RU2500812C1 - Recombinant bacillus licheniformis bacteria strain-producer of heat-resistant lipase - Google Patents

Abstract

FIELD: biotechnologies.

SUBSTANCE: invention represents Bacillus licheniformis bacteria strain All-Russian collection of industrial microorganisms B-11302 - producer of heat-resistant lipase. At fermentation of the obtained strain in 3 l of a laboratory fermenter the ferment activity in culture liquid reaches the level of 500 U/ml.

EFFECT: invention allows obtaining heat-resistant lipase with high efficiency degree.

3 dwg, 5 ex

Description

The invention relates to microbiology and biotechnology and relates to a strain of Bacillus lichensformis, a producer of thermostable lipase enzyme.

Lipases - enzymes that hydrolyze triacylglycerides with the formation of fatty acids and glycerol, are used in the food industry, household chemicals, cosmetics and many other fields. Moreover, most industrial processes in which lipases are used are carried out at temperatures exceeding 45 ° C; therefore, thermostable lipases are of particular interest. In addition, since lipases, along with proteases and cellulases, are part of environmentally friendly detergents, the ability to work in the alkaline pH region is important for them.

Highly thermally stable lipases, the optimum temperature of which exceeds 70 ° C and reaches 95 ° C and was found in the extremely thermophilic anaerobic bacteria Thermosyntropha lipolytica [Journal of Industrial Microbiology & Biotechnology. - 2009. - V.36. - N.10. - P.1281-71], Caldanaerobacter subterraneus, Thermounuerobacler thermohydrosulfwicus [Extremophiles. - 2009. - V.13. - N.5. - P.769-83]. Fervidobacterium changbaicum [Appi Microbiol Biotechnol. - 2011. - V.89. - N.5. - P.1463-73]. However, a significant drawback of the characterized enzymes is their low specific activity - less than 60 units / mg protein.

Thermophilic lipases, the optimum activity of which lies in the temperature range 55-70 ° C and pH 8-10, are isolated from moderately thermophilic aerobic bacteria of the genus Bacillus [Molecular and Cellular Biochemistry. - 2006. - V.290. - N.1-2. - P.17-22, Protein Expr Purif. - 2009. - V.68. - N.2. - P.161-6] and Geobacillus (previously classified as Bacillus): [Journal of Molecular Catalysis B: Enzymatic. - 2003. - V.22. - N.5-6. - P.307-13, Methods in Enzymology. - 1997. - V.284. - P.194-220. Molecular Biotechnology. - 2008. - V.42. - N.1. - P.75-83].

Of the thermostable lipases described in the literature, BTL2 lipase from the strain Geobacillus thermocalenulatus DSM 730 has the highest specific activity, the temperature optimum of its specific activity lies in the range 60-75 ° C. Lipase is highly stable in the presence of detergents (except SDS) and organic solvents (methanol, acetone, isopropanol). The specific activity of the purified enzyme is 55,000 units / mg protein. However, the production of lipase by the natural strain is very small, and therefore it is advisable to use recombinant producers to obtain enzymes

Expression of the lipase gene in E. coli cells under the control of the strong temperature-inducible λP _L promoter. leads to the fact that most of the enzyme is transported to the periplasm [Journal of Biotechnology. - 1997 .-- V.56. - P.89-102]. The enzyme activity reaches 590 units / ml in tributyrin. However, to obtain the enzyme, a stage of cell destruction is required, which leads to an increase in the cost of the final product.

Expression of the thermostable lipase gene in P. pastoris results in secretion of the active enzyme into the culture fluid (up to 309 units / ml) [Protein Expression and Purification. - 2003. - V.28. - N.1. - P.102-1]. However, the specific activity of the enzyme for tributyrate is 23,000 units / mg (versus 55,000 units / ml for the native enzyme), and the cultivation of this producer requires the presence of methanol as an inducer and expensive media, which makes its use unprofitable.

Interest in the creation of highly effective lipase producers based on Bacillus licheniformis is associated with a fairly good genetic study of this object and the fact that this type of bacteria is convenient for industrial fermentation. B. licheniformis also attracts the attention of biotechnologists and geneticists with its thermal tolerance, which opens up the possibility of cultivation at elevated temperatures (up to 60 ° C), which prevents the contamination of the culture in a production fermenter.

In addition, work with B. licheniformis strains does not require special precautions, since this type of bacteria belongs to microorganisms that are not pathogenic for humans.

