.This shows that those skilled in the art has carried out research work with regard to having used this bacterial classification before 2002.

In this patent, use prokaryotic expression plasmid pET15b carrier, it is present technique field personnel's common carrier, it can be available from U.S. Novagen company, the network address of the said firm is: http://www.Novagen.com, on the website of the said firm, listed the carrier that comprises pET15b, and information such as performance of various carriers, price, document (PET _15b-BCG HSP65-GP ₂Construction of recombinant plasmid and evaluation ", Bengbu Medical College's journal the 27th the 5th phase of volume of September in 2002,383-384; Wang Lijuan etc.), document 5 (expression of gene in P.pastoris and E.coli of growth factor of human nerve β subunit ", Science Bulletin, the 44th the 66th phase of volume of March in 1999,637-642) used carrier all is available from the said firm.On the other hand, because of this carrier uses general, worldwide scientific research cooperation is close day by day, this carrier also can be to buy back cultivation storage by the researchist in this area from commercial company also to grant mutually, as document (clone of human endostatin gene and expression product anti-tumor activity thereof "; Nanjing medical academy journal, the 24th the 1st phase of volume of March in 2002, record 1-3).

Using e. coli bl21 (DE3) Condon Plus in this patent is a kind of bacterial strain of intestinal bacteria (Escherichiacoli), it is a kind of host cell that generally uses in this area, as document (Functionalidentification of AtTPS03 as (F)-β-ocimene synthase:a monoterpene synthasecatalyzing jasmonate-and wound-induced volatile formation in Arabidopsisthaliana, Planta (2003) 216:745-751) the 746th page described, the document is transformed into plasmid pSBET-AtTPS03 in this host cell, expressed enzyme AtTPS03, and relevant experiment material and method has been described.In 746 pages of right hurdles of the document, pointed out the source of this bacterium simultaneously, i.e. Startagene company, the network address of the said firm is: Http:// www.stratagene.com/homepage/, on the homepage of the said firm, introduced composition, history, contact method and the main products classified catalogue of the said firm, want to buy the client of biological technology products, by the given contact method of the said firm, promptly available corresponding product.The e. coli bl21 that we mention in this patent (DE3) Condon Plus belongs to the Cloning class, or enters behind the search column input BL21 (DE3) of homepage.At document (Geobacter sulfurreducens Has Two Autoregulated LexA Genes Whose ProductsDo Not Bind the recA Promoter:Differing Responses of lexA and recA to DNADamage; Journal of Bacteriology, Apr.2003, p2493-2502) in, used this bacterial classification equally, these show that this bacterial classification widely uses in this area, and can obtain from public's channel.

Description of drawings

Fig. 1. thermophilic esterase/phospholipase A ₂The gene sequencing spectrogram;

Fig. 2. the recombinant expression vector synoptic diagram;

Thermophilic esterase/phospholipase A that Fig. 3 purifying obtains ₂Electrophoretogram;

Fig. 4 thermophilic esterase/phospholipase A ₂Temperature-vigor curve;

Fig. 5. thermophilic esterase/phospholipase A ₂PH-vigor curve;

Fig. 6. thermophilic esterase/phospholipase A ₂Temperature and pH beta stability line;

Embodiment

Embodiment 1: the structure of Zimadzhunt L 340 engineering bacteria and the expression of enzyme thereof

(1) cultivation of thermophilic Archimycetes Aeropyrum pernix K1 and the extraction of chromosomal DNA thereof.

Get 37.4g Bacto marine broth 2216 (Difco) (substratum) and be dissolved in the 990ml distilled water moist heat sterilization; Get 1.0g Na ₂S ₂O ₃5H ₂O (nutritive salt) is dissolved in the 10ml distilled water, joins in the substratum of sterilization after the degerming of 0.45m membrane filtration.The stem cell of Archimycetes Aeropyrum pernix K1 adds the 0.5ml substratum, is transferred in the test tube that the above-mentioned substratum of 5mL is housed mixing after the dissolving; Therefrom get 0.5ml and be transferred to the test tube that the 5ml fresh culture is housed, 90 ℃ of static cultivations 7 days.Be transferred in the Erlenmeyer flask that the 100ml substratum is housed 90 ℃ of shaking culture then 3 days ,-40 ℃ to preserve thalline standby.

