CN1435484A - Human lactoferritin gene-contg. gene recombinant methanol pichia P. pastoris - Google Patents

Abstract

A recombinant methanol yeast P.Pastoris 020105 containing human lactoferritin gene, CGMCC No.0702, is disclosed.

Description

The reorganization methyl alcohol pichia P.Pastoris that contains human lactoferrin gene

Technical field

The present invention relates to bio-science field, be specifically related to a kind of recombinant bacterial strain that can efficiently express human lactoferrin.

Technical background

Lactoferrin is a kind of glycoprotein in conjunction with iron ion, belongs to Transferrins,iron complexes family.Since the sixties in last century, it has higher content in human milk, has caused scientific circles' extensive concern (L nnerdal and Iyer, 1995).This albumen all has discovery in all Mammals milk, many researchs attempt to open biological function (Reiter, 1985 of lactoferrin; Sanchez et al.1992; Hambraeus and L nnerdal, 1994), it is generally acknowledged that the stronger activity in conjunction with iron in its function and it is relevant.But the function (L nnerdal and Iyer, 1995) irrelevant with combining iron ion of finding other arranged also.Many research carried out deep research (Steijns et al.2000) to its structure.Lactoferrin mainly is present in the intensive organs of external secretion body of gland such as digestive tube, respiratory tract, reproductive system.This distribution prompting lactoferrin has non-specific immune function.People not only find the lactoferrin of protection breast in mammary gland, existence is also arranged in tear, synovia, saliva, seminal fluid, and it is a kind of albumen (Inoue et al.1993) with defencive function.Table 1 is enumerated the content of lactoferrin in various liquid.Lactoferrin also is present in the blood, and also finding in the neutrophil leucocyte has lactoferrin, at the position of inflammation, will speed up lactoferrin (Britigan et al.1994 synthetic and that release stores; Levay ﹠amp; Vilioen, 1995).

The concentration of lactoferrin is regular change (Schanbacher et al.1997) in whole lactation period.Milk cow breeds phase, colostrum at mammary gland and forms period and mammary gland paracme, and the concentration of lactoferrin and mRNA thereof is higher, and normal lactation period lactoferrin concentration reduce, this period caseic concentration raise.The content of lactoferrin in the various juices of table 1.

Juice content
	Normal breast＞20 μ the g/ml of the normal breast of people's colostrum＞7mg/ml people＞1mg/ml tear＞2.2mg/ml refining～0.4-1.9mg/ml synovia～10-80 μ g/ml saliva～7-10 μ g/ml colostrum＞1.5mg/ml ox

Data source: Korhonen, 1977; Amold et al.1979; Renne et al.1989; Levay ﹠amp; Viljoen, 1995

Lactoferrin may have the effect of somatomedin and protect non-lactation period of mammary gland and protection newborn mammiferous effect (Steijns et al.2000).

Lactoferrin is a kind of single chain polypeptide albumen, and molecular weight is about 80KD, contains 1-4 the glycosylation site of having an appointment, and the quantity of glycosylation site depends on different species (Spik et al.1994).Bovinelactoferrin and human lactoferrin contain 689 and 691 amino acid respectively, 69% residue identical (Pierce et al.1991) is arranged in the aminoacid sequence, and people such as Baker have studied 3D conformation (the Haridas et al.1995 of Bovinelactoferrin and human lactoferrin in great detail; Moore et al.1997).Bonded polysaccharide unit structure is very big with the different difference of species on the lactoferrin, in this respect very detailed (the Coclcleville et al.1992 of the research of Spik and Mootreuil; Spik et al.1994).

The 3D structure of ox and human lactoferrin is closely similar, and the molecule of each lactoferrin comprises two homeodomains.Respectively at N end and C end.Each structural domain comprises two subdomains respectively, and two subdomains form a slit, Fe in the slit ³⁺Ion combines with two carboxyls.These subdomains are N1, N2 respectively; C1, C2, the aminoacid sequence 1-9 of Bovinelactoferrin and 251-233 constitute the N1 subdomain, and 91-250 constitutes the N2 subdomain.345-431,593-676 constitute the C1 subdomain.432-592 constitutes the C2 subdomain.Aminoacid sequence 334-344 forms a hinge, exercises the opening and closing function between the structural domain.The steady component of secondary structure relies on the disulfide linkage that forms between cysteine residues.In the subdomain slit with Fe ³⁺In conjunction with relevant amino-acid residue mainly is Asp60, Tyr92, Tyr192, His253 in the N end structure territory; Asp395, the Tyr433 in C end structure territory, Tyr526, His595 (Moore et al.1997; Haridas et al.1995).

Bovinelactoferrin has 5 N-glycosylation sites, is respectively Asn233, Asn281, Asn368, Asn476, Asn545, and chemical research shows to have only four N-glycosylations, and Asn281 is not used.There is high homology in the Asn476 site between the lactoferrin of different plant species.Bovinelactoferrin polysaccharide group mainly contains N-acetyl glucosamine ammonia, N-acetyl semi-lactosi ammonia, semi-lactosi, fructose, seminose and neuraminic acid (Spik et al.1994).

Under state of nature, Bovinelactoferrin has only the iron saturation ratio of 15-20%, and color is a pink.The depth of color and luster depends on the iron state of saturation, be commonly referred to deferrization lactoferrin (apolactoferrin) less than the lactoferrin of 5% iron saturation ratio, and the saturated lactoferrin of iron is commonly referred to full milk ferritin (hololactoferrin).Lactoferrin in the human milk mainly is the deferrization lactoferrin.

The avidity of lactoferrin and iron ion is very high, is 260 times of Transferrins,iron complexes in the blood.The affinity equilibrium constant is approximately 10 ²⁰(Baker et al.1994) iron ion depends on carboxyl on the peptide chain in conjunction with activity.Test and the rite-directed mutagenesis experiment confirm with substitutional ion: the size in lactoferrin ionic bond site, amount of charge, three-dimensional structure etc. all are suitable in conjunction with Fe ³⁺(Harrington et al.1987; Baker et al.1994; Brodie et al.1994; Faber et al.1997).Oxalic acid can be with Fe ³⁺From lactoferrin, cement out, but citric acid can not, citric acid can be in conjunction with lactoferrin in extracting the process of lactoferrin, this has reflected lactoferrin may combine with organic acid (Brodie et al.1994) in milk.High concentration of citric can influence lactoferrin in conjunction with iron ability (Reiter, 1985).

Other positively charged ion also can be incorporated in the molecule slit, at this moment can detect with the change of absorption peak.For example: Fe ³⁺Saturated lactoferrin maximum absorption band is 466nm, Cu ²⁺Saturated lactoferrin maximum absorption band is 434nm (Brodie et al.1994).Except Cu ²⁺Outside the ion, lactoferrin also can be in conjunction with Mn ³⁺, Co ³⁺, Zn ²⁺

Utilize site-directed mutagenesis technique, Ward et al. (1996) is purified into the lactoferrin of sudden change C-and N-structural domain from the transgenosis flavus, with the Fe of these two kinds of lactoferrins ³⁺Two Tyr residues of binding site become the Ala residue, and this discovers C end structure territory and Fe ³⁺Bonding force greater than N end structure territory.

For research ox, human lactoferrin N end structure territory and iron binding site, with 30KD trypsin hydrolyzing thing N ₄-N ₂₈₈(comprise subdomain N ₁, N ₂) and 20KD trypsin hydrolyzing thing N ₉₁-N ₂₅₁(comprise N ₂) discharge Fe at the lactoferrin that brings out with suitable pH ³⁺Experiment in, draw such conclusion, N ₂The disappearance of middle Asp60 does not influence in conjunction with Fe ³⁺Stability, found that in addition N end structure territory (30KD trypsin hydrolyzing thing) and C end structure territory (50KD trypsin hydrolyzing thing) mutually promote in conjunction with the stability of iron ion.Bovinelactoferrin at pH less than beginning to discharge Fe at 4 o'clock ³⁺And human lactoferrin at PH less than beginning to discharge Fe at 3 o'clock ³⁺, 30KD trypsin hydrolyzing thing (N end structure territory) behind de-glycosylation, lose about 50-100% in conjunction with Fe ³⁺Active (Legrand et al.1990).Do not find in conjunction with iron Disability (VanBerkel et al.1995) for the human lactoferrin of de-glycosylation.

The amino acid composition of ox and people's lactoferrin sees also table 2, and lactoferrin has higher iso-electric point, and form the PI that calculates by amino acid: Bovinelactoferrin is 9.4, and human lactoferrin is 9.5.But the measured value and the theoretical value of experiment differ bigger, because the difference of experimental technique, the iso-electric point measured value of Bovinelactoferrin is about 8 (Shimazaki et al.1993).And the iso-electric point of human lactoferrin is about 5.5-10 report is arranged all.This difference may be because the condition influence of protein isolate N terminal arginine residue be rich in the state in zone.

