CN1434871A - Prcess for priducing glycosyl transfer product - Google Patents

Abstract

A method of producing a phenol derivative glycoside is provided. The method comprises the step of allowing a saccharide and a phenol derivative to react with each other in the presence of an enzyme to produce the phenol derivative glycoside. The enzyme is selected from the group consisting of neopullulanase, cyclomaltodextrinase, maltogenic alpha-amylase, and saccharifying amylase having cyclodextrin synthesizing capability.

Description

The preparation method of glycosyl transfer product

Technical field

(maltogenic α-amylase) or the saccharifying amylase with cyclodextrin synthesis capability prepare the method for phenol derivatives glucosides to the present invention relates to use new Starch debranching enzyme (neopullulanase), Cyclomaltodextrinase (cyclomaltodextrinase), Fructus Hordei Germinatus α-Dian Fenmei.

Background technology

The phenol derivatives glucosides is not only always as uses such as pigment, sweeting agent, analgesic agent, antioxidants, and also the gradation composition as the makeup of bringing into play good whitening effect uses.Known passing through compared the phenol derivatives glycosylation in the past with glycosylation, improved stability, flavor quality and absorptivity.

The saccharification type α-Dian Fenmei (No. the 2662667th, Japanese Patent No., No. the 2805273rd, Japanese Patent No.) that this case applicant provides use subtilis (Bacillus subtilis) X-23 strain to produce prepares the method for polyphenol glucosides.

The known saccharifying amylase that does not have the cyclodextrin synthesis capability can be with polyphenol glycosylation (Japan special fair 7-36758 number and J.Ferment.Bioeng., 78:31 (1994)).But, by the former known saccharifying amylase that does not have the cyclodextrin synthesis capability, when polyphenol a kind of is the quinhydrones glycosylation (Japan special fair 7-36758 number), the glucosides of generation is 2 kinds of quinhydrones-O-α-D-glycopyranoside and quinhydrones-O-α-D-maltoside.The weight of these materials that generate is respectively 110mg and 51mg.Thereby owing to generate the mixture of multiple quinhydrones glucosides, therefore there is the problem that expends cost for purifying purpose product in the method before adopting.

There is amylase (J.Ferment.Bioeng., 81:26 (1996)) in the known saccharifying amylase that derives from subtilis with cyclodextrin synthesis capability.But not knowing to derive from the amylase with cyclodextrin synthesis capability that exists in the saccharifying amylase of subtilis fully can be with the phenol derivatives glycosylation.

For new Starch debranching enzyme, Cyclomaltodextrinase and Fructus Hordei Germinatus α-Dian Fenmei, do not know fully sugar to be transferred to yet and generate glucosides on the polyphenol.

As known other glycosylation process up to now, there is the glycosylation process (Japanese kokai publication hei 3-7593 number) that uses cyclodextrin glucanotrasferase enzyme like that sugar to be transferred to the glycosylation process of the saccharic part of the polyphenol compound that contains sugar in the molecule.But, adopting this method, sugar effectively can not be transferred in the molecule in the not sacchariferous polyphenol compound.It is also more to have in the phenol derivatives of various physiologically actives in the molecule not sacchariferous compound, and expectation improves the stability and the absorptivity of this phenol derivatives.

In the enzyme reaction of multiple generation glucosides, the malto-oligosaccharide that obtains as by product after enzyme reaction finishes does not have effective use fully.Therefore, a kind of phenol derivatives glycosylation process that can access useful byproducts of expectation.

In the past, use the ligand exchange chromatography of Zeo-karb to be used for sugared separation, for example glucose and fructose separates always.In the chromatography that is used for the purifying glucosides, generally use the hydrophobicity polymeric adsorbent.

Disclosure of the Invention

The inventor finds in the past at the industrial enzyme that utilizes hardly, be that new Starch debranching enzyme, Cyclomaltodextrinase, Fructus Hordei Germinatus α-Dian Fenmei and the saccharifying amylase with cyclodextrin synthesis capability have phenol derivatives glucosides synthesis capability, finished the present invention based on this.

When the inventor finds to use the saccharifying amylase with cyclodextrin synthesis capability, after reaction finishes, generate a kind of phenol derivatives glucosides as glucosides.If use the saccharifying amylase with cyclodextrin synthesis capability with the quinhydrones glycosylation, then the quinhydrones glucosides of Sheng Chenging is a kind of quinhydrones-O-α-D-glycopyranoside.Because product is a kind, therefore, the method for purifying glucosides was compared easily with former method, at an easy rate the glucosides of supplying high purity.

When the inventor also found to use new Starch debranching enzyme, Cyclomaltodextrinase or Fructus Hordei Germinatus α-Dian Fenmei, reaction finished the back and generates phenol derivatives glucosides and dextrinosan.

The inventor also finds, by with phenol derivatives glycosylations such as catechin, coffic acid, kojic acid, quinhydrones, catechol, resorcin compound, Protocatechuic Acid, gallic acid, Vanillin, daidzein, genistein, α-resorcylic acid, Phloroglucinols, the interaction of metal such as bonded calcium, lead, zinc, sodium or hydrogen and phenol derivatives glucosides and different on Zeo-karb or the Zeo-karb with the interaction of phenol derivatives.The inventor also finds by with above-mentioned phenol derivatives glycosylation, anionite-exchange resin partly or entirely with the phenol derivatives glucosides between the hydrophobic interaction and the part or all of interaction of anionite-exchange resin with phenol derivatives different.The inventor finds based on these, has obtained following purification process, promptly by handling the enzyme reaction product of having carried out glycosylation with the column chromatography of using Zeo-karb or anionite-exchange resin, and purification process that can 1 step purifying glucosides.

Use new Starch debranching enzyme, Cyclomaltodextrinase or Fructus Hordei Germinatus α-Dian Fenmei, when generating the glucosides of phenol derivatives, generate a large amount of dextrinosans by the matrix that adds as donor simultaneously.Dextrinosan is attracted attention as the bifidus somatomedin that makes useful intestinal bacterium propagation.Therefore, adopt method of the present invention, can access the phenol derivatives glucosides, and obtain this useful byproducts of dextrinosan simultaneously.

The inventive method is characterised in that the molecule that plays a role regardless of the acceptor as sugar contains saccharide residue, by the effect of above-mentioned enzyme, sugar is transferred on the hydroxyl of this molecule.Even when containing saccharide residue in the acceptor molecule, sugar is transferred on the saccharide residue hydroxyl in addition.This with former method in the enzyme that uses different fully.

Method of the present invention is the preparation method of phenol derivatives glucosides, this method is included in and makes sugar and phenol derivatives reaction under the enzyme existence, form the step of phenol derivatives glucosides, the saccharifying amylase that this enzyme is selected from new Starch debranching enzyme, Cyclomaltodextrinase, Fructus Hordei Germinatus α-Dian Fenmei and has the cyclodextrin synthesis capability.

In a kind of embodiment, above-mentioned enzyme is new Starch debranching enzyme, and this new amylopectin endonuclease capable derives from and is selected from thermoactinomyces vulgaris (Thermoactinomyces vulgaris), bacteroides thetaiotaomicron (Bacteroides thetaiotaomicron), Pseudomonas (Pseudomonas), bacillus polymyxa (Bacillus polymyxa), Bacillus licheniformis (Bacillus licheniformis), bacstearothermophilus (Bacillusstearothermophilus), the bacterium of Bacillus thermoamyloliquefaciens and thermus thermophilus (Thermus thermophilus).

In a kind of embodiment, above-mentioned enzyme is a Cyclomaltodextrinase, and this Cyclomaltodextrinase can derive from the bacterium that is selected from bacstearothermophilus (Bacillusstearothermophilus), bacillus acidocldarius (Bacillus thermophilus), Bacillus coagulans (Bacillus coagulanc), colon bacillus (Escherichiacoli), Flavobacterium (Flavobacterium), Alkaliphilic bacillus (AlkalophilicBacillus) and Bacillus sphaericus (Bacillus sphaericus).

In a kind of embodiment, above-mentioned enzyme is the Fructus Hordei Germinatus α-Dian Fenmei, and this Fructus Hordei Germinatus α-Dian Fenmei can derive from and be selected from thermoactinomyces vulgaris (Thermoactinomyces vulgaris), bacteroides thetaiotaomicron (Bacteroides thetaiotaomicron), Pseudomonas (Pseudomonas), bacillus polymyxa (Bacillus polymyxa), Bacillus licheniformis (Bacillus licheniformis), bacstearothermophilus (Bacillusstearothermophilus), the bacterium of Bacillus thermoamyloliquefaciens and thermus thermophilus (Thermus thermophilus).

In a kind of embodiment, above-mentioned enzyme is the saccharifying amylase with cyclodextrin synthesis capability, and this saccharifying amylase with cyclodextrin synthesis capability can derive from the bacterium that is selected from subtilis (Bacillus subtilis), streptococcus bovis (Streptococcus bovis), streptomyces hygroscopicus (Streptomyces hygroscopicus), early stage streptomycete (Streptomyces praecox), moral row rhizopus equinus (Rhizopus delemar), De Liema aspergillus (Aspergillus delemar) and aspergillus niger (Aspergillus niger).

In a kind of embodiment, above-mentioned phenol derivatives can be selected from flavonoid compound, isoflavonoid, the flavonols compound, flavanone compound, the flavanonol compounds, catechin compounds, the aurone compounds, the chalcone compound, dihydrochalcone-like compound, kojic acid, syringol, paracetamol, Vanillin, quinhydrones, epigallocatechin, gallate table catechu ester, the anthocyan compound, the anthocyanin compounds, coffic acid, catechol, Resorcinol, Protocatechuic Acid, gallic acid, resorcylic acid and Phloroglucinol.

In a kind of embodiment, above-mentioned sugar can be selected from malto-oligosaccharide, dextrin, amylose starch, amylopectin, native starch, amylolysis thing and chemical starch.

In a kind of embodiment, method of the present invention can also comprise makes spent ion exchange resin carry out the fractionated step to above-mentioned enzyme reaction product.

In a kind of embodiment, method of the present invention can also comprise makes spent ion exchange resin that above-mentioned enzyme reaction product is classified as the fraction that contains by product, the step that contains the fraction of unreacted phenol derivatives and contain the fraction of phenol derivatives glucosides at least.The preferred forms of invention

Below, describe the present invention in detail.

Method of the present invention is the preparation method of phenol derivatives glucosides.

In this specification sheets, " phenol derivatives glucosides " is meant that the phenol derivatives part combines the material that obtains with sugar moieties by glycosidic link.The phenol derivatives glucosides can be quinhydrones-O-α-D-glycopyranoside, coffic acid-O-α-D-glycopyranoside, 3,4-syringol-O-α-D-glycopyranoside, catechin-O-α-glycopyranosides such as D-glycopyranoside also can be two glycopyranosides that obtain further combined with sugar moieties of an above-mentioned glycopyranoside, three glycopyranosides etc.

Method of the present invention comprises reacts sugar and phenol derivatives in the presence of enzyme, form the step of phenol derivatives glucosides.

(1) sugar:

" sugar " that uses among the present invention is meant to have general formula C _n(H ₂O) _mCompound.Sugar is that the number of sugar unit is divided into monose, oligose and polysaccharide according to integrant.Among the present invention, preferred oligosaccharide and polysaccharide.Therefore, the n in the above-mentioned general formula is preferably more than 12, and m is preferably more than 11.

Monose is D-glucose.