Get the Archimycetes culture collection thalline of 1.5ml, with the resuspended precipitation of 25mmol/L Tris-HCl damping fluid (pH8.0 contains 50mmol/L glucose, 10mmol/L EDTA) of 200 μ L, add the 50mg/ml N,O-Diacetylmuramidase of 50 μ l, 4 ℃ digested 1 hour; The SDS solution (final concentration is 2%) that adds 125 μ l reacted 10 minutes; Add isopyknic phenol: chloroform: primary isoamyl alcohol, mixing centrifugal 5 minutes, is transferred to supernatant liquor in another centrifuge tube; The dehydrated alcohol that in precipitation, adds 2 times of volumes, the precipitation thallus DNA, centrifugal 5 minutes of 12000rpm, remove supernatant after, the washing with alcohol DNA with 70%; Remove supernatant after centrifugal, dissolve again with TE solution, gained chromosomal DNA solution is put in 4 ℃ of refrigerators standby.

(2) design of primers and angle the gene of getting enzyme to prepare recombinant vectors with the PCR method

Contain several sections possible lipase genes in the Archimycetes Aeropyrum pernix K1 genome.By order-checking, we select the gene of its nucleotide sequence shown in table SEQ ID NO.1 as research object, and are referred to as thermophilic esterase/phospholipase A ₂Gene.This enzyme gene increases from step (1) gained chromosomal DNA by known PCR method and obtains.Two primers are to cut the site according to the multienzyme of the sequence of this gene and expression vector to design, and it is synthetic to entrust Shanghai to give birth to worker bio-engineering corporation.

Upstream primer: TTTAGAATTCGCG CATATGGGTGTTAACGAGG, the line part is Nde I site;

Downstream primer: TTTTGGTACCTTA GGATCCAATTAGTGTTTAGCCTCCG, the line part is BamH I site.

Restriction enzyme site that two primers are set and NdeI and the BamHI of expression vector pET15b are complementary, and are suitable for efficiently expressing in intestinal bacteria.

PCR reaction: in 100 μ l reaction systems, contain 1 μ l Vent archaeal dna polymerase, 10 μ l Vent dna polymerase buffer liquid, 1.5 μ l dNTP mixtures (every kind of nucleotide concentration 25nmol/L), 4 μ l chromosomal DNAs, 1 μ l upstream primer, 1 μ l downstream primer, 81.5 μ l ultrapure waters.94 ℃ of sex change are 0.5 minute in every circulation, 55 ℃ of annealing 0.5 minute, and 72 ℃ were extended 1 minute, and last circulation is extended down to 10min, totally 35 circulations.Detect the PCR product with 2.0% agarose gel electrophoresis, molecular weight is consistent with (474bp) of expection.Use PCR product purification test kit that amplified production is carried out purifying.

The PCR product of purifying is cut with restriction enzyme BamH I enzyme, and 37 ℃ of following insulations added 1 μ l 0.5M NaCl after 1 hour, and 2 μ l Nde I are incubated 1 hour down at 37 ℃ again.Enzyme cuts complete, and electrophoresis on 2.0% sepharose is used the dna fragmentation after dna gel detection kit recovery enzyme is cut.

The method enzyme is cut the pET15b carrier like the application class, and then handles with alkaline phosphatase (CAP), detects the carrier after linear carrier and enzyme purification are cut in 0.7% sepharose.Use the T4DNA polysaccharase at 16 ℃ and connect esterase gene fragment and carrier.Connection carrier is changed among E.coli BL21 (DE3) the Codon Plus, carry out the screening and the evaluation of mono-clonal bacterial strain with the agarose plate that contains penbritin.Picking carrier from bacterium colony with restriction enzyme Nde I and BamHI effect carrier, obtains two fragments of size, and its size clip size with esterase gene and pET15b/NdeI+BamHI respectively is consistent.The building process of recombinant vectors as shown in Figure 2.