The content of various amino-acid residues in table 2. Bovinelactoferrin and the human lactoferrin

Amino-acid residue Bovinelactoferrin human lactoferrin

L-Ala 67 63

Dried meat ammonia enzyme 30 35

Arginine 39 43

Methionin 54 46

N 29 33

Xie Ansuan 47 48

Tryptophane 13 10

Halfcystine 34 32

Threonine 36 31

Isoleucine 15 16

Serine 45 50

Glutaminase 29 27

L-glutamic acid 40 42

Phenylalanine 27 30

Methionine(Met) 45

Leucine 65 58

Glycine 48 54

Tyrosine 22 21

Aspartic acid 36 38

Histidine 99

Amino-acid residue sum 689 691

Data rice source: Pierce et al. (1991)

In addition, the lactoferrin in the neutrophil leucocyte and the lactoferrin of mammary gland secretion are after Glycosylase digestion, and its character difference slightly when doing the SDS-PAGE gel electrophoresis again: the latter is than the former little 4KD.The lectin binding characteristic of people, Bovinelactoferrin is difference (Hurley et al.1993) slightly also.The lactoferrin of people, ox, pig has common antigenic determinant (Magnusson et al.1990).

The N end of the lactoferrin of people and Niu all has stronger alkalescence zone, and these many binding characteristics with lactoferrin are relevant, and lactoferrin and bacteria lipopolysaccharide have very high binding ability.This depends on his N1 subdomain, the binding ability of C-structure territory bacteria lipopolysaccharide than the low 100-130 of N structural domain doubly, with the human lactoferrin binding site be its 28-34 amino-acid residue, with the binding site of Bovinelactoferrin be its 17-41 amino-acid residue (Elass-Rochardet al.1995).With the N end parts of lactoferrin excision back research it with N,O-Diacetylmuramidase, lipopolysaccharides, heparin, the binding ability discovery lactoferrin of DNA and the binding ability and the Fe of these molecules ³⁺Saturation ratio irrelevant, but delete any one arginine residues (Arg ², Arg ³, Arg ⁴, Arg ⁵) will reduce the avidity of it and above-mentioned molecule, to excise manyly more, the avidity forfeiture is many more.If preceding five amino acid complete resection (Gly with the N end ¹-Arg ²-Arg ³-Arg ⁴-Arg ⁵) will lose whole binding abilities.Four arginine residues of this explanation N end participate in host's defense function (Van Berkel et al.1997).Removal N terminal arginine residue also can cause the reduction (Legrand et al.1997) of lactoferrin and T-cell binding ability.

Because lactoferrin is separated at first and to be defined as iron ion conjugated protein, characteristic is relevant therewith mostly in the research of early stage function aspects.Because of lactoferrin content in the milk of some species is very high, this proteic function is considered to be in and transports Fe between the mother and baby ³⁺The iron degree of saturation of lactoferrin is lower, and some investigator thinks that its major function is to suppress bacterium, and this hypothesis obtains the confirmation of experiment in vitro; Because lactoferrin and Fe ³⁺The combination degree height, so some investigator thinks that it has the function of eliminating interior free yl.Neutrophil leucocyte discharges a large amount of lactoferrins when being activated, so this albumen participates in intravital non-specific immunity again.

Some investigator finds that lactoferrin has some to combine irrelevant activity with iron ion, such as some features with somatomedin; Some function in immunity system does not rely on Fe ³⁺Degree of saturation etc.Table 3 has been summed up the article that some proof lactoferrins of delivering recently have multiple function.Need to prove that these biological functions are not isolated, can influence host immune by regulating growth such as lactoferrin.Lactoferrin also has some other effect, along with going deep into of research, will constantly be excavated.

The various biological function activity mechanism reference Fe of table 3. lactoferrin ³⁺Inhaling increases Fe ³⁺Solubleness, receptor-mediated suction Kawakami et al.1988,1993; Mikogami et al. receives 1995 anti-oxidant reduction Fe ³⁺Concentration Matsue et al.1994,1995 antibiotic reduction environment Fe ³⁺Concentration is destroyed cytolemma Reiter, 1985; Naidu and Amold, 1997 antiviral inhibition virus absorption Harmsen et al.1995; Marchetti et al.1996; Yi et

Al.1997 regulates and exempts to activate the NK cell, promotes the T-cell to become Zimecki et al.1991; Cohen et al.1992; The ripe Baltzer et of Mattsby-epidemic disease al.1996; Shimizu et al.1996 growth is expressed Berseth et al.1983 because of regulatory gene; Heird et al.1984; Nichols et al.1987; The anticancer still unknown Bezault et al.1996 of Nichols et al.1990; Sekine et al.1997; Yoo et al.

1997

Early stage investigator observes following two facts: at first, contain a large amount of lactoferrins in the human milk, and the most Fe that contain in the human milk ³⁺Above all being combined in (Franssonand L nnerdal, 1980); Secondly, though Fe in the human milk ³⁺Content is lower, and breast-fed infant at least in the past can iron deficiency (Duncan et al.1985 at six months; L nnerdal et al.1994; Siimes et al.1984).Be easy to draw the conclusion that lactoferrin promotes that iron absorbs.Some experiment draws inconsistent conclusion (Scott, 1989; Davidson et al.1990), the still following fact supports lactoferrin to promote the conclusion that iron absorbs:

A. the gastrodermis cell Fe that lactoferrin can be carried ³⁺Discharge (Levay

and?Viljoen，1995)；

B. the gastrodermis cell is to very strong (the Levay and of receptivity of lactoferrin

Viljoen，1995)；

C. the Fe that from urine, discharges of baby ³⁺Content and breast milk with lactoferrin in the breast milk

Intake become positive correlation (Masson et al.1971);

D. lactoferrin carries Fe ³⁺Shuttle back and forth between small intestine enteric cavity and epidermic cell Fe ³⁺

In the inner membrance of intestines entocuticle cell, build up (Davidson et al.1989);

Though baby's contrast of e. edible formula milk and edible breast milk is in the formula milk

Concentration of iron far above breast milk, the former easy iron deficiency (Saarinen and

Siimes，1977)。

The avidity of lactoferrin and iron ion is very high, is 260 times of Transferrins,iron complexes in the blood, and the affinity equilibrium constant is approximately 10 ²⁰(Baker et al.1994).The lactoferrin of deferrization state has broad-spectrum antibacterial effect (Rainard, 1986; L nnerdal and Iyer, 1995).The bacteriostatic action of lactoferrin is not limited to the iron metabolism that it can block bacterium, and it can combine with the bacteria lipopolysaccharide (LPS) of Gram-negative bacteria, and lipopolysaccharides is discharged from cell walls, reaches the effect (Ellison et al.1988) of killing bacteria.Lactoferrin can also combine with one group of colibacillary porin, thereby changes the permeability (Erdei et al.1994) of film.

The germicidal action of lactoferrin mainly is because it has N end alkalescence zone (Bellamyet al.1992; Tomita et al.1994; Kang et al.1996; Dionysius and Milne, 1997; Hoek et al.1997).Usually bonded zone irrelevant (Bellamy et al.1992) and this peptide section of this peptide section with germicidal action being called lactoferrin cecropin B (Lactoferricin B) this peptide section and responsible iron ion itself just have fungistatic effect (Saito et al.1991 widely; Bellamy et al.1992).

Lactoferrin can promote neutrophil leucocyte to build up and be adsorbed in injured tissue, and granulocyte is become sticky, and reduces the cell surface current potential, promotes cell communication.(Birgens，1984；Boxeret?al.1982)。

Lactoferrin can be regulated various cytokines, and the content of lactoferrin is lower than 10 in blood ^-8During M, lactoferrin can suppress cytokine IL-1, IL-2, TNF and discharge (Crouch et al.1992 from white corpuscle; Machnicki et al.1993).When combining, promote the release (Paul et al.1993) of above-mentioned cytokine again with bacteria lipopolysaccharide.In addition, also has report explanation lactoferrin energy activating macrophage (Silva et al.1989).

As far back as the eighties in last century, just there is the investigator to find that milk is colostrum particularly, effect (the Berseth et al.1983 that promotes the small intestine growth is arranged; Heird et al.1984).Found afterwards that the speed that thymidine mixes DNA accelerated under the condition that lactoferrin exists, this promoter action does not rely on the iron degree of saturation (Nichols et al.1987) of lactoferrin.Have and discover that the saturated lactoferrin of iron is four times (Azuma et al.1989) of deferrization lactoferrin to the influence of the DNA resultant velocity of mouse embryo cell.Yet the effect of this promotion cell proliferation can not be embodied on the cancer cells, on the contrary, and the propagation of its anticancer (Amouric et al.1984).Possible explanation is: this effect of other the collaborative lactoferrin of the factor is arranged.

A large amount of experiment confirm lactoferrins have multiple physiological action, though obtained certain progress with decomposition each substructure of lactoferrin and the function of studying each part now, lactoferrin integral body function in vivo is still waiting further research.For a long time, how obtaining cheap human lactoferrin, to be used for medical purpose be very difficult to the investigator, and the transgenosis recombinant protein provides the source of another kind of human lactoferrin to people.In in the future several years, will cause the research of transgenosis recombinant protein to become focus to the needs of human lactoferrin.