So-called oligose is meant the material that has 1 α-1,4 key in the material that 2～10 monose dehydrating condensations generate at least in this manual.Oligose preferably has 3～9 sugar units, more preferably has 4～8 sugar units, further preferably has 5～7 sugar units.As the example of oligose, can exemplify malto-oligosaccharides such as maltose, trisaccharide maltose, maltotetrose, maltopentaose, MALTOHAXAOASE, Fructus Hordei Germinatus seven sugar, Fructus Hordei Germinatus eight sugar, Fructus Hordei Germinatus nine sugar, Fructus Hordei Germinatus ten sugar with α-1,4 key.Oligose can be straight catenate oligose, also can be a catenate oligose.Oligose can have circular part at its intramolecularly.

So-called polysaccharide is meant the compound that has 1 α-1,4 key in the material that the monose dehydrating condensation more than 11 generates at least in this manual.As the example of polysaccharide, can exemplify dextrin, amylose starch, amylopectin and starch.Preferred dextrin.

Dextrin is meant with chemical process or enzyme method the degraded material that obtains of starch.As the example of dextrin, can exemplify Britain glue (Britishgum), yellow starch gum, white dextrin, PINE-DEX (SongGu Chemical Industrial Co., Ltd), SUNDECK (three and starch Co., Ltd.), Tetrup (the former business of woods Co., Ltd.).

Amylose starch is meant the straight-chain molecule of the glucose unit formation that connects by α-1,4 key.Amylose starch is included in the native starch.

Amylopectin is meant at the chain molecule by obtaining by α-1,6 key connection glucose unit on α-1, the 4 key bonded glucose unit.Amylopectin is included in the native starch.As amylopectin, for example can use the waxy corn starch that constitutes by amylopectin 100%.

Starch is the mixture of amylose starch and amylopectin.As starch, so long as common commercially available starch, any starch all can use.The amylose starch that contains in the starch and the ratio of amylopectin are according to the kind of plant and different.The starch that glutinous rice, Glutinous Semen Maydis etc. contain almost is amylopectin.Starch can be divided into native starch, amylolysis thing and chemical starch.

Native starch is divided into potato starch and cereal starch according to raw material.As the example of potato starch, can exemplify yam starch, tapioca (flour), sweet potato starch, amylum marantae and fern starch etc.As the example of cereal starch, can exemplify W-Gum, wheat starch and rice starch etc.

Chemical starch is native starch to be implemented processing such as hydrolysis, esterification or αization, makes it to have the starch that the character that is easier to utilize obtains.Can access the chemical starch of broad variety that has the transparency, stability to aging etc. of viscosity that gelatinization begins temperature, paste, paste with various combinations.The kind of chemical starch has multiple.As an example, for example by below the gelatinization point of starch, impregnated in the acid starch molecule fracture, but the unbroken starch of starch particle.

The amylolysis thing be to starch implement that enzyme is handled or processing such as hydrolysis obtain with processing before compare few oligopolymer of molecular weight or polymkeric substance.As the example of amylolysis thing, can exemplify starch debranching resolvent and starch partial hydrolysate.

The starch debranching resolvent obtains by making debranching factor act on starch.By to carrying out various changes the action time of debranching factor, can access with any degree and will prop up the starch debranching resolvent that chain portion (that is, α-1,6-glycosidic link) cuts off.

Starch partial hydrolysate is meant by the effect of acid such as hydrochloric acid, acetic acid, oxalic acid, sulfuric acid, nitric acid and starch is partly decomposed the resolvent that obtains.Starch partial hydrolysate is according to the starch kind of decomposing, and the molecular weight distribution of the molecule that obtains can be different.Starch partial hydrolysate can be the mixture of the sugar chain of all lengths.

(2) phenol derivatives:

" phenol derivatives " that uses among the present invention is meant in the compound that contains phenol skeleton (being phenyl ring) or flavonoid skeleton to have the compound, phenol and the kojic acid that are combined in the hydroxyl on phenol skeleton or the flavonoid skeleton.As the example of phenol derivatives, can exemplify the compound that has 1 phenol hydroxyl on single phenol skeleton or the flavonoid skeleton, and the compound that has 2 above phenol hydroxyls on single phenol skeleton or the flavonoid skeleton.Below, for convenience, the compound that will have 1 phenol hydroxyl in this manual on single phenol skeleton or flavonoid skeleton is called single phenols (mono-phenol type) compound, and the compound that will have 2 above phenol hydroxyls on single phenol skeleton or flavonoid skeleton is called Polyphenols (poly-phenol type) compound.

The compound that has 2 phenol hydroxyls on single phenol skeleton or the flavonoid skeleton is called two phenolic compound.

Phenol derivatives glucosides with phenol hydroxyl is included in the phenol derivatives.

Single phenolic compound as having 1 phenol hydroxyl on single phenol skeleton or the flavonoid skeleton can exemplify phenol, kojic acid, syringol, paracetamol, Vanillin and daidzein.

Example as single phenolic compound can also exemplify single phenols flavonoid class compound.As single phenols flavonoid class examples for compounds, can exemplify single phenols flavonoid compound, single phenols isoflavonoid, single phenols flavonols compound, single phenols flavanone compound, single phenols flavanonol compounds, single phenols catechin compounds, single phenols aurone compounds, single phenols chalcone compound and single phenols dihydrochalcone-like compound.

As the example of syringol, can exemplify 2,3-syringol, 2,4-syringol, 2,5-syringol, 2,6-syringol, 3,4-syringol and 3,5-syringol.Preferred 3,4-syringol and 3,5-syringol.

As the polyphenolic compound that has 2 above phenol hydroxyls on single phenol skeleton or the flavonoid skeleton, can exemplify quinhydrones, epigallocatechin, gallate table catechu ester, anthocyan compound, anthocyanin compounds, coffic acid, catechol, Resorcinol, Protocatechuic Acid, gallic acid, genistein, β-resorcylic acid and Phloroglucinol.

As the diphenol examples for compounds, can also exemplify diphenols flavonoid class compound.As diphenols flavonoid class examples for compounds, can exemplify diphenols flavonoid compound, diphenols isoflavonoid, diphenols flavonols compound, diphenols flavanone compound, diphenols flavanonol compounds, diphenols catechin compounds, diphenols aurone compounds, diphenols chalcone compound and diphenols dihydrochalcone-like compound.

As resorcylic acid, can exemplify α-resorcylic acid, β-resorcylic acid and γ-resorcylic acid.In the present invention, preferred β-resorcylic acid.

Preferred quinhydrones, catechin compounds, epigallocatechin, gallate table catechu ester, 3 in the method for the present invention, 4-syringol, 3,5-syringol, paracetamol, more preferably quinhydrones.

Phenol derivatives can be separated by natural goods, also can modify acquisition (promptly semi-synthetic) to natural compounds, also can newly synthesize.The phenol derivatives structure is complicated more, and is preferred more by natural goods extraction or semi-synthetic.

The separation method of phenol derivatives, semisynthesis and synthetic method are known in this field, can carry out according to known method.

(3) enzyme:

The saccharifying amylase that the enzyme that uses in the method for the present invention is selected from new Starch debranching enzyme, Cyclomaltodextrinase, Fructus Hordei Germinatus α-Dian Fenmei and has the cyclodextrin synthesis capability.

As long as the enzyme that uses among the present invention can detect the glycosylated activity of phenol derivatives, not necessarily must be the enzyme of purifying.Even the thick enzyme of unpurified bacterial cultures or purification phase also can be used for preparation method of the present invention.These enzymes can generate according to the nutrient solution of method well known in the art by bacterium.These enzymes also can be commercially available enzymes.

New Starch debranching enzyme is meant the grow sturdily α-1 of enzyme polysaccharide (pullulan) of main hydrolysis, the enzyme of 4-glycosidic link, the enzyme that promptly mainly has the ability of generation panose (panose).This enzyme can further carry out the glycosyl shift reaction.

As the example of new Starch debranching enzyme, can exemplify to derive from and be selected from thermoactinomyces vulgaris (Thermoactinomyces vulgaris), bacteroides thetaiotaomicron (Bacteroidesthetaiotaomicron), Pseudomonas (Pseudomonas), bacillus polymyxa (Bacillus polymyxa), Bacillus licheniformis (Bacillus licheniformin), bacstearothermophilus (Bacillus stearothermophilus), the new Starch debranching enzyme of the bacterium of Bacillusthermoamyloliquefaciens and thermus thermophilus (Thermus thermophilus).

Comprise new Starch debranching enzyme (the Journal ofBacteriology that derives from bacstearothermophilus TRS40 (little worker grinds the bacterium preservation No. 9609) in the example of particularly preferred new Starch debranching enzyme, 170 volumes, the 1554th page, 1988), derive from α-Dian Fenmei (the Agricultural and Biological Chemistry of thermoactinomyces vulgaris, 42 volumes, the 1681st page, 1978) and new Starch debranching enzyme type α-Dian Fenmei (the Biosci.Biotechnol.Biochem.57 volume that derives from thermoactinomyces vulgaris, the 395th page, 1993), enzyme polysaccharide (pullulan) lytic enzyme (the Applied Microbiology and Biotechnology of growing sturdily of bacstearothermophilus KP1064,21 volumes, the 20th page, 1985), new Starch debranching enzyme (the Journal ofBacteriology of bacteroides thetaiotaomicron 95-1,173 volumes, the 2926th page, 1991) and new Starch debranching enzyme (the Applied Biochemistry and Biotechnology that derives from bacillus polymyxa, 68 volumes, the 113rd page, 1997), derive from the amylase (J.Biol.Chem. of Bacillus licheniformis, 267 volumes, 22108 pages, 1992), derive from the new Starch debranching enzyme (Biosci.Biotechnol.Biochem. of bacillus KSM-1876,56 volumes, 514 pages, 1992) etc.

New Starch debranching enzyme is characterised in that, for the reactivity of amylose starch with the reactivity of amylopectin is compared remarkable height.If make new Starch debranching enzyme and starch reaction, then the amylose starch in the starch mainly resolves into maltose.Think since in the presence of the sugar more than the disaccharides such as maltose the hydrolysis of the amylopectin that causes of Starch debranching enzyme newly be suppressed, so the result further is higher than reactivity to amylopectin to the reactivity of amylose starch.New Starch debranching enzyme may not also can decompose amylopectin and reduce molecular weight to a certain extent to amylopectin not effect fully.Therefore, though with starch most of or that in fact all constitute by amylopectin as matrix, also can access the product of the distinctive molecular weight reduction that produces by new Starch debranching enzyme.

New Starch debranching enzyme can be according to known method, and for example No. the 1985401st, No. the 1853673rd, Japanese Patent or Japanese Patent etc. are prepared.

Be meant to decompose to have the malto-oligosaccharide and the cyclodextrin of the above polymerization degree of trisaccharide maltose as Cyclomaltodextrinase, but decompose the enzyme of amylopectin, glycogen, panose and different panose hardly.Cyclomaltodextrinase is recorded in the spy and opens in the flat 5-68486 communique.Open in the flat 7-289280 communique the spy, Cyclomaltodextrinase is defined as has following substrate specificity, promptly to the hydrolysis rate of cyclodextrin or affinity greater than polyose or the straight chain shape oligose identical with the cyclodextrin polymerization degree.In Appl.Microbiol.Biotechnol. (1993) 39:197-203 (1993), put down in writing following content, promptly compared Cyclomaltodextrinase and decompose cyclodextrin (CD) rapidly with starch, amylopectin; Since can not prepare CD by starch, therefore different with CGTase; And it is similar with new Starch debranching enzyme in the one-dimentional structure of aminoacid sequence.