(3) expression of recombinant vectors in host bacteria

Recombinant vectors can be transformed in the host cells such as E.coli BL21 (DE3) and E.coli BL21 (DE3) Codon Plus, and the Zimadzhunt L 340 content of expressing in E.coli BL21 (DE3) Codon Plus is higher.Competent escherichia coli cell preparation and carrier method for transformation thereof are with reference to " molecular cloning experiment guide " book.The positive transformed bacteria of picking is put in the nutrient solution that 5ml contains penbritin 37 ℃ of shaking culture and is spent the night, and is inoculated into next day in the fresh LB substratum of 100ml, and 37 ℃ are continued to cultivate 4h.The seed liquor of tentatively amplifying is inserted in the nutrient solution of 2L with 1% ratio, cultivate in the concussion of air shaking table (37 ℃, 120rpm/min).Treat that thalli growth is to A ₆₀₀It is 0.6～1.0 o'clock, isopropylthio β-D-galactoside (IPTG) to the final concentration that adds 100mM is 1mM, reduces culture temperature to 25 ℃, thalline is induced make it produce a large amount of target proteins, cultivate and gather in the crops thalline after 10-12 hour, obtain engineering bacteria of the present invention.This project bacteria strain is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center on December 02nd, 2002, and deposit number is CGMCC No0844.Classification name: colon bacillus (Escherichiacoli).

Thalline in-30 ℃ freezing 1 hour, melt, add 50mM Tris-HCl (pH8.0) damping fluid of 5-10 times of volume of thalline, ultrasonication 10 minutes; In 85 ℃ of heat treated 30 minutes, (12000rpm 20min), collected supernatant and gets crude enzyme liquid the centrifugal intestinal bacteria foreign protein of removing sex change with broken liquid.

Because reorganization Zimadzhunt L 340 N-end contains His-Tag, application of nickel affinity column (Ni-Chelating Column) separates recombinant protein, combines with chromatography column with 100mM imidazoles wash-out and obtains Zimadzhunt L 340.Use the purity of SDS-PAGE (12%) electrophoresis detection recombinant protein, near visible visible electrophoretic band 18000Da, as shown in Figure 3.

Embodiment 2: reorganization thermophilic esterase/phospholipase A ₂Characteristic

(1) optimal reactive temperature

Temperature of reaction is the important factor that influences the enzyme catalysis vigor.Generally speaking, thermophilic esterase/phospholipase A ₂Reaction vigor at high temperature is higher than low temperature far away.Consider the stability of substrate, the top temperature that detects at this enzyme catalysis vigor only is 100 ℃.

As reaction substrate, in 50-100 ℃ temperature range, measure phospholipase A with NBD-PC ₂Vigor.By Fig. 4 (a) as seen, the rising with temperature in 50-90 ℃ of temperature range of its vigor improves, and more than 90 ℃, vigor descends, and optimum temperuture is 90 ℃.

With the p-NP propionic ester is substrate, and we have also studied the esterase activity of this recombinase under differing temps.The result is shown in Fig. 4 (b), and when temperature reached 90 ℃, this enzyme showed maximum catalysis activity.

Thermophilic esterase/phospholipase A ₂Vitality test: to have the fluorescently-labeled lecithin of NBD as substrate, fluorescence by the generation of observation NBD derivative, just can pass through the vigor that thin plate scanner (WALLAC ARTHUR, England, 1442MULTI-WAVELEN GTH FLUOROIMAGER) detects enzyme.

Get 20ul NBD-PC (0.1mg/ml is dissolved in chloroform) and put into the 2ml vial, nitrogen blowing is so that chloroform evaporated.Add 1.5ml Tris-HCl damping fluid (pH is 8.0, and final concentration is 50mmol/L) and 20ul enzyme liquid of the present invention, 90 ℃ of reactions were put termination reaction in the ice bath after 1 hour.(2: 1, v: v) join in the above-mentioned reaction solution, the jolting mixture was with extraction residual substrate and product NBD-acid with 3ml ethyl acetate/acetone.Centrifugal 10 minutes of 2500rpm collects upper solution (2.5ml), uses the nitrogen drying sample.With residual solid be dissolved in 150 μ l methyl alcohol/chloroforms (1: 1, v/v), get 10 μ l sample spot on thin plate, seasoning, use then chloroform/methanol/water (35: 65: 4, v/v/v) as developing agent, separate NBD Yelkin TTS-and NBD acid.