Yeast is a class lower eukaryotes, and it not only has similar procaryotic growth characteristics, also has general Eukaryotic molecular biology and characteristics of cell biology.Yeast expression system developed rapidly in recent years, had the expression system of plurality of advantages.When expressing the eukaryotic cell foreign protein, not only have prokaryotic organism growth characteristics fast, simple to operate, also have the translation post-treatment of each cells of mamma animals and the function of modification, thereby express bioactive albumen is arranged.For a long time, yeast saccharomyces cerevisiae is that the industrialization of fundamental research and engineered bacterial strain and vaccine makes a great contribution as a kind of gene engineering expression system, but there are some limitation in the yeast saccharomyces cerevisiae expression system, mainly show: 1. yeast saccharomyces cerevisiae is a kind of yeast based on fermentation, adopting under the conventional aerobic fermentation condition, the speed of growth that yeast saccharomyces cerevisiae can reach and density are not high.2. the foreign gene instability is lost easily.3. protein excessive glycosylation.4. processing behind the protein translation and higher eucaryote different (Romanos et al.1992).Thereby impel people to seek and set up new carrier-host system, Pichia Pastoris is exactly a kind of novel expression system that replaces yeast saccharomyces cerevisiae that produces in this case.It is unrivaled that Pichia Pastoris has two kinds of advantages: sophisticated fermentation process and methanol induction promotor.Since the seventies, PichiaPastoris just is used as manufacture order cell protein (SCP) (Wegner, 1983), and dry cell weight can reach the density of 100g/L in the fermented liquid, and fermentation process is quite perfect.Its substratum is inorganic salt, trace element, vitamin H and carbon source, these raw material cheapnesss, nontoxic.

The promotor of P.Pastoris AOX1 gene is the key of this expression system, and clone AOX1 gene is that the cDNA library differential screening of the cell after cultivating respectively by methyl alcohol, ethanol obtains.Further determine AOX1 gene (Ellis et al.1985) according to known AOX protein sequence then.Discover that further P.Pastoris can also express another kind of methanol oxidase AOX2 (Cregg et al.1989).AOX1 has 97% identical (Cregg etal.1989 with the AOX2 protein sequence; Koutz et al.1989).The mutant of AOX1 disappearance is a poor growth on the single carbon source substratum at methyl alcohol, and therefore, AOX1 plays a decisive role when the methyl alcohol metabolism.This also is the reason (Cregg et al.1993) that the promotor of AOX1 is used for exogenous gene expression

The secreting, expressing of foreign gene has not only made things convenient for the separation and purification of expression product, and is simultaneously also relevant with correct processing after the translation of expression product.The foreign protein secretion utilizes the secretion signal expressing protein and is secreted into the extracellular along certain approach the time, utilize the secretion signal of foreign gene itself or zymic secretion signal all successful expression a large amount of foreign genes.But might expression amount when utilizing the natural signals peptide secreting expression of exogenous gene of foreign protein low, expression product also very likely can not correctly be processed.For example in the expression of translocase (invertase), just run into this situation (Tschopp et al.1987).

When construction of expression vector, the secretion signal of general using yeast itself, as the 2-mating factor signal sequence of yeast saccharomyces cerevisiae (S.cerevisiae) is put into expression vector,, can mediate the secretion of foreign protein effectively though it is to contain 89 amino acid whose small peptides.But when foreign protein and signal sequence fusion, need keep the Glu-Ala transcribed spacer that links to each other with the KEX2 protease cutting site modestly, this transcribed spacer this can help to alleviate owing to fusion rotein cause sterically hindered, thereby pichia KEX2 proteolytic enzyme can effectively be cut to the original acid sequence, then, the Glu-Ala transcribed spacer can not made goal gene at unnecessary amino-acid residue (the Vedvick et al.1991 of the terminal interpolation of N-by two peptase (DAP) excisions like this; Clare et al.1991).

The plasmid vector of expression alien gene has many denominators (table 1) exogenous gene expression framework generally to comprise the AOX1 promotor of pichia (P.Pastoris) in pichia, the back is a cloning site, be used to insert foreign gene, the back is the AOX1 genetic transcription terminator sequence of pichia (P.Pastoris) again.Also have the HIS4 gene of P.Pastoris on many carriers, can be used for the screening of auxotroph his4 mutants which had.Also have AOX1 gene 3 ' downstream sequence to be used for 3 ' end of homology displacement AOX1 gene on some carriers.Secreted expression carrier is closelyed follow a secretion signal in the promotor back of AOX1 gene, is generally the secretion signal (PHOI) of 2-mating factor secretion signal or acid phosphatase gene (acidphosphatase).

The interior type pHIL-D2 HIS4 of table 1. pichia yeast expression vector container name selection markers characteristics reference born of the same parents commonly used uses the Notl enzyme to cut can be in AOX1 site Higgins and Cregg, 1998

Insert purpose fragment pAO815 HIS4 and cut generation Cregg et al.1993 by Bgl II and BamH I enzyme

Multiple copied expression cassette pPIC3K HIS4 and kan ^rThe multiple clone site Scorer et al.1994 that provides foreign gene to insert

G418 screening multi-copy strains pPICZ ble ^rThe multiple clone site Higgins and Cregg that provides foreign gene to insert, 1998

Zeocin screens multi-copy strains

Foreign protein can merge His6 and myc tail pHWO10 HIS4 expression is controlled by constitutive promoter GAP Waterham et al.1997pGAPz ble ^rExpression is controlled by constitutive promoter GAP Higgins and Cregg, 1998

The multiple clone site that provides foreign gene to insert

Zeocin screens multi-copy strains

Foreign protein can merge His6 and myc tail secretor type pHIL-S1 HIS4 AOX1 promotor merges acid phosphatase secretion signal Higgins and Cregg, 1998

Provide Xho I, EcoR I and BamH I site

Insert foreign gene pPIC9K HIS4 and kan ^rThe AOX1 promotor merges α secretion signal Scorer et al.1994

Provide Xho I, EcoR I, Not I and SnaB I

Foreign gene is inserted in the site

G418 screening multi-copy strains pPICZ α ble ^rThe AOX1 promotor merges α secretion signal Higgins and Cregg, 1998

The multiple clone site that provides foreign gene to insert

Zeocin screens multi-copy strains

Foreign protein can merge His6 and myc tail pGAPZ α ble ^rGAPp promotor Higgins and Cregg, 1998

GAPp merges the α secretion signal

The multiple clone site that provides foreign gene to insert

Zeocin screens multi-copy strains

Foreign protein can merge His6 and myc tail

Biochemical Research finds that the methyl alcohol metabolism is carried out (Veenhuset al.1983) angle from expression system by a kind of pathways metabolism, and the most attracting is metabolic first enzyme-methanol oxidase of methyl alcohol (AOX).It is an inducible enzyme, and AOX does not express in containing glucose, glycerine or alcoholic acid substratum, but it can reach 30% (Couderc and Baratti 1980) of dry cell weight in the substratum that with methyl alcohol is single carbon source.According to these characteristics, people have induced height and the promotor (P of stringent controlled methanol oxidase gene _AOX1) be used for the carrier of construction expression foreign protein.The higher albumen of output of leading that appeared in the newspapers sees Table 2:

Table 2 pichia yeast high expressed foreign protein exemplifies protein name expression (grams per liter) born of the same parents, and interior/secretor type (to the methyl alcohol metabolism) list of references translocase 2.3 secretion tolerant T schopp et al.1987 alpha amylases 2.5 are secreted to tolerate in responsive Romanos et al.1991 tetanus toxin C 12.0 born of the same parents in responsive Paifer et al.1994 pertussis antigen P69 3.0 born of the same parents and are tolerated responsive Sreekrishna.1989 in Scorer et al.1993 TNF 10.0 born of the same parents in Clare et al.1991HIV-1gp120 1.25 born of the same parents

In multiple copied exogenous gene expression framework, add the yeast strains of resistant gene in order to screening multiple copied exogenous origin gene integrator.(as pPic9K, pPic3K) that resistant gene of card is contained in the inside to one group of plasmid, utilizes G418 resistance gradient screening experiment, can obtain multiple copied exogenous gene cloning (Clare et al.1991).Similarly also have Zeocin resistant gene (sh ble), this gene is less, and 375bp is only arranged, and can play a role in organisms such as intestinal bacteria (E.coli), yeast.These characteristics are fit to construction of expression vector very much.

It is problematic or virulent to P.Pastoris utilizing methanol induction to express under some condition, has developed the expression system (Waterham et al.1997) that utilizes phosphoglyceraldehy-de dehydrogenase (GAP) gene promoter now again.

All expression strains derive from NRRL-Y 11430, and (IL) as form 3, great majority are group ammonia alcohol dehydrogenase gene (HIS4) defective typies for Northern RegionalResearch Laboratories, Peoria.This can utilize revertant to screen easily, and these cells must add Histidine and could grow on minimum medium.