Example as Cyclomaltodextrinase, can exemplify the Cyclomaltodextrinase that derives from the bacterium that is selected from bacstearothermophilus (Bacillus stearothermophilus), bacillus acidocldarius (Bacillusthermophilus, Thermus thermophilus), Bacillus coagulans (Bacilluscoagulanc), colon bacillus (Escherichia coli), Flavobacterium (Flavobacterium), Alkaliphilic bacillus (Alkalophillic Bacillus) and Bacillus sphaericus (Bacillus sphaericus).

Example as preferred Cyclomaltodextrinase, comprise the Cyclomaltodextrinase (Appl.Microbiol.Biotechnol.39:197-203 (1993) that derives from Bacillus sphaericus, hereinafter referred to as BSCDase) and derive from Cyclomaltodextrinase (the preserving number FERM-P-13846 that Alkaliphilic bacillus belongs to the A2-5a strain, Bioscience Biotech.Biochem., 58 (3), 517-520 (1994) is hereinafter referred to as A2-5a CDase).

The Fructus Hordei Germinatus α-Dian Fenmei is meant with endo-type and acts on dextran, produces the enzyme of α end group isomeric maltose.At J.Biol.Chem.267 (31) 22108-22114, put down in writing following content in 1992 about the Fructus Hordei Germinatus α-Dian Fenmei, promptly cut off α-1,4-glycosidic link (but can not cut off α-1, the α-1 after the 6-glycosidic link, 4-glycosidic link); Has transfer activity; Decompose cyclodextrin; And it is similar with new Starch debranching enzyme in the one-dimentional structure of aminoacid sequence.

As the example of Fructus Hordei Germinatus α-Dian Fenmei, can exemplify to derive from and be selected from thermoactinomyces vulgaris (Thermoactinomyces vulgaris), bacteroides thetaiotaomicron (Bacteroidesthetaiotaomicron), Pseudomonas (Pseudomonas), bacillus polymyxa (Bacillus polymyxa), Bacillus licheniformis (Bacillus licheniformin), bacstearothermophilus (Bacillus stearothermophilus), Bacillusthermoamyloliquefaciens, the Fructus Hordei Germinatus α-Dian Fenmei of the bacterium of thermus thermophilus (Thermus thermophilus) and bacillus.

Comprise the Fructus Hordei Germinatus α-Dian Fenmei (being called BLMA) that derives from Bacillus licheniformis in the preferred Fructus Hordei Germinatus α-Dian Fenmei.

New Starch debranching enzyme, Cyclomaltodextrinase, Fructus Hordei Germinatus α-Dian Fenmei all are included in the α-Dian Fenmei family.α-Dian Fenmei family defines by the similarity of the structure of the enzyme that contains and the similarity of catalytic mechanism.That is to say that this α-Dian Fenmei family is defined as having following characteristic:

1, acts on α-glycosidic link;

2, hydrolyzing alpha-glycosidic link, the glucose or the malto-oligosaccharide of generation α-end group isomery perhaps form new α-glucosides reaction by the glycosyl shift reaction;

3, on one-dimentional structure, there are 4 conservative regions of various enzyme common.And, there are all catalytic sites and a plurality of matrix combining site in this conservative region;

4, have Asp206, Glu230 and the corresponding Asp of Asp297, Glu and Asp residue with takadiastase A as catalytic site.

As mentioned above, the enzyme that known α-Dian Fenmei family comprises has 4 zones that homology is high, i.e. conservative regions according to the comparison of the one-dimentional structure of aminoacid sequence.Conservative region in the enzyme of said here α-Dian Fenmei family is meant Journal of Bioscience andBioenginieering the 87th volume, the zone shown in Figure 11,2,3 and 4 of 557-565 page or leaf (1999) (being called conservative region 1,2,3 and 4).Conservative region 1～4 is present in the A structural domain with following structure, and described structure is that the structure with 8 repeating units of β chain and α spiral (is called (beta/alpha) ₈-barrel structure).In some enzymes of α-Dian Fenmei family, conservative region 1 begins (for example, α-Dian Fenmei (originating from Aspergillus oryzae)) by about the 120th amino acid position of distance N-terminal side.But, in α-Dian Fenmei family, also have the enzyme of conservative region 1 by about the 240th amino acid position of distance N-terminal side (preferred 239～242 amino acid positions) beginning.The amino acid sequence number of above-mentioned enzyme is begun by the N-terminal of its mature form.The new Starch debranching enzyme that uses among the present invention, Cyclomaltodextrinase and Fructus Hordei Germinatus α-Dian Fenmei can have the feature of the latter's aminoacid sequence.This kind of enzyme also can further have other structural domains (N structural domain) that are made of the amino acid more than 100 before the A structural domain.

The new Starch debranching enzyme that uses among the present invention, Cyclomaltodextrinase and Fructus Hordei Germinatus α-Dian Fenmei comprise by the N-terminal side and play the conservative region 1,2,3 that contains αDian Fenmei family enzyme successively and 4 aminoacid sequence.In new Starch debranching enzyme, Cyclomaltodextrinase and the Fructus Hordei Germinatus α-Dian Fenmei that the present invention uses, the conservative region 1 in the enzyme of α-Dian Fenmei family can begin at the 239th～242 amino acid position of distance N-terminal or with equal in fact position, this position." equal in fact position " can be to be risen and moved 1～10 amino acid whose position by the position of mark (promptly the 239th～242) in N-terminal side or C-terminal side, preferred 1～5 amino acid, more preferably 1～3 amino acid, further preferred 1～2 amino acid, further preferred 1 amino acid again.Most preferably in this amylose starch specific enzymes, conservative region 1 is begun by the 239th～242 position of distance N-terminal.

Saccharifying amylase with cyclodextrin synthesis capability is meant the initial stage in reaction, and the cyclodextrin of synthesized polymer degree more than 6 finally produces the α-Dian Fenmei of glucose, maltose and trisaccharide maltose.

As the example of saccharifying amylase, can exemplify the saccharifying amylase of the bacterium that derives from the subtilis (Bacillus subtilis), streptococcus bovis (Streptococcus bovis), streptomyces hygroscopicus (Streptomyceshygroscopicus), early stage streptomycete (Streptomyces praecox), moral row rhizopus equinus (Rhizopus delemar) and the aspergillus niger (Aspergillus niger) that are selected from IFO14140 strain representative with cyclodextrin synthesis capability with cyclodextrin synthesis capability.

The example of subtilis that has the saccharifying amylase of cyclodextrin synthesis capability as generation, can exemplify the IFO14140 strain (can be by Institute For Fermentation, Osaka, Japan (brief note is IFO) acquisition), Ohaio University, [Journal ofFermentation Technology Vol.41 such as the genus bacillus 1A289 strain of BacillusGenetic Stock Center, field, ridge, No.8,427 (1963)] K02 strain, K05 strain, K12 strain and the D11 strain of record.This K02 strain, K05 strain, K12 strain and D11 strain of finding records such as field, ridge can be synthesized the saccharifying amylase with cyclodextrin synthesis capability.Source, screening method and the activity determination method of the bacterium that obtains generation saccharification type α-Dian Fenmei put down in writing in field, ridge etc.Once screen according to this method, can obtain to produce the bacterial strain of saccharifying amylase.For the bacterial strain of the generation saccharifying amylase that obtains, at J.Ferment.Bioeng., the methods of 71,26 (1996) records are carried out postsearch screening, can select the bacterial strain that produces the enzyme with cyclodextrin synthesis capability according to Xi Cun etc.The saccharifying amylase with cyclodextrin synthesis capability about being given birth to by producing bacillus subtilis is recorded in J.Ferment.Bioeng., in 81,26 (1996).

Produce the bacterium of saccharifying amylase owing to produce the possibility height of the saccharifying amylase with cyclodextrin synthesis capability in the bacteriums such as streptococcus bovis, streptomyces hygroscopicus, early stage streptomycete, moral row rhizopus equinus and aspergillus niger, the bacterium that therefore produces saccharifying amylase also can be suitable for.Whether the bacterium that produces saccharifying amylase produces the saccharifying amylase with cyclodextrin synthesis capability, can be according to J.Ferment.Bioeng. such as Xi Cun, and 81,26 (1996) method is confirmed.

Have the sugar substrate of the wide scope of saccharifying amylase hydrolysis of cyclodextrin synthesis capability, glucose is transferred on the various phenol derivativess, thereby obtain diversified phenol derivatives glucosides.

Saccharifying amylase with cyclodextrin synthesis capability can be according to known method, and for example the method [Journal of Fermentation Technology Vol.41., No.8,427 (1963)] in field, ridge etc. is prepared.

New Starch debranching enzyme, Cyclomaltodextrinase, the Fructus Hordei Germinatus α-Dian Fenmei that the present invention uses and have the saccharifying amylase of cyclodextrin synthesis capability can be by adopting gene recombination method import the microorganisms of the gene of encoding such enzymes.For example, for new Starch debranching enzyme, (spy opens flat 7-177891 communique can be used to come from the base sequence (J.Gen.Microbiol., the 135th volume, 1521 pages (1989)) of the new Starch debranching enzyme of bacstearothermophilus and aminoacid sequence; Also put down in writing the step of reorganization).Perhaps, also can be by using primer, the DNA library of retrieval plant or microorganism etc., the saccharifying amylase that obtains new new Starch debranching enzyme, Cyclomaltodextrinase, Fructus Hordei Germinatus α-Dian Fenmei or have the cyclodextrin synthesis capability based on the known sequence design.The utilization of this new enzyme is also included within the scope of the present invention.

The new Starch debranching enzyme that uses among the present invention, Cyclomaltodextrinase, Fructus Hordei Germinatus α-Dian Fenmei and have on the polypeptide of enzymes such as saccharifying amylase of cyclodextrin synthesis capability and add 1～about 10 polypeptide that amino-acid residue obtains, by the polypeptide of above-mentioned enzyme disappearance 1～about 10 polypeptide that amino-acid residue obtains, perhaps in the polypeptide of above-mentioned enzyme, replace 1～polypeptide that about 10 amino-acid residues obtain also can show this required biologic activity of amylose starch specificity.The amino-acid residue of above-mentioned interpolation, disappearance or replacement can be 10 and even several are to 1.Preferred above-mentioned total number of atnino acid is 10,8,5,3,2 or 1.The amino-acid residue of preferred this disappearance, interpolation or replacement is present in the non-conservative region in the α-Dian Fenmei family.When replacing, the preferred replacement is the replacement of guarding.Conservative replacement is that those skilled in the art are well-known.

Also be easy to those skilled in the art by obtaining this kind of enzyme by the nature screening.And this peptide species can adopt and well known to a person skilled in the art the gene manipulation techniques preparation.

The enzyme that uses among the present invention for example can as described belowly be prepared.At first, cultivate the bacterium of the enzyme that uses among production the present invention.This bacterium also can be the bacterium of this enzyme of direct production.In addition, also the gene cloning of this enzyme of coding can be used the gene that obtains to make for the favourable bacterium of expression of enzymes and carried out the proterties conversion, obtain the proterties transform bacteria, the bacterium that obtains is used for enforcement of the present invention.

The proterties of the bacterium that the employing cloned gene carries out transforms and can carry out according to the method for well known to a person skilled in the art.Use the occasion of cloned gene, preferably this gene is operably connected on composition promotor or the inducible promoter." being operably connected " is meant promotor is connected with gene, enables the expression by this promotor regulatory gene.When using inducible promoter, preferably under inductive condition, cultivate.Various inducible promoters are well known to a person skilled in the art.