The technical task of the invention is the expansion of the arsenal of recombinant microorganisms that produce thermostable lipase.

The problem was solved by constructing a recombinant strain of bacteria Bacillus lichemformis VKPM B-11302, a producer of thermostable lipase.

The recombinant Bacillus lichemformis strain VKPM B-11302 was obtained from the Bacillus lichemformis 28KA strain (VKPM B-3039) by transforming the latter with an expression replicative plasmid derived from the pHY300PLK vector (J. Bacteriol (1983), 153, 813-821), named p- bt1 and containing the btl2 gene encoding thermostable BTL2 lipase from the Geohacillus thermocatenulatus DSM 730 strain.

The inventive strain of Bacillus lichemformis is deposited in the All-Russian collection of industrial microorganisms (VKPM) at 117545 Moscow, 1st Dorozhniy proezd, 1 and has a registration number VKPM B-11302.

The strain of Bacillus lichemformis VKPM B-11302 is characterized by the following features:

Cultural and morphological characters.

Gram-positive spore-forming rod-shaped bacterium. The daily culture in liquid LB medium (wt.%: Yeast extract - 0.5, peptone - 1, NaCl - 1, water - the rest) is represented by moving chains of 2-3 cells with rod-shaped cells 0.6-0.8 in size and 0.2-0.3 microns. By the third day, the chains break up and oval spores form, not exceeding the size of the cell, located centrally. When growing on an agarized LB medium, it forms colonies of irregular shape, mucous, smooth, opaque, 2-5 mm in diameter.

Physiological and biochemical characteristics. Obligate aerob. Sugar does not ferment. Assimilates: sucrose, D-glucose, L-arabinose, D-xylose. D-mannitol. Hydrolyzes casein and starch. It is characterized by reduced proteolytic activity and the ability to reduce nitrate.

The optimal pH for growth is 5.5-8.0. Capable of growing at 55 ° C. The optimum growth temperature is 30-40 ° C.

The inventive strain when grown in flasks on LB medium. able to produce thermostable lipase with activity up to 250 PIECES / ml of culture fluid, when grown in a laboratory fermenter - with activity up to 500 PIECES / ml of culture fluid

The invention is illustrated by the following figures of a graphic image:

Figure 1 Electrophoregram of PCR analysis of the studied strains using test primers.

Figure 2 Graph of the activity of recombinant and native thermostable lipase on temperature

Figure 3 A graph of the activity of recombinant and native thermostable lipase on the pH of the incubation medium

Obtaining and culturing a strain of Bacillus licheniformis VKPM B-11302 is confirmed by the following examples.

Example 1. Obtaining a strain of Bacillus licheniformis VKPM B-11302. Bacillus licheniformis is transformed by introducing DNA molecules into bacterial protoplasts under the osmotic pressure of a polyethylene glycol (PEG) solution (Harwood, C. R. & Cutting, S. M. (1990). Molecular Biological Methods for Bacillus. New York: Wiley. )

For the preparation of competent cells, the Bacillus licheniformis 28KA VKPM B-3039 strain is used. 1 μg of p-bt1 plasmid DNA is used as DNA. Transformants are selected on LB agar medium supplemented with the erythromycin antibiotic.

The presence of the target recombinant gene in the plasmid transformants is confirmed by PCR analysis.

From bacterial clones obtained as a result of genetic transformation, plasmid DNA is used as standard for polymerase chain reaction using specific test primers using standard methods.

The sequence of the test primers:

bt1-f AAACATATGATGAAAGGCTGCCGGGTGATGGTT

bt1-r AAATCGCGAATACAACTCAGGTGCTTGCT

PCR reaction mode:

95 ° C - 3 min. - 1 cycle

35 cycles:

95 ° C - 30 sec.

60 ° С - 30 sec.

72 ° C - 60 sec.

72 ° C - 5 min - 1 cycle.

To control the magnitude of DNA fragments during electrophoresis, the molecular marker O'GeneRuler 100 bp DNA Ladder is used (Fig. 1 line 1, fragment size 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1700, 2000 . 3000 bp, from top to bottom)

The accumulation of fragments of 420 bp using the test primers bt1-f and bt1-r confirms the presence of the target recombinant btl gene in the plasmids of the obtained Bacillus Ucheniformis 28KA / p-bt1 clones (Fig. 1, lines 2 and 3)

Transformed clones are cultured in a liquid medium in test tubes. Fermentation is carried out at 37 ° C on a shaker (250 rpm) in a nutrient medium LB in test tubes (50 ml) with a working volume of 10 ml. Sowing is carried out by a bacteriological loop.