Table 3 pichia yeast expression strain strain name genotype phenotype is consulted Y-1 1430 wild-type NRRL ^αGS115 his4 Mut ⁺His ^-Cregg et al.1985KM71 aox1 △ ∷ SARG4 Mut ^sHis ^-Tsehopp et al.1987

his4?arg4MC100-3???????aox1△∷SARG4????Mut ^-His ^-?????????????Cregg?et?al.1989

aox2△∷Phis4

his4arg4SMD1168???????pep4△his4???????Mut ⁺His ^-?????????????Higgins?and?Cregg?1998

Protease?deficientSMD1165???????prblhis4?????????Mut ⁺His ^-?????????????Higgins?and?Cregg?1998

Protease?deficientSMD1163???????pep4?prblhis4????Mut ⁺His ^-?????????????Higgins?and?Cregg?1998

Protease?deficient

According to one or two AOX genetically deficient (Mut that expression strain can be divided three classes ⁺, Mut ^s, Mut ^-), they utilize the ability difference of methyl alcohol, and the yeast that deletes the AOX gene usually can be expressed foreign protein (Tschopp et al.1987 better; Cregg et al.1987; Chirulova et al.1997).Mut ⁺Genotypic typical case's representative is GS115, and two genes of its AOX1 and AOX2 are consistent with wild-type.Mut ^sGenotypic typical case's representative is KM71, owing to its AOX1 gene is partially removed the ARG4 gene that replaces yeast saccharomyces cerevisiae (S.Cerevisiae), therefore, its genotype is that his4 arg4 aox1 △ ∷ ARG4 is because this yeast strains can only rely on more weak AOX2 gene relatively, its speed of utilizing methyl alcohol is slow (Cregg and Madden, 1987).MC100-3 is the genotypic yeast of Mut-, because its AOX1, AOX2 gene is all deleted, so this class yeast (Cregg et al.1989 that can not on the substratum that with methyl alcohol is single carbon source, survive; Chirulovaet al.1997).SMD series bacterial strain, proteolytic enzyme is deleted, is applicable to the exogenous protein expression (Higgins and Cregg, 1998) that easily is degraded.

(S.Cerevisiae) is the same with yeast saccharomyces cerevisiae, and linear carrier DNA can produce stable transformed yeast strain (Cregg et al.1985 by its two ends and the total sequence homology group of pichia (P.Pastoris); Cregg et al.1987).All P.Pastoris expression vectors contain the fragment (as AOX1 or GAP promotor) of a P.Pastoris DNA at least, and inside has a restriction enzyme site at least, is used to be integrated into the yeast genes group.Some carrier comprises the HIS4 gene of P.Pastoris, also can be used for integrating yeast genes group HIS4 site.The expression vector that contains 3 ' AOX1 sequence can be gone into AOX1 site or HIS4 site with the single-point cross integration, also can be integrated into the AOX1 site in the mode of gene substitution.The latter causes the deletion of AOX1 gene, so phenotype is His ⁺/ Mut ^s

The answer of his4 gene is used in the screening of transgenosis pichia usually, and further screening is usually with round pcr or Southern hybridization technique (Clare et al.1991; Romannoset al.1991), perhaps, directly with method (the Sreekrishna et al.1989 that screens product; Wung and Gascoigne, 1996).Usually have the multiple copied of 1-10% to transform probability (Sreekrishna et al.1989) in the transgenic yeast, but multiple copied transformant high yield not necessarily need experiment to determine high yield strain.The method of screening high yield strain can also be screened with G418 or Zeocin resistance gradient, and high anti-strain generally contains the copy (Clare et al.1991) more than 5, if the copy number that will screen more than 30 also will carry out strict Southern hybridization.

Different yeast cell systems had both used identical expression plasmid to transform, and the expression amount of its foreign protein also is not quite similar, and must do a large amount of screening operations like this and determine that any fungus strain expression amount is the highest.But because the condition of shake-flask culture and fermentor cultivation differs too big, this screening operation also is futile sometimes.The conditional parameter that shakes bottle in a small amount is determined (Barr et al.1992) at present, and this comprises: substratum is to the surge capability of nectar degree; Control suitable pH to suppress exoproteinase; Competent oxygen; An amount of trypsin hydrolyzing thing or casamino acids are to suppress the exoproteinase activity and energy is provided.

The high density fermentation condition of pichia and technology are inquired into (Siegeland Brierley 1989 in detail; Brierley et al.1989; Brierley et al.1990; Siegel et al.1990) reasonable example is the deleted expression fungus strain of AOX1 gene.The cell total amount increases rapidly on glycerinated substratum, in this stage, the expression of foreign protein is suppressed fully, after glycerine consumption fully, the adding of methyl alcohol can be induced the expression of foreign protein, and the cell total amount has faint rising (Cregg et al.1993) simultaneously.

Because the fungus strain metabolism of deletion AOX1 gene reduces, reaching maximum foreign protein output need can use wild-type bacterial classification fermentative production to solve with 150～200 hours (Tschopp et al.1991) these problems at present.Improving fermentation condition also can solve.(Siegel andBrierley 1989; Brierley et al.1989; Brierley et al.1990; Siegel et al.1990) this fermentation process to the effect that: the growth limitation when reaching glycerine and exhaust is during the phase, perhaps supply with methyl alcohol with growth limitation speed, perhaps methyl alcohol and glycerine provide with growth limitation speed simultaneously, can make the metabolism of expressing fungus strain strengthen the product showed increased like this.

The high density fermentation secreted protein is along with cell density increases, and foreign protein content increases.But exoproteinase content also increases, some product obvious degradation.As EGF (Clare et al.1991; Siegel et al.1990) have three kinds of methods can slow down the influence of exoproteinase: first kind is to add proteolysate or other materials that is full of amino acid and small peptide with competitive inhibition proteolytic enzyme (Barr et al.1992); Second method is to regulate the pH value, and proteolytic enzyme is at pH＜6.0 activity lower (Siegal et al.1990); The third method is to use the fungus strain of deletion PEP4 gene, and a kind of intracellular protein enzyme of PEP4 genes encoding, this proteolytic enzyme can activate a series of other proteolytic enzyme (Hirsh et al.1989).More than these three kinds of methods can use simultaneously, to obtain production peak.

Yeast makes the zymic expression system extremely valuable to a series of cuttings, glycosylation, the formation disulfide linkage process of foreign protein in the process of secretion foreign protein.Secretion type expression has more advantage than constitutive expression aspect the purifying.

With pichia secreting, expressing albumen no matter its character how, following purification process in most of the cases is suitable for.At first, yeast is separated with medium centrifugal, nutrient solution with 50mM sodium-acetate (pH5.0) with the dilution of 1: 1 volume ratio, suitable excessively chromatography column, and with NaAc buffer solution for cleaning chromatography column, use the NaCl gradient elution of 0-1M at last.The sample of Chu Liing like this, lipidated protein can reach more than 90%, albumen again by hydrophobic chromatography post (HIC) with 0～40% (NH ₄) ₂SO ₄Behind the wash-out, purity can be brought up to 95% (Creggetal.1993).Certainly, different albumen has different characteristics, be according to characteristics such as the proteic molecular weight of difference, iso-electric point, subunit bonding state design purification process.

Yeast saccharomyces cerevisiae (S.cerevisiae) expression system expressed protein has significant different (Tschopp et al.1987 with pichia (P.pastoris) expression system expressed protein in glycosylation; Grinna and Tschopp, 1989).By to the discovering of pichia, yeast saccharomyces cerevisiae mutase (invertase), the oligonucleotide chain length of pichia secretory protein is much smaller than yeast saccharomyces cerevisiae, and the translocase of pichia overwhelming majority level of glycosylation are at Man _8-14GlcNAc ₂(Man: seminose, GlcNAc ₂: the N-acetylglucosamine) and the yeast saccharomyces cerevisiae expressed proteins only has an appointment 20% in this scope (Grinna andTschopp, 1989; Byrd et al.1982; Trimble et al.1991).Find the longest 30 mannose groups of only having an appointment of oligonucleotide chain of P.pastoris expressing protein by research P.pastoris and S.cerevisiae glycoprotein, and the oligonucleotide chain of S.cerevisiae (KuKuruzinska et al.1987 about 50-150 mannose group usually; Byrd et al.1982).Have tangible different by the topology discovery P.pastoris of peacekeeping two dimensional NMR collection of illustrative plates research oligonucleotide chain and the oligonucleotide chain of S.cerevisiae, the most significant difference of translocase of P.pastoris and S.cerevisiae is: P.pastoris excretory translocase does not have α 1, the terminal seminose that 3-connects, this point is significant, the yeast saccharomyces cerevisiae expressed proteins mainly is because its terminal α 1, has limited its application (Cregg et al.1993) pharmaceutically thereby terminal seminose that 3-connects makes it have very high antigenicity

Summary of the invention

The purpose of this invention is to provide a kind of reorganization pichia methanolica that efficiently expresses human lactoferrin.Its concrete invention step is as follows: 1 from cDNA library screening hLF gene clone

Lactoferrin content in human breast higher (Levay and Viljoen, et al.1995), corresponding, the content of its mRNA is also higher.Consider that it is not too economical that synthetic one section probe is used to screen the library, P1/P2 screens phage library with primer.Removing some that screen with the contrast of single primer may be the reaction product of single primer, than checking the dependency of characteristic fragment to two primers appears with 10 times primers, screen a strain positive bacteriophage PCR confirmatory experiment as shown in Figure 1 in order to last method, the fragment of 1.0kb shown in the swimming lane 5 may be exactly the part of human lactoferrin gene, further needs sequence verification.