The detection of esterase activity: with the p-NP propionic ester as the lipase hydrolysis substrate, reaction system is 1ml, buffer system is 50mM Tris-HCl (pH8.0), the final concentration of p-NP octanoate is 0.2mM, the enzyme that adds 20ul, 70 ℃ of absorbance values of measuring 420nm with Hitachi's 557 type ultraviolet spectrophotometers.1 enzyme activity unit is that 1 minute hydrolysis substrate generates 1 μ mol p-NP (ε=0.016 μ M ^-1.cm ^-1) needed enzyme amount.

(2) optimal pH

Environment pH value can influence the conformation of charged amino acid whose dissociated state and enzyme in the enzyme molecule, and then influence the catalysis activity of enzyme.As substrate, measure the ratio of Zimadzhunt L 340 in pH 5-11 scope (pH 5.0-7.0, phosphoric acid buffer alive down with the p-NP propionic ester at 70 ℃; PH 7.5-8.8, the Tris-HCl damping fluid; PH 9.0-11.0, Gly-NaOH damping fluid), experimental result as shown in Figure 5, the hydrolysis of catalysis p-NP propionic ester effectively between pH value 7.5 to 8.5, and show that the optimal pH of enzyme of the present invention is 8.0.

(3) substrate specificity

Take by weighing various p-NP fatty acid esters, they are dissolved in the substrate solution that acetonitrile is made into 10mmol/L respectively, carry out enzyme activity determination with reference to above-mentioned esterase condition determination.

As shown in Table 1, thermophilic esterase/phospholipase A ₂Substrate p-NP palmitate and p-NP hard acid ester are not showed catalysis activity; With p-NP octanoate, p-NP laurate the part vigor is arranged when being substrate; Time performance has the highest vigor as substrate at the p-NP propionic ester.Therefore as seen, the fatty acid ester of short chain is the suitable substrate of enzyme.The fatty acid ester of short chain extensively is present in grease, the Chemicals, and therefore enzyme of the present invention has application widely in fields such as biochemical industry, grease processing, toolenzyme.

The substrate specificity of table 1. Zimadzhunt L 340

(4) temperature and pH stability

The enzyme of purifying placed (pH 8, and its residual enzyme activity is measured in Tris-HCl) damping fluid insulation cooling rapidly after a hour then under the differing temps (50-100 ℃).The result shows that this enzyme residual enzyme activity after 80 ℃ of insulations still is 76.64% shown in Fig. 6 (a); Residual enzyme activity in the time of 90 ℃ is 68.23%; 95 ℃ residual enzyme activity is 53.56%, and this thermostability that this enzyme is described is higher.

Gained enzyme liquid of the present invention is positioned over damping fluid (pH 5.0-7.0, the phosphoric acid buffer of the different pH of 50mM; PH7.5-8.8, the Tris-HCl damping fluid; PH 9.0-11.0, the Gly-NaOH damping fluid) in, placed 24 hours in room temperature, survey its remaining vigor for 70 ℃.By Fig. 6 (b) as can be seen, this enzyme is higher at alkalescence (pH 6-10) scope internal stability, and residual enzyme activity is more than 60%.

(5) metal ion is to enzyme influence alive

5 kinds of mineral ion (Na have been tested ⁺, K ⁺, Ca ²⁺, Mg ²⁺And Zn ²⁺) when concentration is 1mmol/L to the influence (table 2) of enzyme activity.The result shows that each metal ion species does not all have tangible activation.Zn ²⁺Enzyme is had outside the stronger restraining effect, and all the other ions also have certain restraining effect.Therefore when using this enzyme, should avoid the existence of high-concentration metallic ions.

2. metal ion is to the influence of enzyme activity

Content disclosed in this invention believes that those skilled in the art can use the present invention to greatest extent.Therefore the preferred specific embodiments of front should be understood that only to illustrate, but not limits the scope of the invention by any way.This area researchist can carry out various changes and improvement to the present invention under the situation that does not depart from its purport and scope.