Cloned gene also can be connected with signal peptide, and the enzyme secretion that makes generation is outside thalline.Signal peptide is well known to a person skilled in the art.

Those skilled in the art can suitably set the condition of microbial culture in order to produce enzyme.Being suitable for the substratum of microbial culture, the inductive condition that is suitable for various inducible promoters etc. is well known to a person skilled in the art.

After cultivating reasonable time, reclaim enzyme by nutrient solution.The enzyme secretion of producing except that degerming, obtains supernatant liquor by centrifugation to thalline outside the time.When the enzyme of producing is not secreted, handle the bacterium pulverizing, obtain bacterium and pulverize liquid by ultrasonication, mechanical disintegration, chemistry pulverizing etc.Then, bacterium is pulverized the liquid centrifugation, remove the fragment that degerms, obtain supernatant liquor.Employing comprises that the well-known method of ammonium sulfate precipitation or ethanol sedimentation, acid extraction, negatively charged ion or cation exchange chromatography, phosphorylated cotton chromatography, hydrophobic interaction chromatography method, affinity chromatography, hydroxyapatite chromatography method and lectin chromatography reclaims enzyme of the present invention by the supernatant liquor that obtains.The product that reclaims can carry out purifying as required.

The enzyme that uses among the present invention can be purifying enzyme or thick enzyme, can be immobilized enzyme, also can be not immobilized enzyme.The form of reaction can be an intermittent type, also can be continous way.As immobilized method, can use carrier combined techniques (for example covalent attachment method, ionic bond method or physisorphtion), crosslinking or carry the well-known methods of those skilled in the art such as (lattice-type or microcapsule-types) of studying in France.

(activity determination method)

Enzymic activity is as described below to be measured.

(Zulkovsky starch is produced by Merck company to add 40 ℃ of 1.5 w/w % Zulkovsky starch aqueous solution of cultivating down in 40 ℃ of enzyme liquid 50 μ l that cultivate down, and be adjusted to pH5.5 by 40mM acetic acid-Na buffered soln) 200 μ l, reacted 10 minutes down at 40 ℃.In this reaction product, add 0.5N acetic acid and 0.5N hydrochloric acid were mixed the liquid 2ml that obtains by 5: 1, then stir the mixture that obtains, reaction is stopped.Gather the solution 0.1ml after reaction stops, adding the solution 5ml that contains 0.005% iodine and 0.05% potassiumiodide, then stir the mixture that obtains.At room temperature placed 20 minutes, and made it colour developing by iodostarch reaction.Then, measure the absorbancy of this solution at the 660nm place.With the absorbancy that obtains as C.In addition, prepare the solution that replaces above-mentioned enzyme liquid with distilled water, carry out same time-and-motion study absorbancy as blank.With the absorbancy that obtains as B.Adopt following formula to obtain enzymic activity A by C that obtains like this and B.

A＝(B-C)/B×10

Wherein, 1 unit of enzymic activity is 10% of a B value.

(measuring method of the glycosyl rate of transform)

The glycosyl rate of transform is as described below to be measured.

To contain donor such as Zulkovsky starch or maltopentaose and as the solution of the quinhydrones of acceptor, catechin etc., and enzyme liquid mixes, 40 ℃ of reactions 16～24 hours down.With HPLC (the ODS post RP-18 that uses MERCK company to produce; Use is adjusted to the elutriant of 10% methyl alcohol of pH2.5) the analytical reaction product.Measure the absorbancy of the level separatory of HPLC, detect glucosides, carry out then quantitatively at the 280nm place.Obtain the peak area of glucosides.In contrast, preparation is carried out and above-mentioned same operation with the solution of distilled water replacement enzyme liquid, measures the amount of acceptor.Obtain the peak area of acceptor.

Adopt following formula to calculate the glycosyl rate of transform.

Peak area * 100 of the acceptor of the peak area/contrast of the glycosyl rate of transform=glucosides

(phenol derivatives and sugared reaction)

In the step that above-mentioned sugar in the preparation method of phenol derivatives glucosides of the present invention and above-mentioned phenol derivatives react in the presence of enzyme, so long as reaction conditionss such as the pH of generation phenol derivatives glucosides, temperature can adopt any condition.The concentration of above-mentioned sugar and phenol derivatives can consider that also reaction conditions etc. determines.In the stage of beginning enzyme reaction, not necessarily the total amount of saccharide donor such as dextrin and phenol derivatives must be dissolved in the dissolvant of reaction system.Even few amount as long as there is the dissolved dextrin, just can make the reaction beginning.For example, even when a part of dextrin does not dissolve, make the reaction beginning by the dissolved dextrin, along with the carrying out of enzyme reaction, undissolved dextrin is little by little dissolving also, constantly reacts.Equally, even when the part of phenol derivatives is not dissolved, along with the carrying out of enzyme reaction, undissolved phenol derivatives also little by little dissolving react.

When enzyme was new Starch debranching enzyme, the pH of reaction system was preferably about 4.0 to about 8.0.Consider that from the aspects such as stability of speed of response, efficient, enzyme more preferably from about 5.0 to about 7.5, further preferred about 5.5 to about 7.0.Preferably about 10 ℃ to about 80 ℃ of temperature.Consider from the aspects such as stability of speed of response, efficient, enzyme, more preferably from about 20 ℃ to about 60 ℃, further preferred about 40 ℃.Preferably about 1 to 100 hour of reaction times, more preferably from about 1 to 50 hour, further preferred about 16 hours.Phenol derivatives concentration is preferably about 0.1 weight % to about 50 weight %, considers from the aspects such as processing difficulty or ease of speed of response, efficient, matrix solution, and more preferably from about 1 weight % is to about 20 weight %, and further preferred about 1 weight % is to about 5 weight %.Sugar concentration is preferably about 0.1 weight % to about 70 weight %, considers from the aspects such as processing difficulty or ease of speed of response, efficient, matrix solution, and more preferably from about 1 weight % is to about 20 weight %, further preferred about 5 weight %～about 10 weight %.The amount of the enzyme that uses determines according to the relation with reaction times, substrate concn, preferably selects to make the enzyme amount that finishes in about 1 hour to about 72 hours that is reflected at usually.The preferred every 1g matrix of using of enzyme amount is generally about 50～10000 units.

When enzyme was Cyclomaltodextrinase, the pH of reaction system was preferably about 4.0 to about 8.0.Consider that from the aspects such as stability of speed of response, efficient, enzyme more preferably from about 5.0 to about 7.5, further preferred about 6.0 to about 7.0.Preferably about 10 ℃ to about 80 ℃ of temperature.Consider from the aspects such as stability of speed of response, efficient, enzyme, more preferably from about 20 ℃ to about 60 ℃, further preferred about 40 ℃.Preferably about 1 to 100 hour of reaction times, more preferably from about 1 to 50 hour, further preferred about 16 hours.Phenol derivatives concentration is preferably about 0.1 weight % to about 50 weight %, considers from the aspects such as processing difficulty or ease of speed of response, efficient, matrix solution, and more preferably from about 1 weight % is to about 20 weight %, and further preferred about 1 weight % is to about 5 weight %.Sugar concentration is preferably about 0.1 weight % to about 70 weight %, considers from the aspects such as processing difficulty or ease of speed of response, efficient, matrix solution, and more preferably from about 1 weight % is to about 20 weight %, and further preferred about 5 weight % are to about 10 weight %.The amount of the enzyme that uses determines according to the relation with reaction times, substrate concn, preferably selects to make the enzyme amount that finishes in about 1 hour to about 72 hours that is reflected at usually.The preferred every 1g matrix of using of enzyme amount is generally about 50～10000 units.

When enzyme was the Fructus Hordei Germinatus α-Dian Fenmei, the pH of reaction system was preferably about 4.0 to about 8.0.Consider that from the aspects such as stability of speed of response, efficient, enzyme more preferably from about 5.0 to about 7.5, further preferred about 5.5 to about 7.0.Preferably about 10 ℃ to about 80 ℃ of temperature.Consider from the aspects such as stability of speed of response, efficient, enzyme, more preferably from about 20 ℃ to about 60 ℃, further preferred about 40 ℃.Preferably about 1 to 100 hour of reaction times, more preferably from about 1 to 50 hour, further preferred about 16 hours.Phenol derivatives concentration is preferably about 0.1 weight % to about 50 weight %, considers from the aspects such as processing difficulty or ease of speed of response, efficient, matrix solution, and more preferably from about 1 weight % is to about 20 weight %, and further preferred about 1 weight % is to about 5 weight %.Sugar concentration is preferably about 0.1 weight % to about 70 weight %, considers from the aspects such as processing difficulty or ease of speed of response, efficient, matrix solution, and more preferably from about 1 weight % is to about 20 weight %, and further preferred about 5 weight % are to about 10 weight %.The amount of the enzyme that uses determines according to the relation with reaction times, substrate concn, preferably selects to make the enzyme amount that finishes in about 1 hour to about 72 hours that is reflected at usually.The preferred every 1g matrix of using of enzyme amount is generally about 50～10000 units.

Enzyme is when having the saccharifying amylase of cyclodextrin synthesis capability, and the pH during reaction is generally about 3.0 to about 11.0.Consider preferred about 4.0 to about 7.0, further preferred about 4.0 to about 6.5 from the aspects such as stability of speed of response, efficient, enzyme.Temperature of reaction is about 10 ℃ to about 80 ℃, considers preferred about 30 ℃ to about 60 ℃ from the aspects such as stability of speed of response, efficient, enzyme.Reaction times is generally about 3 to 72 hours, and preferred about 10 to 24 hours, further preferred about 16 hours.Phenol derivatives concentration is generally about 1 weight % to about 40 weight %, considers from the aspects such as processing difficulty or ease of speed of response, efficient, matrix solution, and preferred about 1 weight % is to about 40 weight %, and further preferred about 5 weight % are to about 20 weight %.Sugar concentration is generally about 1 weight % to about 50 weight %, considers from the aspects such as processing difficulty or ease of speed of response, efficient, matrix solution, and further preferred about 10 weight % are to about 50 weight %.The amount of the enzyme that uses determines according to the relation with reaction times, substrate concn, preferably selects to make the enzyme amount that finishes in about 10 hours to about 24 hours that is reflected at usually.The every 1g matrix of using of enzyme amount is generally about 10～10000 units.

(separation of product and purifying)

The phenol derivatives glucosides that obtains by above-mentioned reaction can adopt the well-known separation method of those skilled in the art to separate and purifying.For example, can utilize the distribution and the chromatography (example gel filtration chromatography, HPLC) of use all kinds of SOLVENTS (for example methyl alcohol, ethanol) to carry out purifying alone or in combination.

The phenol derivatives glucosides that obtains by above-mentioned reaction preferably carries out purifying by the chromatography that makes spent ion exchange resin.Ion exchange resin can be Zeo-karb, also can be anionite-exchange resin.More preferably Zeo-karb.This interaction that is based between part or all and the phenol derivatives glucosides of interaction between metal such as bonded calcium, lead, zinc, sodium on Zeo-karb or the Zeo-karb or hydrogen and the phenol derivatives or anionite-exchange resin changes according to the glycosylation of phenol derivatives.Infer that part or all of anionite-exchange resin and interaction between the phenol derivatives glucosides may be based on resin all and the hydrophobic interaction of phenol derivatives glucosides.If carry out purifying by the chromatography of using Zeo-karb or anionite-exchange resin, can be with 1 step of glucosides purifying.