Use primer P3/P4 instead and further identify this phage clone, obtain the fragment of an about 2.1kb, conform to (as shown in Figure 2) with the size of expection product.

With this cloning and sequencing, sequencing primer is the M17 universal primer, and this dna sequence analysis shows that the about 2.5kb of this cDNA clone's length is near total length.With the sequence contrast of DNAssist (v1.02) software with people such as Rey among the sequence that obtains and the Gene Bank, result's demonstration: our seq 1 0rey ' s seq 1 GACTCCTAGGGGCTTGCAGACCTAGTGGGAGAGAAAGAACATCGCAGCAGCCAGGC AGAAC 61

As from the foregoing, this clone is full length cDNA clone, and the sequence that has people such as 14 bases and Rey is different, and this species diversity may reflect the polymorphism of gene order, and we further study the difference of maturation protein sequence:

As seen, in 14 place's differences of the eDNA sequence of Rey, have 9 place's differences and cause amino acid whose variation from the contrast of two protein sequences, the variation of all the other bases does not cause amino acid whose change.In the amino acid that changes, it is that Methionin becomes arginine (29 and 164) that two places are arranged; There is the amino acid change at two places also not relate to amino acid whose physico-chemical property (94 tyrosine become halfcystine, 561 aspartic acids become L-glutamic acid) in addition.With iron ion in conjunction with relevant amino-acid residue (Asp, Tyr, Tyr, His) (Spik et al.1994) illustrates that these amino-acid residues guard not among these difference.2hLF gene subclone is in the pPIC9 plasmid

At first, the incision enzyme map of the hLF gene that we are cloned into the DNAssist software analysis is used for difference use restriction endonuclease when subclone is operated, and obtains incision enzyme map as shown in Figure 3.The multiple clone site restriction endonuclease of plasmid pPIC9 is Xho I, SnaB I, EcoRI, Avr II, Not I successively.We select two restriction endonucleases of Xho I and Not I to insert the hLF gene, designs two primer P9a and P9b and have two sites respectively and along the reading frame of α secretion signal, intercept the functional protein cDNA sequence in the hLF gene.The PCR product connects in the pPIC9 plasmid, digested plasmid, and the result is as shown in Figure 4.Two Bgl II sites are arranged on the plasmid pPIC9, respectively+1 and+5621 (is starting point with 5 ' AOX1 promotor), there are two Bgl II sites hLF gene inside, respectively+890 and+1500 (are+1 with hLF functional protein cDNA starting point), the hLF gene clone is in α secretion signal (+949-+1218) back, single endonuclease digestion can produce 0.61kb, 2.10kb, four fragments of 2.41kb, 4.97kb, experimental result conform to it (lane 5).There is an EcoRV site hLF functional protein cDNA inside+1534 positions, respectively there is an EcoR V site pPIC9 plasmid inside+1749 and+5574, in inner one 6788 positions of pPIC9 plasmid one Not I site is arranged, two enzyme double digestions can produce 0.52kb, 0.77kb, four fragments of 3.82kb, 4.96kb, experimental result conform to it (lane3).We use two restriction endonucleases of Xho I+Not I in two ends when subclone hLF gene, and lane4 conforms to it.

The plasmid that builds proves that through order-checking (BioAsia company Shanghai) base sequence and reading frame all are correct.3 recombinant plasmids change in the yeast

Linear carrier DNA can produce stable transformed yeast strain (Cregg et al.1985 by its two ends and the total sequence homology group of pichia (P.Pastoris); Cregg et al.1987).Recombinant plasmid is cut into linear DNA with restriction endonuclease Sal I, transform pichia strain KM71 with electrotransformation, this foreign DNA can make the his4 gene of KM71 yeast strains revert back to the gene of function, can not contain growth (Fig. 5) on any amino acid whose minimal medium like this.This reorganization pichia bacterial strain is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center January 24 in 2002, and preserving number is: CGMCCNO.0702.

In this way, we screen 326 strain positive colonies altogether.With shaking bottle high-density culture transformed yeast and abduction delivering hLF gene, protein electrophoresis screening high yield strain, a high expression level yeast strains electrophoresis screening surplus we obtain 226,153,216 etc. 20, as shown in Figure 6.

Further identify positive yeast strains by PCR, with the partial sequence of AOX1 promotor inside be 5 ' primer (P5 ' _AOX1), the partial sequence of AOX1 gene termination sequence inside be 3 ' primer (P3 ' _AOX1).Because we insert the his4 site by foreign DNA, the result of positive colony PCR should have a treaty 2.5kbp's [α secretion signal-hLF cDNA] merge the AOX1 functional gene of a fragment and a treaty 0.9kbp [5 ' AOX1-3 ' AOX1] after deleted and merge fragment, experimental result conforms to it, as shown in Figure 7.

It has been generally acknowledged that the bacterial strain that multiple copied inserts all is (the Brierley et al.1994 of high yield; Clare et al.1991; Scorer et al.1993; Scorer et al.1994), general copy more than 5 accounts for 10% (see:Pichia Expression KitInstruction manual) in all transgenosis strains.The bacterial strain 226 than high yield that we are screened extracts DNA according to 3.3,3.4 method and does Southern hybridization, the insertion and the copy number of checking foreign gene, and the result is as shown in Figure 8.

As shown in Figure 8, the result of lane4 has confirmed the restriction enzyme site that the hLF gene uses when the construction expression plasmid, and the size of hybrid belt is 2.1kbp.Lane5,6 result and plasmid restriction enzyme site and insert the gene restriction enzyme site and coincide, confirmed the result of Fig. 4 and proved copy number greater than 3 (lane1 shows to have at least three sites to insert the external source fragment), two less hybrid belt explanations of lane1 have that star activity that exogenous genetic fragment inserts zone beyond the his4 site or restriction endonuclease causes.The expression of 4hLF gene in transgenic yeast

Pichia suppresses the AOX1 promotor when other carbon sources are arranged, can reach 30% (Couderc and Baratti 1980) of dry cell weight when the albumen of the genetic expression in its downstream in the substratum that with methyl alcohol is sole carbon source.According to this characteristic, at first transgenic yeast is made it the nectar degree on the YPD substratum and reach OD:5～6, concentrate the long-pending and interpolation inductor of decaploid then, make yeast abduction delivering hLF gene under high concentration environment.So promptly can use small device and less substratum, key has also been simplified purification step.The yeast strains that we use is KM71, and genotype is Mut ^s, owing to utilize the speed of methyl alcohol slow,, make that like this inductive phase is longer so its metabolism when being single carbon source with methyl alcohol is slower, need 3～5 days usually.Before inducing and induce 24 hours time sampling, extract yeast strains 226 total RNA Northern hybridization detection hLF expression of gene, the result is as shown in Figure 9.

As shown in Figure 9, the hLF expression of gene is subjected to complete inhibition to the pichia that changes the hLF gene when enriching on the amino acid whose YPD substratum growth containing, and changing over to methyl alcohol is back this expression of gene of induced strong on the substratum of sole carbon source.The output of expressed proteins and integrity are that we are concerned about, pichia secreting, expressing itself be exactly external albumen or secretion process be not obstructed albumen the time output generally all more than 1g/L, about the about 500～1000mg of output 226 bacterial strains that we calculate according to the sxemiquantitative as a result of protein electrophoresis.The Western results of hybridization of secretory protein as shown in figure 10.

As shown in figure 10, hLF expression of gene protein yield is about 500mg/L, and expressed proteins molecular weight size is close with the natural human lactoferrin, and standard substance are degraded to some extent in treating processes.

Directly with the electrophoretic results of hybridization of yeast inducing culture liquid owing to be subjected to concentration limit, the hybridization band is also not obvious, we dialyse inducing culture liquid and have concentrated 100 times, applied sample amount obtains experimental result as shown in figure 11 with last identical.

As shown in figure 11, restructuring lactoferrin suffers the intensive degraded in concentration process, the factor that spontaneous degraded is arranged certainly therein, to this proper explanations be: dialysis procedure is removed and have been distinguished the proteinase inhibitor in the nutrient solution and pH value of solution raise, and can activate the exoproteinase of pichia under these conditions.The bacterial strain that protease deficiency has been arranged at present, we prepare to do the such bacterial strain of a strain again and further save production cost.

In a word, lactoferrin content in human breast is higher corresponding, and the content of its mRNA is also higher.Consider that it is not too economical that synthetic one section probe is used to screen the library, get two sections fragments about suitable primer intercepting 1k bps from gene inside and screen phage library.Screen a strain positive bacteriophage.

It is different with people's such as Rey sequence to have 14 bases in the sequence, and this species diversity may have been reacted the polymorphism of gene order.Functional protein cDNA sequence in the intercepting hLF gene connects in the pPIC9 plasmid.

The positive yeast of strain surplus obtaining 300 by electrotransformation, by the product screening, a high expression level yeast strains surplus we obtain 226,153,216 etc. 20.

Transgenic yeast is made it the nectar degree reach OD:5～6 on the YPD substratum, concentrate the long-pending and interpolation inductor of decaploid then, make yeast abduction delivering hLF gene under high concentration environment.The time hLF expression of gene be subjected to complete inhibition, changing over to methyl alcohol is back this expression of gene of induced strong on the substratum of sole carbon source.