Attached: thermophilic esterase involved in the present invention/Phospholipase A2 gene nucleotide series and thermophilic esterase/Phospholipase A2 aminoacid sequence

(1) SEQ ID NO.1 thermophilic esterase/Phospholipase A2 gene nucleotide series table

＜110〉Jilin University

＜120〉thermophilic esterase/phospholipase gene, engineering bacteria, enzyme and application thereof

<160>2

<210>1

<211>477

<212>DNA

＜213〉Archimycetes (Aerobic Hyper-thermophilic crenarchaeon, Aeropyrum pernix K1)

<220>

<221>CDS

<222>(1)...(477)

<400>1

GTG?GGT?GTT?AAC?GAG?GCT?TAC?GAG?GCG?CTG?CTC?CGA?GCC?TGT?GGC?GAC

Val?Gly?Val?Asn?Glu?Ala?Tyr?Glu?Ala?Leu?Leu?Arg?Ala?Cys?Gly?Asp

1 5 10 15

GGG?GAT?TTT?GAA?GAG?TGC?AGG?AGC?GGC?TAC?CAA?AGG?TTT?CTA?GAA?GAG

Gly?Asp?Phe?Glu?Glu?Cys?Arg?Ser?Gly?Tyr?Gln?Arg?Phe?Leu?Glu?Glu

20 25 30

GCG?TGC?AGG?GAG?GCT?GGC?ACG?TGT?CCT?AAG?AGG?AGG?TCC?TCG?GGC?GCT

Ala?Cys?Arg?Glu?Ala?Gly?Thr?Cys?Pro?Lys?Arg?Arg?Ser?Ser?Gly?Ala

35 40 45

GGC?CGG?GGG?AAA?TAC?GTG?TGG?GTG?GAG?AGC?ATA?ATC?AGG?TCT?GGA?GTG

Gly?Arg?Gly?Lys?Tyr?Val?Trp?Val?Glu?Ser?Ile?Ile?Arg?Ser?Gly?Val

50 55 60

CCC?GAC?GGG?CGC?TCT?AGG?CTG?ATA?CTC?TAC?GTT?ATA?AGC?AGG?TAT?CTT

Pro?Asp?Gly?Arg?Ser?Arg?Leu?Ile?Leu?Tyr?Val?Ile?Ser?Arg?Tyr?Leu

65 70 75 80

GTC?AAC?GTT?AAG?GGT?CTA?GAG?CCC?GGT?GAG?GCT?GAG?GCT?GTC?ATA?GAC

Val?Asn?Val?Lys?Gly?Leu?Glu?Pro?Gly?Glu?Ala?Glu?Ala?Val?Ile?Asp

85 90 95

GAG?TTC?CTG?AGG?GTC?TGC?TGC?GAG?AAG?CAC?GGC?AAC?TGC?AGG?AAA?ATC

Glu?Phe?Leu?Arg?Val?Cys?Cys?Glu?Lys?His?Gly?Asn?Cys?Arg?Lys?Ile

100 105 110

TAC?AAA?TCA?TGG?ATT?AGG?AAC?GTG?CTC?AGG?AGG?GTT?AGG?GAG?GGT?GGG

Tyr?Lys?Ser?Trp?Ile?Arg?Asn?Val?Leu?Arg?Arg?Val?Arg?Glu?Gly?Gly

105 120 125

TGG?AGG?CCC?TGG?ACG?CTG?GAG?AGA?ATC?AGG?AGC?GAG?GAC?CCG?GAG?CTC

Trp?Arg?Pro?Trp?Thr?Leu?Glu?Arg?Ile?Arg?Ser?Glu?Asp?Pro?Glu?Leu

130 135 140

TAC?AGG?ATT?ATA?GAG?CCT?ATA?GTG?TCC?GCC?GGC?GGA?GGC?TAA?477

Tyr?Arg?Ile?Ile?Glu?Pro?Ile?Val?Ser?Ala?Gly?Gly?Gly(*)