As long as Zeo-karb can separating phenol derivative and phenol derivatives glucosides, can use Zeo-karb arbitrarily.As the example of Zeo-karb, can exemplify DIAION SK1B, DIAION SK104, DIAIONSK110, DIAION PK208, DIAION PK212, DIAION PK216, DIAION UBK530 and DIAION UBK550 that commercially available Mitsubishi Chemical society produces; And CR-1310, CR-1320, Amberlite IR120B, Amberlite 200CT and the IRC50 of the production of organic Co., Ltd..

As long as anionite-exchange resin can separating phenol derivative and phenol derivatives glucosides, can use anionite-exchange resin arbitrarily.As the example of anionite-exchange resin, can exemplify PA412, WA-30 and PA-308 that commercially available Mitsubishi chemical Co., Ltd produces; And IRA96SB, IRA910CT, XT6050RF and the IRA900 of the production of organic Co., Ltd..Preferably for example styrenic anionite-exchange resin being carried out pre-treatment makes C1 type, acetic acid type, calcareous type or nitric acid type and uses so that be difficult to cause anionresin.Anionite-exchange resin more preferably carries out using after pre-treatment makes it to form the C1 type to styrenic anionite-exchange resin.

By using the chromatography of Zeo-karb or anionite-exchange resin, can with respectively independently fraction reclaim the phenol derivatives glucosides, as the sugar (for example dextrinosan) and the unreacted phenol derivatives of by product.Therefore, these materials that can effectively utilize classification to obtain once more.

In the method for the invention, also can implement to carry out continuously the simulation moving-bed formula column chromatography of purifying as required.

(purposes of phenol derivatives glucosides)

The surrogate that the phenol derivatives glucosides that obtains according to method of the present invention can be used as phenol derivatives is used for various uses.Particularly these phenol derivatives glucosides can be used as composition for beverage or food, food adds with the age resister of composition, transfusion, bonding composition, starch, composition for oral cavity, medicine, healthcare products and makeup use.In these purposes, these phenol derivatives glucosides can use with all-purpose concentration.

Embodiment

(preparation example 1: the preparation of Cyclomaltodextrinase)

Prepare the karyomit(e) that Alkaliphilic bacillus belongs to A2-5a strain (preserving number FERM-P-13864) according to ordinary method.(DBJ/EMBL/GenBank AB015670), according to the synthetic oligonucleotide with following sequence of ordinary method, uses as the PCR primer to belong to the base sequence of the Cyclomaltodextrinase gene of A2-5a strain with reference to disclosed Alkaliphilic bacillus.The sequence of PCR primer is as follows:

NP6N-NCO:TGGCCATGGTAAAAGAAGCGATTTA; And

NP6N-KPN：TTCGGTACCTTAAATCACCTTTATAACACC。

Use the karyomit(e) and the primer of preparation, 94 ℃ handle 1 minute after, carry out 94 ℃ following 0.5 minute, 50 ℃ following 1 minute and 72 ℃ of following circulations of 2 minutes 30 times repeatedly.Under this condition, carry out PCR, the gene segment of amplification Cyclomaltodextrinase.

Gene segment with restriction enzyme NcoI and KpnI cut off amplification is connected with the carrier pKK388-1 (production of Clontech company) that cuts off with these enzymes in advance, obtains recombinant plasmid pNPR63.According to ordinary method this plasmid is imported intestinal bacteria TG-1 strains (production of AmershamPharmacia Biotech company), obtain having the reorganization TG-1 strain that Alkaliphilic bacillus belongs to A2-5a strain Cyclomaltodextrinase gene.

The reorganization TG-1 strain 0.01g that obtains is mixed among L substratum (1.0% Tryptones, 0.5% yeast extract and the 0.5%NaCl) 10ml that contains 50 μ g/ml penbritins, at 37 ℃ of one nights of following shaking culture, obtains pre-nutrient solution.

This pre-nutrient solution 10ml added to 1 liter of Terrific substratum is housed (LifeTechnologies Oriental (strain) produces, the penbritin that contains 50 μ g/ml) in 2 liters of slope mouth flasks, use the shaking culture machine to descend the vibration flasks 3 hours then at 37 ℃.Then, the design temperature of shaking culture machine changed to 15 ℃ after, at 15 ℃ of vibration flasks 30 minutes down.Then, in flask, add sec.-propyl-β-D-galactopyranoside (the pure medicine production of IPGP and light), make ultimate density reach 0.1mM, descended the vibration flasks 20 hours at 15 ℃ again.

Then, with product centrifugation 10 minutes, reclaim bacterium with 10000rpm.The bacterium that obtains is outstanding turbid in the 10mM of 50ml sodium phosphate buffer (pH7.5) (hereinafter referred to as damping fluid ML).This suspension liquid is carried out ultrasonication, bacterium is pulverized.Then, with product centrifugation 10 minutes, remove insolubles, obtain crude enzyme liquid with 10000rpm.

In this crude enzyme liquid, add ammonium sulfate and reach 70% saturated, make the Cyclomaltodextrinase precipitation.Sedimentary Cyclomaltodextrinase is outstanding turbid in the damping fluid ML of about 20ml.Afterwards, change damping fluid 1 time every day for damping fluid ML, simultaneously with this suspension liquid dialysis 3 days.

Suspension liquid after the dialysis is packed in the Q-Sepharose post of crossing with damping fluid ML balance (Amersham Pharmacia Biotech production).Wash this post with the damping fluid ML that contains 0.2M NaCl, then make the damping fluid ML that contains 0.4M NaCl flow through the wash-out Cyclomaltodextrinase.

Change damping fluid 1 time every day for damping fluid ML, simultaneously the active fraction that obtains was dialysed 3 days.Solution after the dialysis is packed in the ResourceQ post of crossing with damping fluid ML balance (Amersham Pharmacia Biotech production).Wash this post with the damping fluid ML that contains 0.2M NaCl.Afterwards, make the NaCl concentration straight line among the damping fluid ML rise to 0.4M, the wash-out Cyclomaltodextrinase.Change damping fluid 1 time every day for damping fluid ML, simultaneously the active fraction that obtains was dialysed 3 days, obtain purity ring glycase liquid.

(preparation example 2: the preparation of Fructus Hordei Germinatus α-Dian Fenmei)

The karyomit(e) for preparing Bacillus licheniformis ATCC27811 strain according to ordinary method.Base sequence (the Kim of the Fructus Hordei Germinatus alpha-amylase gene (being also referred to as the BLMA gene) of the disclosed Bacillus licheniformis ATCC27811 of reference strain, I.C. etc., J.Biol.Chem., 267,11108-22114 (1992)), according to the synthetic oligonucleotide of ordinary method, use as the PCR primer with following sequence.The sequence of PCR primer is as follows:

NP4N-NDE:TGGCATATGATCGAATTAGCAGCGATAC; With

NP4N-ECO：CTTGAATTCTTAACAGAATTTAGACCGC。

Use the karyomit(e) and the primer of preparation, 94 ℃ handle 1 minute after, carry out 94 ℃ following 0.5 minute, 50 ℃ following 1 minute and 72 ℃ of following circulations of 2 minutes 30 times repeatedly.Under this condition, carry out PCR, the gene segment of amplification Fructus Hordei Germinatus α-Dian Fenmei.

Gene segment with restriction enzyme NdeI and EcoRI cut off amplification is connected with the carrier pGEX-Nde2 that cuts off with these enzymes in advance, obtains recombinant plasmid pNPR63.PGEX-Nde2 is to use archaeal dna polymerase that these four bases of CTGA are inserted into Terada etc. at Applied andEnvironmental Microbiology, and unique XbaI restriction enzyme of the pGEX-Nde of 165:910-915 (1999) record is cut off the plasmid that the position obtains.According to ordinary method this plasmid is imported intestinal bacteria TG-1 strains (production of Amersham Pharmacia Biotech company), obtain the Fructus Hordei Germinatus alpha-amylase gene reorganization TG-1 strain of Bacillus licheniformis ATCC27811 strain.

0.01g is mixed among the L substratum 10ml that contains 50 μ g/ml penbritins with reorganization TG-1 strain, then with substratum 37 ℃ of one nights of following shaking culture, obtain pre-nutrient solution.

This pre-nutrient solution 10ml is added in 2 liters of slope mouth flasks that 1 liter of Terrific substratum (LifeTechnologies Oriental (strain) produces, and contains the penbritin of 50 μ g/ml) is housed, descended the vibration flasks 3 hours at 37 ℃ then.Then, the design temperature of shaking culture machine changed to 15 ℃ after, at 15 ℃ of vibration flasks 30 minutes down.Then, in flask, add sec.-propyl-β-D-galactopyranoside (the pure medicine production of IPGP and light), make ultimate density reach 0.1mM, descended the vibration flasks 20 hours at 15 ℃ again.

Then, with product centrifugation 10 minutes, reclaim bacterium with 10000rpm.The bacterium that obtains is outstanding turbid in the 10mM of 50ml sodium phosphate buffer (pH7.5) (hereinafter referred to as damping fluid ML).This suspension liquid is carried out ultrasonication, bacterium is pulverized.Then, with product centrifugation 15 minutes, remove insolubles, obtain crude enzyme liquid with 10000rpm.

In this crude enzyme liquid, add ammonium sulfate and reach 70% saturated, make Fructus Hordei Germinatus α-Dian Fenmei precipitation.Sedimentary Fructus Hordei Germinatus α-Dian Fenmei is outstanding turbid in the damping fluid ML of about 20ml, change damping fluid 1 time every day for damping fluid ML then, simultaneously with this suspension liquid dialysis 3 days.

Solution after the dialysis is packed in the Q-Sepharose post of crossing with damping fluid ML balance (Amersham Pharmacia Biotech production).Wash this post with the damping fluid ML that contains 0.4M NaCl, the damping fluid ML that contains 1.0M NaCl is flow through, wash-out Fructus Hordei Germinatus α-Dian Fenmei.

Change damping fluid 1 time every day for damping fluid ML, simultaneously the active fraction that obtains was dialysed 3 days, obtain purifying Fructus Hordei Germinatus α-Dian Fenmei liquid.(embodiment 1: the preparation of quinhydrones-O-α-D-glycopyranoside)

Quinhydrones (producing with the pure medicine of light society) and maltopentaose (sugaring society in salt solution port produces) are dissolved in 20mM acetic acid-Na damping fluid (pH5.5), obtain the solution of quinhydrones 10 weight % and maltopentaose 20 weight %.In this solution 10ml, add the saccharifying amylase liquid 10ml with cyclodextrin synthesis capability of enzymic activity 60 units, obtain mixture.This enzyme liquid is to use subtilis IFO14140 strain preparation according to the method for records such as field, above-mentioned ridge.This mixture was reacted 18 hours down at 40 ℃.Then, add the ethyl acetate of 3 times of amounts in this reaction product, the thermal agitation container stops enzyme reaction.Then, this reaction product at room temperature left standstill 30 minutes after, reclaim water fraction (being lower floor).This operation is carried out 3 times, removes unreacted quinhydrones fully.The water fraction that drying under reduced pressure finally obtains obtains sample.

With the distilled water of sample dissolution, obtain sample solution in 10ml.This sample solution is joined in the active carbon column of crossing with the distilled water balance (producing with the pure medicine of light society), glucosides is adsorbed onto on the activated carbon column.Then, be adsorbed on unreacted sugar on the activated carbon column with 20% methanol aqueous solution 200ml wash-out.Then, with 100% methyl alcohol 300ml wash-out glucosides.After will containing 100% methyl alcohol fraction drying under reduced pressure of glucosides, residue is dissolved in the distilled water once more, carries out lyophilize.By above operation, obtain the about 250mg of white powder.