Pichia secreting, expressing itself be exactly external albumen or secretion process be not obstructed albumen the time output generally all more than 1g/L, about the about 500～1000mg of output 226 bacterial strains that we calculate according to the sxemiquantitative as a result of protein electrophoresis.Secretory protein is verified restructuring lactoferrin with Western hybridization.

Shown in description of drawings Fig. 1 is with two primer PCR screenings of P1, P2 eDNA library; Shown in Figure 2 is that two primers of P3, P4 are further identified positive colony; Shown in Figure 3 is the incision enzyme map of hLF gene; Shown in Figure 4 is plasmid hLF/pPIC9 restriction analysis; Shown in Figure 5 is the transgenosis synoptic diagram; Shown in Figure 6 is that the human lactoferrin yeast strains is produced in the protein electrophoresis screening; Shown in Figure 7 is that PCR identifies the transgenic yeast strain; Shown in Figure 8 is the Southern hybridization of 226 strain chromosome DNA; Shown in Figure 9 is 226 yeast strains are expressed the hLF gene under inductive condition Northern detection; Shown in Figure 10 is the Western hybridization of 226 bacterial strain expression products; Shown in Figure 11 is the Western hybridization of 226 bacterial strain expression products after concentrating; Shown in Figure 12 is the subclone structural representation of recombinant plasmid hLF/pPIC9.

Embodiment

The invention will be further described to utilize embodiment below: the operation in embodiment 1cDNA library

Human breast carcinoma cDNA library is available from Novagen company commodity Human BreastTumor cDNA Library in λ SCREEN by name.Through checking, the transformation efficiency in this library can reach every microgram 10 ¹⁰Individual plaque.1.1 prepare to infect the bacterial cultures of phage

1, picking ER1647 bacterial strain list bacterium colony is inoculated in 10mL and contains 0.2% maltose

With 10mM MgSO ₄The LB substratum in, in 37 ℃ the concussion overnight incubation.

2, second day, draw 500 μ l overnight culture, be inoculated in 50mL LB and cultivate

(contain 0.2% maltose and 10mM MgSO in the base ₄), violent in 37 ℃

Concussion was cultivated 2 hours.1.2 shop system phage flat board

1, phage is carried out gradient dilution, phage is diluted in 20mM Tris-HCl

PH7.4,100mM NaCl, 10mM MgSO ₄In, extension rate is 1: 10 ⁵

2, with 100 μ l phage diluents and isopyknic bacterial cultures 5mL's

Mixing in the container is 37 ℃ of static insulation half an hour.

3, be incorporated in the top layer glue of 45 ℃ of insulations, pour 37 ℃ fresh behind the mixing immediately into

On the LB flat board, be inverted after top layer glue is condensed and be put in overnight incubation in 37 ℃ of incubators.1.3PCR the intermediate segment of amplification h-LF gene

1, the sequence of finding according to Gene Bank is from one section of the inner intercepting of h-LF gene

The fragment of 1k, design primer P1:5 '-

GAGCCCATTGAGGCAGCTGTGGC-3’；P2：5’-

GTAAGGCTAGTGTCTGCTCTCCT-3’。

2, with above primer and following reaction system: 1 * PCR buffer; The 1pmol/L primer

(every kind); 200 μ mol/L dNTP (every kind); 2 μ Taq enzymes; The picking list

Plaque is a template, and water is supplied the reaction system of 50 μ L.

3, be reflected on the PE2400 type PCR instrument and carry out, at first 94 ℃ 3 minutes, its

Inferior, with 94 ℃ 40 seconds, 58 ℃ 40 seconds, 72 ℃ one minute] carry out 35

Circulation is at last with 72 ℃ of 4 ℃ of termination reactions after 7 minutes.

4, each reaction runs into and does single primer control experiment when 1k left and right sides fragment is arranged again, should

Experiment is except that above reaction, and the primer of the same race that equivalent is set is done 3 reactions altogether

(P1/P1, P1/P2, P2/P2), all the other are the same.The a small amount of of embodiment 2 plasmid operations 2.1 plasmids is extracted

1, LB inoculation of medium list bacterium colony, 37 ℃ of shaken overnight.

2, in 1.5 milliliters of centrifuge tubes with the thalline control of 3 milliliters of bacterium liquid of two times centrifugal gained

Add 100 microlitre solution I (50mmol/L glucose, 20mmol/L behind the dry liquids

Tris-Hcl pH8.0,10mmol/L EDTA pH8.0) resuspended thalline, put on ice

Put one minute.

3, add the new obtain solution II of 200 microlitres (0.2mol/L NaOH, 1%SDS)

Turn upside down rapidly 5 times, note pipe bottom branch and the abundant mixing of solution II, afterwards

Place on ice.

4, the solution III (3mol/L KAc, 2mol/L HAc) that adds the precooling of 150 microlitres ice

Fully mixing is 10 seconds, in placing 3-5 minute on ice.

5, centrifugal 5 minutes of 4 ℃, 1200g are transferred to supernatant in another centrifuge tube also

Adding 2 microgram RNA enzyme (Sigma) room temperatures placed 15 minutes.

6, add the saturated phenol of 250 microlitre Tris, add 250 microlitre chloroforms behind the mixing.

4 ℃, 1200g are centrifugal 1 minute behind the mixing.

7, supernatant is transferred to another centrifuge tube, added 500 microlitre chloroforms, behind the mixing 4

℃, centrifugal 5 minutes of 1200g.

8, supernatant is transferred to another centrifuge tube (noting lower floor's organic solvent not being picked up)

Add 2 times of volume dehydrated alcohols, centrifugal 5 minutes of 4 ℃, 1200g behind the mixing behind the mixing

Clock.

9, outwell supernatant, add 1 milliliter of 75% ethanol, will precipitate fully and hang, then

Centrifugal 1 minute of 4 ℃, 1200g.

10, be dissolved in the 50 microlitre pure water after the precipitation drying.2.2 the enzyme of plasmid is cut

1, will be diluted to the plasmid 50ul adding 5ul enzyme cutting buffering liquid of 0.1～0.2ug/ul,

And add the 5u restriction endonuclease, 37 ℃ are incubated 2 hours,

Whether 2, agarose electrophoresis detects endonuclease reaction complete.

If 3, used enzyme cutting buffering liquid is inconsistent to two restriction endonucleases during double digestion, then earlier

Carry out adding 0.1 volume 5mol/L KAc two volumes after an enzyme cuts

Ethanol sedimentation, precipitation is used the resuspended precipitation of 75% ethanol again, supernatant outwelled after centrifugal,

After drying precipitated nucleic acid is diluted to 0.2～0.3ug/ul and adds another restriction endonuclease.2.3 the preparation of fresh competence E.coli cell

1, after the glassware that all are used is cleaned, fill with distilled water, 120 ℃ go out

Bacterium 30 minutes.To guarantee that not having any stain remover pollutes.Prepare fresh LB, used

Substratum does not all have any stain remover and pollutes.

2, select the single colony inoculation of DH5 α 37 ℃ of shaken overnight in the 1ml test tube.Inferior

Day, 37 ℃ were shaken at the fresh LB inoculation of medium of 20ml overnight culture 20ul

Swing after 2 hours triangular flask put and place 10 minutes on ice.

3, preparation ice 0.1mol/L CaCl precooling, fresh, degerming after filtration ₂

50ml。

4, with 4 ℃ of bacterium liquid, centrifugal 10 minutes of 5000g, abandon supernatant, and as far as possible control do from

Core barrel.

5, the CaCl that adds the ice precooling ₂Solution 20ml, resuspended bacterium.

6, centrifugal 5 minutes of 4 ℃, 5000g are abandoned supernatant, control dried centrifuge tube as far as possible.

7, repeat 5,6, at last bacterium liquid is resuspended in 1mlCaCl ₂In 4 ℃ of placements spend the night.2.4 the connection of plasmid, conversion

1, on the low melting-point agarose gel, with the carrier of needs and be inserted into the DNA sheet

Section is dissolved gel in 70 ℃.

2, by 1: 2 adding DNA binding buffer liquid (Promega) mixing in needle tubing,

And mistake post.

3,70% ethanol 2ml washes purification column 2 times.

4, purification column was removed residual ethanol in centrifugal 5 minutes in 4 ℃, 1200g.

5,20ul, 80 ℃ of pure water are with the purification column wash-out.

6, electrophoresis is determined carrier and is inserted into the concentration of dna fragmentation.

7,, and mix at 1: 5 with mol ratio with carrier be inserted into fragment and be diluted to 0.1ug/ul

Even, 8.8ul is got in each reaction.

8, the connection damping fluid that adds 1ul, and the T of adding 1ul ₄Ligase enzyme (is used 0.2ul

5 units/microlitre T ₄Ligase enzyme).

9,6 ℃ of fresh competent cell mixings that connect after 4 hours with 3.1.3, and at ice

Last placement 30 minutes.

10,42 ℃ of heat shocks are 90 seconds, place on ice 5 minutes, add 1ml LB and cultivate

Base was cultivated 30 minutes for 37 ℃.