Fermentation is continued for 24 hours. The specific activity of thermostable lipase is determined spectrophotometrically by hydrolysis of the chromogenic substrate of pyra-nitrophenyl butyrate (FEMS Yeast Res - 2002 - N.2 - P.371-379).

Lipolytic activity characterizes the ability of the enzyme to catalyze the cleavage of the substrate iara-nitrophenyl butyrate to Jord-nitrophenol and butanoic acid.

For a unit of lipolytic activity, take such an amount of enzyme that in 1 min hydrolyzes 1 μmol of substrate with the release of an equimolar amount of nitrophenol and fatty acids

According to the fermentation results, the claimed strain of Bacillus licheniformis VKPM B-11302 is selected, which, when cultured in LB medium. allows you to get a thermostable lipase with an activity of 240 IU / ml of culture fluid.

Example 2. Cultivation of a strain of Bacillus licheniformis VKPM B-l 1302 in laboratory conditions.

The culture of Bacillus licheniformis VKPM B-11302. grow in 5 ml of LB medium for 20 hours at 37 ° C with aeration on a rocking chair (250 rpm)

The inoculum is transferred to a 750 ml flask with 45 ml of fresh LB medium and grown at 37 ° C for 24 hours with aeration on a shaker (250 rpm).

After 5, 10, 15, 20, and 24 hours of cultivation, samples of a growing bacterial culture are taken, cells are precipitated by centrifugation, and the culture fluid is used to analyze specific lipase activity.

When fermented in flasks in a nutrient medium, the Bacillus licheniformis strain VKPM B-11302 synthesizes a thermostable lipase with an activity of 240 U / ml of culture fluid.

Example 3. Cultivation of a strain of Bacillus licheniformis VKPM B-11302 in a 3 L laboratory fermenter.

To obtain seed in vitro culture of Bacillus licheniformis VKPM B-11302. grow in 5 ml of LB medium for about 20 hours at 37 ° C with aeration (250 rpm). Then the culture from the tube is transferred into a flask with 50 ml of LB medium. Cultivated in a shaker-incubator (250 rpm) at 37 ° C for 24 hours.

The resulting seed was transferred to a 3 L fermenter and grown 48 hours in 1 liter of LB medium.

After 12, 24, 36, and 48 hours of cultivation, samples of a growing bacterial culture were taken, cells were precipitated by centrifugation, and the culture viability was used to analyze specific lipase activity.

When fermented in a 3 L laboratory fermenter, VKPM strain B-11302 synthesizes a thermostable lipase with an activity of 500 U / ml of culture fluid.

Example 4. The study of the temperature optimum of recombinant thermostable lipase.

To determine the temperature optimum of a recombinant thermostable lipase, the specific enzyme activity is measured at different temperatures by the hydrolysis of para-nitrophenyl butyrate. The results are shown in figure 2 (curve 2) in comparison with the similar values of the native thermostable lipase BTL2 from Geobacillus thermocatenulatus DSM 730 (curve 1).

It was shown that the temperature optimum of the action of the recombinant thermostable lipase is in the range of 45-60 ° C, while the temperature optimum of the native thermostable lipase lies in the range of 65-72 ° C.

Example 5. The study of the optimum pH of recombinant thermostable lipase.

The activity of thermostable lipase is measured at different pH values of the incubation medium by the hydrolysis of para-nitrophenyl butyrate. The data obtained are shown in figure 3 (curve 2) in comparison with the similar values of the native thermostable lipase BTL2 from Geobacillus thermocatenulatus DSM 730 (curve 1). show that the optimum pH of the recombinant thermostable lipase is in the pH range from 7.5 to 8.5 and almost coincides with the optimum pH of the native thermostable lipase.

Thus, the inventive strain of Bacillus lichemformis VKPM B-1130 produces a thermostable lipase with activity up to 500 u / ml of culture fluid, while the resulting enzyme retains the industrially valuable properties of the native enzyme.

Claims (1)

The recombinant strain of Bacillus licheniformis VKPM B-11302 is a producer of thermostable lipase.

Images