This powder 1mg and alpha-glucosidase (production of TOYOBO society) 20 units are dissolved in phosphoric acid buffer (pH7.0), obtain solution.This solution was cultivated 4 hours down at 40 ℃.After the cultivation, this solution is imposed on the HPLC that uses ODS post RP-18 (production of MERCK company), use and be adjusted to 10% methanol aqueous solution of pH2.5 as mobile phase.Measure the absorbancy of each fraction of elutriant, detect the quinhydrones glucosides at the 280nm place.As a result, the peak completely dissolve of quinhydrones one glucoside reappears the peak of quinhydrones.The powder that hence one can see that obtains is that glucose α is combined in the glucosides (quinhydrones one glucoside) on the quinhydrones.

And by the structure of NMR (JNM-GX270 that JEOL society produces) affirmation quinhydrones one glucoside, the result is same as described above.

The purity of quinhydrones one glucoside that the result obtains as can be known is 96%.(embodiment 2: the preparation of quinhydrones-O-α-D-glycopyranoside)

Quinhydrones (producing with the pure medicine of light society) and maltopentaose (sugaring society in salt solution port produces) are dissolved in 20mM acetic acid-Na damping fluid (pH5.5), obtain the solution of quinhydrones 10 weight % and maltopentaose 40 weight %.In this solution 10ml, add the saccharifying amylase liquid 10ml with cyclodextrin synthesis capability of enzymic activity 60 units, obtain mixture.This enzyme liquid is to use subtilis IFO14140 strain preparation according to the method for records such as field, above-mentioned ridge.At J.Ferment.Bioeng., the methods of 71,26 (1996) records confirm to have the cyclodextrin synthesis capability to this enzyme liquid according to Xi Cun etc.This mixture was reacted 16 hours down at 40 ℃.

Then, adopt Sephadex G-15 that this reaction product is carried out gel-filtration, obtain the hydroquinone glucoside (purity 90%) of about 800mg.(embodiment 3: the preparation of quinhydrones-O-α-D-glycopyranoside)

Quinhydrones (producing with the pure medicine of light society) and maltopentaose (sugaring society in salt solution port produces) are dissolved in 20mM acetic acid-Na damping fluid (pH5.5), obtain the solution of quinhydrones 5 weight % and maltopentaose 5 weight %.In this solution 10ml, add the new Starch debranching enzyme liquid 10ml of enzymic activity 60 units, obtain mixture.This enzyme liquid is according to Journal of Bacteriology, 170 volumes, and the 1554th page, the method for record in 1988 uses bacstearothermophilus TRS40 to prepare.Make this mixture 40 ℃ of down reactions, the reaction beginning was appended weight with respect to mixture respectively and is 2% the maltopentaose and the new Starch debranching enzyme of 30 units after 3,8 and 12 hours, add up to reaction 24 hours.

Then, adopt Sephadex G-15 that this reaction product is carried out gel-filtration, obtain the hydroquinone glucoside (purity 85%) of about 100mg.

By gel-filtration, the fractions different with the fraction that contains hydroquinone glucoside contain saccharic.This contains the saccharic that contains in the fraction of saccharic about 60% and is dextrinosan.(embodiment 4: the preparation of quinhydrones-O-α-D-glycopyranoside)

Quinhydrones (producing with the pure medicine of light society) and maltopentaose (sugaring society in salt solution port produces) are dissolved in 20mM acetic acid-Na damping fluid (pH5.5), obtain the solution of quinhydrones 5 weight % and maltopentaose 50 weight %.In this solution 10ml, add the Cyclomaltodextrinase liquid 5ml of enzymic activity 10 units, obtain mixture.This enzyme liquid be preparation example 1 obtain derive from the enzyme liquid that Alkaliphilic bacillus belongs to A2-5a.This mixture was reacted 16 hours down at 40 ℃.

Then, adopt Sephadex G-10 that this reaction product is carried out gel-filtration, obtain the hydroquinone glucoside (purity 85%) of about 50mg.

By gel-filtration, the fractions different with the fraction that contains hydroquinone glucoside contain saccharic.This contains the saccharic that contains in the fraction of saccharic about 50% and is dextrinosan.(embodiment 5: the preparation of quinhydrones-O-α-D-glycopyranoside)

Quinhydrones (producing with the pure medicine of light society) and maltopentaose (sugaring society in salt solution port produces) are dissolved in 20mM acetic acid-Na damping fluid (pH5.5), obtain the solution of quinhydrones 3 weight % and maltopentaose 10 weight %.In this solution 10ml, add the Fructus Hordei Germinatus α-Dian Fenmei liquid 10ml of enzymic activity 10 units, obtain mixture.This enzyme liquid is the enzyme liquid that derives from Bacillus licheniformis ATCC27811 that preparation example 2 obtains.Per 3 hours, in this mixture, add weight with respect to reactant and be 1% quinhydrones, be 1% the maltopentaose and the Fructus Hordei Germinatus α-Dian Fenmei of enzymic activity 10 units with respect to the weight of reactant, add up to reaction 24 hours down at 40 ℃ simultaneously.

Then, adopt Sephadex G-15 that this reaction product is carried out gel-filtration, obtain the hydroquinone glucoside (purity 80%) of about 30mg.

By gel-filtration, the fractions different with the fraction that contains hydroquinone glucoside contain saccharic.This contains the saccharic that contains in the fraction of saccharic about 50% and is dextrinosan.(embodiment 6: the preparation of catechin-O-α-D-glycopyranoside)

Catechin (production of Funakoshi company) and maltopentaose (sugaring society in salt solution port produces) are dissolved in 20mM acetic acid-Na damping fluid (pH5.5), obtain the solution of catechin 2 weight % and maltopentaose 10 weight %.In this solution 1ml, add the saccharifying amylase liquid 1ml with cyclodextrin synthesis capability of amylase activity 10 units, obtain mixture.This enzyme liquid is to use subtilis IFO14140 strain preparation according to the method for records such as field, above-mentioned ridge.This mixture was reacted 16 hours down at 40 ℃.

Then, adopt HPLC to analyze this reaction product.HPLC uses ODS post RP-18, with acetonitrile/ethyl acetate/0.05% phosphoric acid=12/2/86 wash-out, by the absorbance detection product of 280nm.As a result, except unreacted catechin, also confirmed the peak of new catechin glucosides.

Then, in this reaction product 2ml, add the alpha-glucosidase (production of TOYOBO society) of enzymic activity 40 units, reacted 6 hours down at 40 ℃.Alpha-glucosidase is the enzyme of the non-reduced terminal α-D-glucoside bond that exists of hydrolysis.Then, analyze this reaction product with above-mentioned same employing HPLC.As a result, the peak of catechin glucosides disappears, and compares with the reaction product before handling with alpha-glucosidase, and the peak of unreacted catechin increases.Can confirm that thus the catechin glucosides is that glucose is combined in the compound on the catechin by α-D-glucoside bond.The glycosyl rate of transform in this reaction is about 28%.

Adopt Zeo-karb (the DIAION UBK530 that Mitsubishi Kasei Corp produces) as mobile phase reaction product to be carried out classification with water.As a result, obtain the catechin glucosides (5mg) (purity 70%) of purifying.(embodiment 7: the preparation of epigallocatechin-O-α-D-glycopyranoside)

Epigallocatechin (production of Funakoshi company) and maltopentaose (sugaring society in salt solution port produces) are dissolved in 20mM acetic acid-Na damping fluid (pH5.5), obtain the solution of epigallocatechin 2 weight % and maltopentaose 10 weight %.In this solution 1ml, add the saccharifying amylase liquid 1ml with cyclodextrin synthesis capability of amylase activity 10 units, stir and obtain mixture.This enzyme liquid is to use subtilis IFO14140 strain preparation according to the method for records such as field, above-mentioned ridge.This mixture was reacted 16 hours down at 40 ℃.

Then, adopt HPLC to analyze this reaction product.HPLC uses ODS post RP-18, with acetonitrile/ethyl acetate/0.05% phosphoric acid=12/2/86 wash-out, by the absorbance detection product of 280nm.As a result, except unreacted epigallocatechin, also confirmed the peak of new epigallocatechin glucosides.

Then, in this reaction product 2ml, add the alpha-glucosidase (production of TOYOBO society) of enzymic activity 40 units, reacted 6 hours down at 40 ℃.Then, analyze this reaction product with above-mentioned same employing HPLC.As a result, the peak of epigallocatechin glucosides disappears, and compares with the reaction product before handling with alpha-glucosidase, and the peak of unreacted epigallocatechin increases.Can confirm that thus the epigallocatechin glucosides is that glucose is combined in the compound on the epigallocatechin by α-D-glucoside bond.The glycosyl rate of transform in this reaction is about 20%.

Adopt Zeo-karb (the DIAION UBK530 that Mitsubishi Kasei Corp produces) as mobile phase reaction product to be carried out classification with water.As a result, obtain the epigallocatechin glucosides (7mg) (purity 70%) of purifying.(embodiment 8: the preparation of gallate table catechu ester-O-α-D-glycopyranoside)

Gallate table catechu ester (production of Funakoshi company) and maltopentaose (sugaring society in salt solution port produces) are dissolved in 20mM acetic acid-Na damping fluid (pH5.5), obtain the solution of gallate table catechu ester 2 weight % and maltopentaose 10 weight %.In this solution 1ml, add the saccharifying amylase liquid 1ml with cyclodextrin synthesis capability of amylase activity 20 units, stir and obtain mixture.This enzyme liquid is to use subtilis IFO14140 strain preparation according to the method for records such as field, above-mentioned ridge.This mixture was reacted 16 hours down at 40 ℃.

Then, adopt HPLC to analyze this reaction product.HPLC uses ODS post RP-18, with acetonitrile/ethyl acetate/0.05% phosphoric acid=12/2/86 wash-out, by the absorbance detection product of 280nm.As a result, except unreacted gallate table catechu ester, also confirmed the peak of new gallate table catechu ester glucosides.

Then, in this reaction product 2ml, add the alpha-glucosidase (production of TOYOBO society) of enzymic activity 40 units, reacted 6 hours down at 40 ℃.Then, analyze this reaction product with above-mentioned same employing HPLC.As a result, the peak of gallate table catechu ester glucosides disappears, and compares with the reaction product before handling with alpha-glucosidase, and the peak of unreacted gallate table catechu ester increases.Can confirm that thus gallate table catechu ester glucosides is glucose and is combined in compound on the gallate table catechu ester by α-D-glucoside bond.The glycosyl rate of transform in this reaction is about 20%.

Adopt Zeo-karb (the DIAION SK1B that Mitsubishi Kasei Corp produces) as mobile phase reaction product to be carried out classification with water.As a result, obtain the gallate table catechu ester glucosides (8mg) (purity 70%) of purifying.(embodiment 9:3, the preparation of 4-syringol-O-α-D-glycopyranoside)

With 3,4-syringol (production of Sigma company) and maltopentaose (sugaring society in salt solution port produces) are dissolved in 20mM acetic acid-Na damping fluid (pH5.5), obtain 3, the solution of 4-syringol 2 weight % and maltopentaose 10 weight %.In this solution 1ml, add the saccharifying amylase liquid 1ml with cyclodextrin synthesis capability of amylase activity 15 units, stir and obtain mixture.This enzyme liquid is to use subtilis IFO14140 strain preparation according to the method for records such as field, above-mentioned ridge.This mixture was reacted 16 hours down at 40 ℃.