11, centrifugal, abandon supernatant, with the resuspended thalline of 100ul LB, one of every 20ul shop

The LB flat board that contains suitable antibiotic 9cm.

12,20 single bacterium colony PCR of picking identify recombinant plasmid.In the time of suitable,

Order-checking is identified.2.5hLF gene is connected with the pPIC9 plasmid

1, design primer P _9aAnd P _9b, when design, remove secretion signal in the hLF gene,

Gly residue with ripe human lactoferrin is a starting point, and keeps the a-secretion signal,

Reservation and the Glu-Ala transcribed spacer that the KEX2 protease cutting site closely links to each other make

With the XhoI on the pPIC9 plasmid and two restriction enzyme sites of NotI.

P _9a：5

TCT，CGA，GAA，AAG，AGG，CCG，TAG，GAG，AAG，GAG，TGT3′

P _9b：5′GCG，GCC，GCT，TAC，TTC，CTG，AGG，AAT，TCA，C3′

2, by following system amplification hLF gene:

Every kind of 30pmol/L picking of 1u Pfu polysaccharase dNTP template DNA, and water is supplied 50ul

Reaction process: 94 ℃, 2min--[94 ℃, 40S--60 ℃, 40S--72

℃, 2min] (front bracket in circulation want 30 times)-72 ℃, 7min--

4 ℃ of terminations

3, reaction product adds 1mlDNA binding buffer liquid (Promega) at syringe

Cross purification column behind the middle mixing.

4,70% ethanol 2ml washes purification column 2 times.

5, purification column is in 4 ℃, the centrifugal 10min of 12000g.

6, with 50ul, 80 ℃ of pure water wash-outs.

7, elutriant adds 1/10 enzyme cutting buffering liquid (Dbuffer Promega), and adds

Go into 1ulXhoI, 1ulNotI.

8, repeat the operation of 3-6 after 2 hours, purifying hLF amplified fragments.

9, pPIC9 is cut with XhoI and NotI enzyme after, press the method purifying of 3.2.4,

And be connected with the hLF amplified fragments, connect product and transform DH5a, screening reorganization matter

Grain.The electricity of embodiment 3 pichias transforms the preparation of 3.1 foreign DNAs

1, extract recombinant plasmid, become linear DNA by different insertion method digested plasmids,

HLF/pPIC9 is cut it with SalI in the HIS4 mid-way.

2, press the method purifying exogenous dna fragment of 3.2.5 3-6, and concentration is concentrated

To 0.5ug/ul.3.2 the competent preparation of pichia

1, picking pichia list bacterium colony, shakes by in the 10mlYPD substratum 28 ℃

Swing and cultivated 48 hours.

2, get the 1ml culture and be inoculated in the 200mlYPD substratum 28 ℃, acutely shake

Swung 4 hours.

3, after 30ml bacterium liquid was put on ice 10min, 4 ℃, the centrifugal 5min of 5000g discarded

Supernatant is controlled residual substratum in the dried centrifuge tube.

4, the resuspended thalline of ice-cold pure water 30ml, 4 ℃, the centrifugal 5min of 5000g.

Abandon supernatant, repeat once again.

5, the resuspended precipitation of sorbyl alcohol 10ml of ice-cold 1mol/L, 4 ℃, 5000g

Centrifugal 5min removes supernatant.

6, the resuspended precipitation of the sorbyl alcohol of ice-cold 2ml 1mol/L, 4 ℃, 5000g

Centrifugal 5min removes supernatant.

7, bacterial sediment is resuspended in the sorbyl alcohol of 500ul 1mol/L, be put in 4 ℃ stand-by.3.3 electricity transforms pichia

1, add 5ugDNA in the 200ul competence pichia, mixing is on ice

Place 30min.

2, change 2mm electricity conversion pool over to, electric conversion instrument (biorad) is transferred to finish the Chi Shi ferment

Female shelves, electricity swashs.

3, the sorbyl alcohol that adds 1ml 1mol/L in the conversion product, mixing, the mountain of getting 200ul

Pears alcohol liquid is paved plate and is cultivated.The extraction of embodiment 4 pichia nucleic acid extraction 4.1 pichia chromosomal DNAs

1, yeast mono-clonal of picking is inoculated in the 50mlYPD substratum 28 ℃

36 hours (2OD of bacterium are shaken in vibration ₆₀₀).

2, get 20ml4 ℃, the centrifugal 5min of 2500g.

3, abandon supernatant, with the resuspended precipitation of 10ml pure water.

4,4 ℃, the centrifugal 5min of 2500g.

5, abandon supernatant,, and change 1.5ml over to the resuspended thalline of SZB solution of the new preparation of 0.4ml

Centrifuge tube, 37 ℃ of water-bath 40min.(SZB solution: 1M sorbital, 10mM

sodium?citrate，pH7.5，10mM?EDTA，10mM?DTT，0.5mg/ml

Zymolyse)(Sigma)

6, add 0.4ml 1%SDS, mixing is placed 5min on ice gently.

7, add 0.3ml 5M KAc PH8.9, mixing gently.

8,10000g, 4 ℃ of centrifugal 10min forward supernatant to another centrifuge tube.

9, add 2 times of volume of ethanol, mixing, 10000g, 4 ℃ of centrifugal 10min.

10, abandon supernatant, after the precipitation drying, be dissolved among the 0.7mlTE buffer, add

Go into the 1mgRNA enzyme, room temperature is put 20min.

11, add the saturated phenol of 0.3mlTris, mixing adds the 0.3ml chloroform again, mixes

Even.10000g, 4 ℃ of centrifugal 10min.

12, get supernatant and add equal-volume chloroform, mixing, 10000g, 4 ℃ of centrifugal 5min.

13, get supernatant and add 0.1 times of volume 5M KAc, add 2 times of volume ethanol again,

Mixing.10000g, 4 ℃ of centrifugal 10min.

14, precipitation is resuspended with 75% ethanol, and 10000g, 4 ℃ of centrifugal 5min abandon

Clearly.Precipitation is dry, and is stored in-70 ℃.

When 15, using, resolution of precipitate is got final product with pure water.4.2 the extraction of the total RNA of pichia

1, picking yeast list bacterium colony is inoculated in the 50mlYPD substratum, at 28 ℃,

Shaking culture 36 hours.

2, get 20ml bacterium liquid in 4 ℃, the centrifugal 10min of 2000g, abandon supernatant.

3, add the 20ml pure water, resuspended thalline, in 4 ℃, the centrifugal 10min of 2000g,

Abandon supernatant.

4, thalline is resuspended in the 1ml pure water, changes the 1.5ml centrifuge tube over to, at 4 ℃, 2000g

Centrifugal 10min abandons supernatant.

5, add 1ml Trizol (GEBCAL.BRL) mixing, be put in 65 ℃, 2min.

Change-70 ℃ immediately over to, place 2min.

6, add 0.2ml chloroform, mixing, 4 ℃, the centrifugal 5min of 10000g.

7, supernatant changes another centrifuge tube over to, adds 2 times of volume ethanol ,-70 ℃ of preservations.

8, with before, centrifugal, dry in the air after half-dried, add an amount of pure water dissolving.The enzyme of embodiment 5 nucleic acid hybridization 5.1Southern hybridization 5.1.1DNA is cut, electrophoresis and shift to nylon membrane

1, get an amount of DNA sample, be diluted to about 0.1～0.2ug/ul, the 10 * Buffer that adds 1/10 volume cut 4 hours by enzyme amount enzyme under suitable temperature of reaction of 1u/ug.

2, the electrophoresis detection enzyme is cut effect, if do not cut fully, and the operation above repeating after the imitative extracting of phenol.

3, the DNA sample that enzyme is cut electrophoresis under the volts lost that is being lower than 1V/cm on 1.0% the sepharose spends the night.

4, gel is handled 2 * 15 minutes part depurinations in 0.2mol/LHCl.

5, at 0.5mol/LNaOH, handled 2 * 30 minutes in the sex change liquid of 1.5mol/LNaCl, then at 0.5mol/LTris-HCl (pH7.0), handled in the 1.5mol/LNaCl neutralizer 2 * 30 minutes.

6, with gel with capillary tube technique in the transfering buffering liquid of 20 * SSC to through 10 minutes nylon membrane of 2 * SSC pre-treatment (Boeringer Manheim) transferase 12 4 hours.

8, after transfer finishes, washed nylon membrane 10 minutes, toasted 30 minutes in 120 ℃ after dry half an hour with 6 * SSC.5.1.2 the mark of radioactive probe

The A random primering, this method is with reference to the operation instruction of the Prim-a-gene test kit of Promega company.

1. the template DNA with 50ng is diluted to 30ul, and boiling water bath 10 minutes places on ice rapidly.

2. add 10ul 5 * mark damping fluid, 2ul dATP, dGTP, the mixture of dTTP, every kind of 2mmol/L, 2ul BSA, 5u Klebknow Fragment, 5ul α- ³²P-dCTP (50uCi) placed room temperature following 1 hour.

3. after reaction finishes, be placed on sex change in 10 minutes in the boiling water bath, place stand-by then on ice.