145 150 155

(2) SEQ ID NO.2 thermophilic esterase/Phospholipase A2 aminoacid sequence table

<210>2

<211>157

<212>PRT

<400>2

Val?Gly?Val?Asn?Glu?Ala?Tyr?Glu?Ala?Leu?Leu?Arg?Ala?Cys?Gly?Asp

1 5 10 15

Gly?Asp?Phe?Glu?Glu?Cys?Arg?Ser?Gly?Tyr?Gln?Arg?Phe?Leu?Glu?Glu

20 25 30

Ala?Cys?Arg?Glu?Ala?Gly?Thr?Cys?Pro?Lys?Arg?Arg?Ser?Ser?Gly?Ala

35 40 45

Gly?Arg?Gly?Lys?Tyr?Val?Trp?Val?Glu?Ser?Ile?Ile?Arg?Ser?Gly?Val

50 55 60

Pro?Asp?Gly?Arg?Ser?Arg?Leu?Ile?Leu?Tyr?Val?Ile?Ser?Arg?Tyr?Leu

65 70 75 80

Val?Asn?Val?Lys?Gly?Leu?Glu?Pro?Gly?Glu?Ala?Glu?Ala?Val?Ile?Asp

85 90 95

Glu?Phe?Leu?Arg?Val?Cys?Cys?Glu?Lys?His?Gly?Asn?Cys?Arg?Lys?Ile

100 105 110

Tyr?Lys?Ser?Trp?Ile?Arg?Asn?Val?Leu?Arg?Arg?Val?Arg?Glu?Gly?Gly

105 120 125

Trp?Arg?Pro?Trp?Thr?Leu?Glu?Arg?Ile?Arg?Ser?Glu?Asp?Pro?Glu?Leu

130 135 140

Tyr?Arg?Ile?Ile?Glu?Pro?Ile?Val?Ser?Ala?Gly?Gly?Gly?(*)

145 150 155

Claims

1, a kind of thermophilic esterase/phospholipase A ₂Gene, its nucleotide sequence is shown in SEQ ID NO.1.

2, colon bacillus (Escherichia coli) JDA1, it is deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center on December 02nd, 2002, and deposit number is CGMCC No0844.

3, the construction process of a kind of colon bacillus (Escherichia coli) JDA1 comprises that cultivation, the nucleotide sequence goal gene shown in SEQID NO.1 to the thermophilic Archimycetes Aeropyrum pernix K1 that derives from crater, Japanese deep-sea angles and get, construction of expression vector and carrier is transformed into 4 steps in E.coli BL21 (DE3) the Codon Plus host cell; It is characterized in that: goal gene angles and gets is to add 1 μ l Vent archaeal dna polymerase in 100 μ l reaction systems, 10 μ l Vent dna polymerase buffer liquid, 1.5 μ l dNTP mixture, wherein every kind of nucleotide concentration 25nmol/L, 4 μ l chromosomal DNAs, 1 μ l upstream primer TTTAGAATTCGCG CATATGGGTGTTAACGAGG, 1 μ l downstream primer TTTTGGTACCTTA GGATCCAATTAGTGTTTAGCCTCCG, 81.5 μ l ultrapure waters; 94 ℃ of sex change are 0.5 minute in every circulation, 55 ℃ of annealing 0.5 minute, and 72 ℃ were extended 1 minute, and last circulation is extended down to 10min, totally 35 circulations; Detect the PCR product with 2.0% agarose gel electrophoresis, with PCR product purification test kit amplified production is carried out purifying, the PCR product of purifying is cut with restriction enzyme BamH I enzyme, insulation is after 1 hour under 37 ℃, add 1 μ l 0.5M NaCl, 2 μ l Nde I are incubated 1 hour down at 37 ℃ again; Enzyme cuts complete, and electrophoresis on 2.0% sepharose is used the dna fragmentation after dna gel detection kit recovery enzyme is cut, and obtains the goal gene of nucleotide sequence shown in SEQ ID NO.1.

4, the construction process of colon bacillus according to claim 3 (Escherichia coli) JDA1, it is characterized in that: employed carrier is eucaryon or prokaryotic expression carrier.

5, the construction process of colon bacillus according to claim 4 (Escherichia coli) JDA1, it is characterized in that: employed carrier is pET15b.

6, the construction process of colon bacillus according to claim 3 (Escherichia coli) JDA1 is characterized in that: employed host cell is e. coli bl21 (DE3) CodonPlus.

7, a kind of thermophilic esterase/phospholipase A ₂, its aminoacid sequence is shown in SEQ ID NO.2.

8, the thermophilic esterase/phospholipase A of aminoacid sequence shown in SEQ ID NO.2 ₂In biochemical industry, grease processing, toolenzyme Application for Field.

9, the thermophilic esterase/phospholipase A of preparation aminoacid sequence shown in SEQ ID NO.2 ₂Method, comprise that colon bacillus (Escherichia coli) JDA1 fermentation is centrifugal, collecting precipitation, freeze thawing, ultrasonication, thermal treatment, affinity chromatography, purification step.