Then, adopt HPLC to analyze this reaction product.HPLC uses ODS post RP-18, with 25% methanol aqueous solution wash-out, by the absorbance detection product of 280nm.As a result, except unreacted 3, beyond the 4-syringol, also confirmed new 3, the peak of 4-syringol glucosides.

Then, in this reaction product 2ml, add the alpha-glucosidase (production of TOYOBO society) of enzymic activity 40 units, reacted 4 hours down at 40 ℃.Then, analyze this reaction product with above-mentioned same employing HPLC.As a result, 3, the peak of 4-syringol glucosides disappears, and compares with the reaction product before handling with alpha-glucosidase, and is unreacted 3, and the peak of 4-syringol increases.Can confirm 3 thus, 4-syringol glucosides is that glucose is combined in 3 by α-D-glucoside bond, the compound on the 4-syringol.The glycosyl rate of transform in this reaction is about 12%.

Adopt Zeo-karb (the DIAION UBK530 that Mitsubishi Kasei Corp produces) as mobile phase reaction product to be carried out classification with water.As a result, obtain 3 of purifying, 4-syringol glucosides (2mg) (purity 90%).(embodiment 10:3, the preparation of 5-syringol-O-α-D-glycopyranoside)

With 3,5-syringol (production of Sigma company) and maltopentaose (sugaring society in salt solution port produces) are dissolved in 20mM acetic acid-Na damping fluid (pH5.5), obtain 3, the solution of 5-syringol 2 weight % and maltopentaose 10 weight %.In this solution 1ml, add the saccharifying amylase liquid 1ml with cyclodextrin synthesis capability of amylase activity 15 units, stir and obtain mixture.This enzyme liquid is to use subtilis IFO14140 strain preparation according to the method for records such as field, above-mentioned ridge.This mixture was reacted 16 hours down at 40 ℃.

Then, adopt HPLC to analyze this reaction product.HPLC uses ODS post RP-18, with 25% methanol aqueous solution wash-out, by the absorbance detection product of 280nm.As a result, except unreacted 3, beyond the 5-syringol, also confirmed new 3, the peak of 5-syringol glucosides.

Then, in this reaction product 2ml, add the alpha-glucosidase (production of TOYOBO society) of enzymic activity 40 units, reacted 4 hours down at 40 ℃.Then, analyze this reaction product with above-mentioned same employing HPLC.As a result, 3, the peak of 5-syringol glucosides disappears, and compares with the reaction product before handling with alpha-glucosidase, and is unreacted 3, and the peak of 5-syringol increases.Can confirm 3 thus, 5-syringol glucosides is that glucose is combined in 3 by α-D-glucoside bond, the compound on the 5-syringol.The glycosyl rate of transform in this reaction is about 18%.

Adopt Zeo-karb (the DIAION UBK530 that Mitsubishi Kasei Corp produces) as mobile phase reaction product to be carried out classification with water.As a result, obtain 3 of purifying, 5-syringol glucosides (4mg) (purity 90%).(embodiment 11: the preparation of paracetamol-O-α-D-glycopyranoside)

Paracetamol (production of Sigma company) and maltopentaose (sugaring society in salt solution port produces) are dissolved in 20mM acetic acid-Na damping fluid (pH5.5), obtain the solution of paracetamol 2 weight % and maltopentaose 10 weight %.In this solution 1ml, add the saccharifying amylase liquid 1ml with cyclodextrin synthesis capability of amylase activity 10 units, stir and obtain mixture.This enzyme liquid is to use subtilis IFO14140 strain preparation according to the method for records such as field, above-mentioned ridge.This mixture was reacted 16 hours down at 40 ℃.

Then, adopt HPLC to analyze this reaction product.HPLC uses ODS post RP-18, with 25% methanol aqueous solution wash-out, by the absorbance detection product of 280nm.As a result, except unreacted paracetamol, also confirmed the peak of new paracetamol glucosides.

Then, in this reaction product 2ml, add the alpha-glucosidase (production of TOYOBO society) of enzymic activity 40 units, reacted 4 hours down at 40 ℃.Alpha-glucosidase is the enzyme of the non-reduced terminal α-D-glucoside bond that exists of hydrolysis.Then, analyze this reaction product with above-mentioned same employing HPLC.As a result, the peak of paracetamol glucosides disappears, and compares with the reaction product before handling with alpha-glucosidase, and the peak of unreacted paracetamol increases.Confirm that thus the paracetamol glucosides is that glucose is combined in the compound on the paracetamol by α-D-glucoside bond.The glycosyl rate of transform in this reaction is about 5%.

Adopt Zeo-karb (the DIAION UBK530 that Mitsubishi Kasei Corp produces) as mobile phase reaction product to be carried out classification with water.As a result, obtain the paracetamol glucosides (1mg) (purity 85%) of purifying.(embodiment 12: the preparation of quinhydrones-O-α-D-glycopyranoside)

Quinhydrones (producing with the pure medicine of light society) and maltopentaose (sugaring society in salt solution port produces) are dissolved in 20mM acetic acid-Na damping fluid (pH5.5), obtain the solution of quinhydrones 10 weight % and maltopentaose 10 weight %.In this solution 10ml, add the saccharifying amylase powder with cyclodextrin synthesis capability of enzymic activity 30 units, obtain mixture.This powder is to use subtilis IFO14140 strain preparation according to the method for records such as field, above-mentioned ridge.Make this mixture 40 ℃ of reactions down, the reaction beginning is after 3,9 and 15 hours, and appending with respect to mixed solution weight respectively is the maltopentaose of 1g and the saccharifying amylase with cyclodextrin synthesis capability of 30 units, adds up to reaction 19 hours.

Then, adopt Sephadex G-25 that this reaction product is carried out gel-filtration, obtain quinhydrones one glucoside (purity 96%) of about 600mg.(embodiment 13: the preparation of quinhydrones-O-α-D-glycopyranoside)

Quinhydrones (producing with the pure medicine of light society) and amylolysis thing (PINE-DEX 1 that SongGu Chemical Industrial Co., Ltd produces) are dissolved in the water, obtain the solution of quinhydrones 15 weight % and amylolysis thing 40 weight %.In this solution 10ml, add the saccharifying amylase powder with cyclodextrin synthesis capability of enzymic activity 30 units, stir and obtain mixture.This powder is to use subtilis IFO14140 strain preparation according to the method for records such as field, above-mentioned ridge.This mixture was reacted 20 hours down at 40 ℃.

Then, the DIAION UBK530 that adopts Mitsubishi Kasei Corp to produce carries out classification as mobile phase to this reaction product with water, obtains containing the fraction of quinhydrones one glucoside.Make this fraction further by DIAION PA308, decolour.As a result, obtain quinhydrones one glucoside (purity 95%) of about 1g.(embodiment 14: the mass preparation of quinhydrones-O-α-D-glycopyranoside)

Quinhydrones (producing with the pure medicine of light society) and amylolysis thing (SongGu Chemical Industrial Co., Ltd produces, and PINE-DEX 100) are dissolved in the water, obtain the solution of quinhydrones 15 weight % and amylolysis thing 40 weight %.In 10 liters of this solution, add the saccharifying amylase powder with cyclodextrin synthesis capability of enzymic activity 30000 units, stir and obtain mixture.This enzyme liquid is to use subtilis IFO14140 strain preparation according to the method for records such as field, above-mentioned ridge.This mixture was reacted 20 hours down at 40 ℃.

Then, adopt DIAION UBK530 that Mitsubishi Kasei Corp produces, obtain containing the fraction of quinhydrones one glucoside by as the simulation mobile layer column chromatography of mobile phase this reaction product being carried out classification continuously with water.Make this fraction further by DIAION PA308, decolour.As a result, obtain quinhydrones one glucoside (purity 98%) of about 1kg.(embodiment 15: the preparation of quinhydrones-O-α-D-glycopyranoside)

Quinhydrones (producing with the pure medicine of light society) and amylolysis thing (three and the production of starch Co., Ltd., SUNDECK 70) are dissolved in the water, obtain the solution of quinhydrones 15 weight % and amylolysis thing 40 weight %.In this solution 10ml, add the saccharifying amylase powder with cyclodextrin synthesis capability of enzymic activity 30 units, stir and obtain mixture.This powder is to use subtilis IFO14140 strain preparation according to the method for records such as field, above-mentioned ridge.This mixture was reacted 20 hours down at 40 ℃.

Then, adopt Amberlite 1310Na (organic Co., Ltd.) as mobile phase this reaction product to be carried out classification with water.As a result, obtain quinhydrones one glucoside (purity 96%) of about 1g.(embodiment 16: the mass preparation of quinhydrones-O-α-D-glycopyranoside)

Quinhydrones (producing with the pure medicine of light society) and amylolysis thing (SongGu Chemical Industrial Co., Ltd produces, MAX 1000EX) are dissolved in the water, obtain the solution of quinhydrones 15 weight % and amylolysis thing 40 weight %.In 10 liters of this solution, add the saccharifying amylase powder with cyclodextrin synthesis capability of enzymic activity 30000 units, stir and obtain mixture.This enzyme liquid is to use subtilis IFO14140 strain preparation according to the method for records such as field, above-mentioned ridge.This mixture was reacted 20 hours down at 40 ℃.

Then, adopt Amberlite 1310Na (organic Co., Ltd.), obtain containing the fraction of quinhydrones one glucoside by as the simulation mobile layer column chromatography of mobile phase this reaction product being carried out classification continuously with water.As a result, obtain quinhydrones one glucoside (purity 94%) of about 1kg.(embodiment 17: the preparation of quinhydrones-O-α-D-glycopyranoside)

Quinhydrones (producing with the pure medicine of light society) and maltopentaose (sugaring society in salt solution port produces) are dissolved in 20mM acetic acid-Na damping fluid (pH5.5), obtain the solution of quinhydrones 5 weight % and maltopentaose 50 weight %.In this solution 10ml, add the Cyclomaltodextrinase liquid 5ml of enzymic activity 20 units, stir and obtain mixture.This enzyme liquid be preparation example 1 obtain derive from the enzyme liquid that Alkaliphilic bacillus belongs to A2-5a.This mixture was reacted 16 hours down at 40 ℃.

Then, adopt Amberlite 1310Na (organic Co., Ltd.) by as the column chromatography of mobile phase this reaction product being carried out classification with water.As a result, obtain the hydroquinone glucoside (purity 80%) of about 75mg.

In the column chromatography, the fractions different with the fraction that contains hydroquinone glucoside contain saccharic.This contains the saccharic that contains in the fraction of saccharic about 50% and is dextrinosan.(embodiment 18: the preparation of quinhydrones-O-α-D-glycopyranoside)

Quinhydrones (producing with the pure medicine of light society) and maltopentaose (sugaring society in salt solution port produces) are dissolved in 20mM acetic acid-Na damping fluid (pH5.5), obtain the solution of quinhydrones 3 weight % and maltopentaose 10 weight %.In this solution 10ml, add the Fructus Hordei Germinatus α-Dian Fenmei liquid 10ml of enzymic activity 10 units, stir and obtain mixture.This enzyme liquid is according to J.Biol.Chem.267 (31) 22108-22114, and the method for 1992 records is used the E.coli preparation that is deposited in Industrial Technology Institute life engineering Industrial Technology Research Institute with preserving number FERM P-13717.This E.coli has the gene of the Fructus Hordei Germinatus α-Dian Fenmei that derives from thermoactinomyces vulgaris R-47 strain, expresses this Fructus Hordei Germinatus α-Dian Fenmei.Added in per 3 hours with respect to this mixture weight and be 2% quinhydrones, be 4% the maltopentaose and the Fructus Hordei Germinatus α-Dian Fenmei of enzymic activity 10 units, add up to reaction 24 hours down at 40 ℃ simultaneously with respect to the weight of mixture.