B PCR method label probe, this method and unique difference of being conventional PCR be with α- ³²P-dCTP replaces inactive dCTP.5.1.3 hybridization program

1. soaked nylon membrane 10 minutes with 6 * SSC, move in the hybrid pipe, add 20ml hybridization solution (5 * SSC, 50%Formamide, 1%Blocking reagent (B.M.), 10%PEG (6000), 10mmol/LEDTA, 20mmol/L? Na ₂HPO ₄-NaH ₂PO ₄PH7.0 is 7%SDS) at 42 ℃ of prehybridization 1-2 hours.Afterwards the liquid in the hybrid pipe is outwelled.

2. with the radiolabeled probe and an amount of hybridization solution mixing of sex change, be added in the hybrid pipe, hybridized 30 hours for 42 ℃.

3. with 2 * SSC, 0.5%SDS washed film 2 * 15 minutes for 42 ℃, 0.1 * SSC, and 0.5%SDS washed film 2 * 15 minutes for 65 ℃.

4. after with preservative film nylon membrane being wrapped, be pressed under the X-ray sheet exposure 3-5 days, towards X-ray sheet developing.5.2Northern hybridization 5.2.1 RNA electrophoresis changes film

1. prepare 1% denaturing formaldehyde glue (Sambrook, et al.1989), with point sample behind RNA and the point sample damping fluid mixing, under the volts lost of 3 V/cm electrophoresis 2-3 hour.

2. after electrophoresis finishes, glue was soaked 2 * 15 minutes with the distilled water that DEPC handles, change film with reference to the method for 3.5.1.1 then.

3. after changeing the film end, with nylon membrane flushing 10 minutes, cool in back 80 ℃ of bakings 2 hours with the 0.5mol/L sodium acetate.5.2.2Northern hybridization program

1. nylon membrane was soaked 10 minutes with 6 * SSC, in the hybrid pipe of packing into.

2. in hybrid pipe, add 20ml hybridization solution (5 * SSC, 5 * Denhart ' s reagent, 20mmol/L EDTA, 50ug/ml salmon sperm dna) at 65 ℃ of prehybridization 1-2 hours,

3. will mix with the probe of 4.2 method mark and an amount of hybridization solution, spend the night in 65 ℃ of hybridization after changing hybridization solution, then 56 ℃ of annealing 2-3 hour.

4. with 0.5 * SSC, 0.5%SDS and 0.1 * SSC, the film washing liquid of 0.5%SDS respectively washed 2 * 15 minutes, and nylon membrane is wrapped back X-ray sheet exposure with preservative film.5.2.3 the preparation of probe template

1. add 5u restriction enzyme, 5ul 10 * Buffer, 5ug in the reaction system of 50ul

Plasmid, enzyme were cut 3 hours.

2. reclaim the purpose fragment with the low melting-point agarose gel.Embodiment 6 protein SDS-PAGE gel electrophoresises 6.1 protein electrophoresises

1, gets 1ml bacterium liquid, 4 ℃, the centrifugal 5min of 5000g.Get supernatant 50ul adding etc.

Volume, sample loading buffer (50mmol/L Tris-Hcl PH6.8,100mmol/L

DTT, 2%SDS, 0.1 tetrabromophenol sulfonphthalein, 10% glycerine).

2, boiling water bath boils 10min, gets the last sample of 10～30ul.6.2 gel preparation and dyeing procedure

6.2.1 the preparation 1 of polyacrylamide gel, sheet glass is installed according to the explanation of electrophoresis equipment.2, according to the requirement that separates different molecular weight of albumen, the preparation separation gel, contain 0.1%SDS in the separation gel, 0.1% ammonium persulfate, 0.4M Tris-HCl pH8.8,0.008%TEMED adds 30% acrylamide solution and water according to required gel strength, in general separates the acrylamide gel that 80KD protein need be used 6-8%.3, be poured in immediately between the layer glass behind the above-mentioned solution mixing, reserve the required space of perfusion basic unit glue (tooth of comb is long to add 1 centimetre again), on glue, cover one deck 0.1%SDS then, gel vertically is positioned under the room temperature.4, remove tectum liquid with filter paper after 30 minutes, on gel, record spacer gel (68% water, 1.7%30% acrylamide solution, 0.125M Tris-HCl pH6.8,0.1%SDS, 0.1% ammonium persulfate, 0.001%TEMED), comb is placed and drives away as far as possible bubble then.5, gel polymerisation after about 40 minutes, ultra violet lamp can be accelerated cohesion.

6.2.2 with Xylene Brilliant Cyanine G to the SDS polypropylene make the ammonia gel dye 1, at 90ml methyl alcohol: water (1: dissolving 0.25g Xylene Brilliant Cyanine G 1v/v) and in the mixed solution of 10ml glacial acetic acid, remove insolubles with filter paper filtering.2, the dye liquor with 5 times of volumes soaks gel, is placed on to shake on the platform in room temperature dyeing 4 hours.3, reclaim dye liquor, with the methyl alcohol that does not contain dyestuff. acetic acid solution shook 48 hours gently, during change the destainer several times.4, scanning gel, record gel image.Embodiment 7 albumen forward on the pvdf membrane from the SDS-PAGE gel.Immobilization is proteic

After Western hybridization 1.SDS-PAGE gel electrophoresis finishes, gel is taken off, be put in an equirotal usefulness and move on damping fluid (39mmolN glycine, 48mmol/L Tris, 0.37%SDS, 20% methyl alcohol) the wetted filter paper.2. cut one and gel pvdf membrane of the same size, soaked into 5 minutes with alcohol earlier, used the transfering buffering liquid balance again 30 minutes.3. pvdf membrane is covered on the gel, lid layer is used on the wet filter paper of transfering buffering liquid rosy clouds more above, and whole clip is clipped, and is put in the electrophoretic blotting groove.4.PVDF a side of film is towards anode, 7mA40 ℃ was shifted 8 hours.5. after shifting end, pvdf membrane takes out room temperature and dried in the air 10 minutes, changes in the TBST banyan liquid and soaks 10 minutes.6. filter membrane is changed among the IBST that contains 1%BSA over to room temperature and shook 1 hour, discard solution.7. add an amount of TBST (submergence pvdf membrane just), add 1/5000 first antibody again, room temperature was shaken 1 hour.8. 20mlTBST washed pvdf membrane 3 * 15 minutes under the room temperature.9. add an amount of TBST (submergence pvdf membrane), add 1/2000HRP mark second antibody again, room temperature was shaken 40 minutes gently.10. under the room temperature, 20ml TBST washed pvdf membrane 3 * 15 minutes.11. wash film once with TBS, remove TweedO.Placed 5 minutes 12. add colour developing damping fluid (Piece), pull the back out and package, in the darkroom, clip together and make it to expose 3 minutes with the X-ray sheet with hybridization bag.13. towards X-ray sheet developing.Embodiment 8 pichias secretion human lactoferrin fermentation process

8.1 a large amount of cultural method 1. picking list bacterium colonies are seeded in the 20ml BMMGY substratum, (in the 250ml Erlenmeyer flask) 28 ℃ of vibrations are shaken bacterium and are spent the night.2. above-mentioned culture is changed in the 200ml BMMGY substratum, (in the 1000m1 triangular flask) 28 ℃ of vibrations are shaken bacterium and are spent the night.3. above-mentioned culture changes the 3.7L fermentor cultivation over to OD6005-7.4. nutrient solution centrifugal 10 minutes, is abandoned supernatant at room temperature 2000g.With the 200mlBMMY substratum thalline is hanged, change in the 3.7L fermentor tank, supply the BMMY substratum again.Every 8 hours additional methyl alcohol to final concentration 05%.5. every 24,36,72,96 hours sampling analysis.

8.2 cultural method 1. is pressed 3.8.1 in a small amount, the method for 1-2 is cultivated thalline.2. room temperature 2000g abandons after centrifugal 10 minutes and asks, and with the resuspended thalline of 20ml BMMY substratum, and refunds in the former triangular flask, continues to cultivate.3. replenish methyl alcohol 0.2ml every day, every 24 hours sampling analysis.

8.3 the bacteriostatic experiment 1. of fermentation crude extract is seeded among the 20mlLB 37 mouthfuls of shaking culture with E.coli and spends the night.2. postcooling to 50 ℃ is dissolved in the LB substratum heating that will contain 2% agarose, and mixes by 1: 10 with the E.coli overnight culture.3. mixed solution is poured on the flat board, above evenly place golden cup.4. fluid to be detected is poured in the golden cup into 12,24,48 hours observation bacteriostatic experiments.

Sequence table (1) general information (i) denomination of invention: (ii) sequence number: information (i) sequence signature (A) length: 2496bp (B) type of 2 (2) SEQ ID NO:1: nucleic acid (C) chain: double-stranded (D) topological framework: linearity is molecule type (ii): cDNA is sequence description (iii): SEQ ID NO:1:

(3) information of SEQ ID NO:2

(i) sequence signature

(A) length: 692 amino acid

(B) type: amino acid

(C) topological framework: linearity

(ii) molecule type: polypeptide

(iii) sequence description: SEQ ID NO:2:

Claims (1)

1. bacterial strain P.P020105 that can efficiently express the reorganization methyl alcohol pichia P.Pastoris of human lactoferrin gene, its preserving number is: CGMCC NO.0702.

Images