Then, adopt Amberlite 1310Na (organic Co., Ltd.) by as the column chromatography of mobile phase this reaction product being carried out classification with water.As a result, obtain the hydroquinone glucoside (purity 96%) of about 30mg.

By column chromatography, obtain following fraction, the fraction that this fraction is different with the fraction that contains hydroquinone glucoside contains saccharic.This contains the saccharic that contains in the fraction of saccharic about 50% and is dextrinosan.(embodiment 19: the preparation of quinhydrones-O-α-D-glycopyranoside)

Quinhydrones (producing with the pure medicine of light society) and amylolysis thing (the MAX 1000EX that SongGu Chemical Industrial Co., Ltd produces) are dissolved in the water, obtain the solution of quinhydrones 20 weight % and amylolysis thing 50 weight %.In 10 liters of this solution, add the saccharifying amylase powder with cyclodextrin synthesis capability of enzymic activity 50000 units, stir and obtain mixture.This powder is to use subtilis IFO14140 strain preparation according to the method for records such as field, above-mentioned ridge.This mixture was reacted 20 hours down at 40 ℃.

Then, adopt the DIAION WA-30 of Mitsubishi Kasei Corp's production of after the HCl balance, making the C1 type as mobile phase this reaction product to be carried out column chromatography, carry out classification, obtain containing the fraction of quinhydrones one glucoside with water.As a result, obtain quinhydrones one glucoside (purity 96%) of about 1.2kg.(embodiment 20: the preparation of quinhydrones-O-α-D-glycopyranoside)

Quinhydrones (producing with the pure medicine of light society) and amylolysis thing (the MAX 1000EX that SongGu Chemical Industrial Co., Ltd produces) are dissolved in the water, obtain the solution of quinhydrones 20 weight % and amylolysis thing 50 weight %.In 10 liters of this solution, add the saccharifying amylase powder with cyclodextrin synthesis capability of enzymic activity 50000 units, stir and obtain mixture.This powder is to use subtilis IFO14140 strain preparation according to the method for records such as field, above-mentioned ridge.This mixture was reacted 20 hours down at 40 ℃.

Then, adopt the DIAION PA-412 of Mitsubishi Kasei Corp's production of after the HCl balance, making the C1 type as mobile phase this reaction product to be carried out column chromatography, carry out classification, obtain containing the fraction of quinhydrones one glucoside with water.As a result, obtain quinhydrones one glucoside (purity 95%) of about 1.0kg.(embodiment 21: use subtilis K02 strain to prepare quinhydrones-O-α-D-glycopyranoside)

Except that the saccharifying amylase liquid with cyclodextrin synthesis capability that derives from subtilis K02 strain that uses records such as field, above-mentioned ridge replaces deriving from the saccharifying amylase liquid with cyclodextrin synthesis capability of subtilis IFO14140 strain, react similarly to Example 1.This enzyme liquid is to use subtilis K02 strain preparation according to the method for records such as field, above-mentioned ridge.

In this reaction solution, add alpha-glucosidase (production of TOYOBO company) 20 units, cultivated 4 hours down at 40 ℃.After the cultivation, this solution is imposed on the HPLC that uses ODS post RP-18 (production of MERCK company), use and be adjusted to 20% methanol aqueous solution of pH2.5 as mobile phase.In contrast, the solution of not handling with alpha-glucosidase is imposed on the HPLC.Measure the absorbancy of each fraction of elutriant, detect the quinhydrones glucosides at the 280nm place.As a result,, compare with untreated solution with the occasion that alpha-glucosidase is handled, the peak completely dissolve of quinhydrones one glucoside, the peak of quinhydrones increases.Also generated the quinhydrones glucosides during use K02 strain that hence one can see that.

In addition, decompose this fact, can learn that this glucosides is that glucose α is combined in the glucosides on the quinhydrones based on the elution time of HPLC and by alpha-glucosidase.(embodiment 22: use subtilis K05 strain to prepare quinhydrones-O-α-D-glycopyranoside)

Except that the saccharifying amylase liquid with cyclodextrin synthesis capability that derives from subtilis K05 strain that uses records such as field, above-mentioned ridge (adopt field, above-mentioned ridge etc. method preparation) replacement derives from the saccharifying amylase liquid with cyclodextrin synthesis capability of subtilis IFO14140 strain, react similarly to Example 1.This enzyme liquid is to use subtilis K05 strain preparation according to the method for records such as field, above-mentioned ridge.

In this reaction solution, add alpha-glucosidase (production of TOYOBO company) 20 units, cultivated 4 hours down at 40 ℃.After the cultivation, this solution is imposed on the HPLC that uses ODS post RP-18 (production of MERCK company), use and be adjusted to 20% methanol aqueous solution of pH2.5 as mobile phase.In contrast, the solution of not handling with alpha-glucosidase is imposed on the HPLC.Measure the absorbancy of each fraction of elutriant, detect the quinhydrones glucosides at the 280nm place.As a result,, compare with untreated solution with the occasion that alpha-glucosidase is handled, the peak completely dissolve of quinhydrones one glucoside, the peak of quinhydrones increases.Also generated the quinhydrones glucosides during use K05 strain that hence one can see that.(embodiment 23: use subtilis K12 strain to prepare quinhydrones-O-α-D-glycopyranoside)

Except that the saccharifying amylase liquid with cyclodextrin synthesis capability that derives from subtilis K12 strain that uses records such as field, above-mentioned ridge (adopt field, above-mentioned ridge etc. method preparation) replacement derives from the saccharifying amylase liquid with cyclodextrin synthesis capability of subtilis IFO14140 strain, react similarly to Example 1.This enzyme liquid is to use subtilis K12 strain preparation according to the method for records such as field, above-mentioned ridge.

In this reaction solution, add alpha-glucosidase (production of TOYOBO company) 20 units, cultivated 4 hours down at 40 ℃.After the cultivation, this solution is imposed on the HPLC that uses ODS post RP-18 (production of MERCK company), use and be adjusted to 20% methanol aqueous solution of pH2.5 as mobile phase.In contrast, the solution of not handling with alpha-glucosidase is imposed on the HPLC.Measure the absorbancy of each fraction of elutriant, detect the quinhydrones glucosides at the 280nm place.As a result,, compare with untreated solution with the occasion that alpha-glucosidase is handled, the peak completely dissolve of quinhydrones one glucoside, the peak of quinhydrones increases.Also generated the quinhydrones glucosides during use K12 strain that hence one can see that.(embodiment 24: use subtilis D11 strain to prepare quinhydrones-O-α-D-glycopyranoside)

Except that the saccharifying amylase liquid with cyclodextrin synthesis capability that derives from subtilis D11 strain that uses records such as field, above-mentioned ridge (adopt field, above-mentioned ridge etc. method preparation) replacement derives from the saccharifying amylase liquid with cyclodextrin synthesis capability of subtilis IFO14140 strain, react similarly to Example 1.This enzyme liquid is to use subtilis D11 strain preparation according to the method for records such as field, above-mentioned ridge.

In this reaction solution, add alpha-glucosidase (production of TOYOBO company) 20 units, cultivated 4 hours down at 40 ℃.After the cultivation, this solution is imposed on the HPLC that uses ODS post RP-18 (production of MERCK company), use and be adjusted to 20% methanol aqueous solution of pH2.5 as mobile phase.In contrast, the solution of not handling with alpha-glucosidase is imposed on the HPLC.Measure the absorbancy of each fraction of elutriant, detect the quinhydrones glucosides at the 280nm place.As a result,, compare with untreated solution with the occasion that alpha-glucosidase is handled, the peak completely dissolve of quinhydrones one glucoside, the peak of quinhydrones increases.Also generated the quinhydrones glucosides during use D11 strain that hence one can see that.Industrial applicibility

According to the present invention, provide the preparation method of phenol derivatives glucosides.Among the present invention, new Starch debranching enzyme, Cyclomaltodextrinase, Fructus Hordei Germinatus α-Dian Fenmei and the saccharifying amylase with cyclodextrin synthesis capability utilize α bonded glycosyl to shift for phenol derivativess such as quinhydrones, catechin, epigallocatechins.

Make new Starch debranching enzyme, Cyclomaltodextrinase, Fructus Hordei Germinatus α-Dian Fenmei do the time spent, when obtaining glucosides, can also obtain dextrinosan.

Claims (9)

1, a kind of preparation method of phenol derivatives glucosides, this method is included in and makes sugar and phenol derivatives reaction under the enzyme existence, form the step of phenol derivatives glucosides, the saccharifying amylase that this enzyme is selected from new Starch debranching enzyme, Cyclomaltodextrinase, Fructus Hordei Germinatus α-Dian Fenmei and has the cyclodextrin synthesis capability.

2, the method for claim 1, above-mentioned enzyme is new Starch debranching enzyme, and this new Starch debranching enzyme derives from the bacterium that is selected from thermoactinomyces vulgaris, bacteroides thetaiotaomicron, Pseudomonas, bacillus polymyxa, Bacillus licheniformis, bacstearothermophilus, Bacillusthermoamyloliquefaciens and thermus thermophilus.

3, the method for claim 1, above-mentioned enzyme is a Cyclomaltodextrinase, and this Cyclomaltodextrinase derives from the bacterium that is selected from bacstearothermophilus, bacillus acidocldarius, Bacillus coagulans, colon bacillus, Flavobacterium, Alkaliphilic bacillus and Bacillus sphaericus.

4, the method for claim 1, above-mentioned enzyme is the Fructus Hordei Germinatus α-Dian Fenmei, and this Fructus Hordei Germinatus α-Dian Fenmei derives from the bacterium that is selected from thermoactinomyces vulgaris, bacteroides thetaiotaomicron, Pseudomonas, bacillus polymyxa, Bacillus licheniformis, bacstearothermophilus, Bacillusthermoamyloliquefaciens and thermus thermophilus.

5, the method for claim 1, above-mentioned enzyme is the saccharifying amylase with cyclodextrin synthesis capability, and this saccharifying amylase with cyclodextrin synthesis capability derives from the bacterium that is selected from subtilis, streptococcus bovis, streptomyces hygroscopicus, early stage streptomycete, moral row rhizopus equinus, De Liema aspergillus and aspergillus niger.

6, the method of claim 1, above-mentioned phenol derivatives can be selected from flavonoid compound, isoflavonoid, the flavonols compound, flavanone compound, the flavanonol compounds, catechin compounds, the aurone compounds, the chalcone compound, dihydrochalcone-like compound, kojic acid, syringol, paracetamol, Vanillin, quinhydrones, epigallocatechin, gallate table catechu ester, the anthocyan compound, the anthocyanin compounds, coffic acid, catechol, Resorcinol, Protocatechuic Acid, gallic acid, resorcylic acid and Phloroglucinol.

7, the method for claim 1, above-mentioned sugar are selected from malto-oligosaccharide, dextrin, amylose starch, amylopectin, native starch, amylolysis thing and chemical starch.

8, the method for claim 1 further comprises making spent ion exchange resin carry out the fractionated step to above-mentioned enzyme reaction product.

9, the method for claim 1 further comprises making spent ion exchange resin that above-mentioned enzyme reaction product is classified as the fraction that contains by product, the step that contains the fraction of unreacted phenol derivatives and contain the fraction of phenol derivatives glucosides at least.