CN1424399A - Salmon calcitonin analogues and expression method for the same in vegetable oils - Google Patents

Abstract

A novel salmon calcitonin analog's gene msCT(31aa) is cloned by gene engineering and a gene expression system by fusing oleosin with target protein is created. Its steps includes separating and cloning the promotor of rape's oleosin gene, coding the structure gene of sesame's oleosin, designing the gene msCT for coding salmon calcitonin analog m3CT [Trp1, Ser6, Phe7 and del-Leu19], inserting it to C terminal of sesame oleosin gene, configuring the expression carrier of rape's oleosin gene promoter driven sesame oleosin-msCT fusion gene plant, transferring to rape and cotton by Agrobacterium method and pullen channel methods to respectively obtain their transgenic plants, and testing. It can be used to treat osteoporosis, Paget's disease, ostalgia, etc.

Description

A kind of novel salmon calcitonin analogues and the method for in vegetable oils, expressing thereof

Invention field

The method that the present invention relates to a kind of novel salmon calcitonin analogues msCT (31aa) and express in vegetable oils relates in particular to and utilizes vegetable oils albumen-target protein to form the method that the antigen-4 fusion protein gene expression system is produced salmon calcitonin analogues msCT (31aa) and other target protein.

Summary of the invention

Thyrocalcitonin is the important peptide hormone of calcium in the control agent, phosphorus metabolism and bone metabolism, can reduce the level of blood calcium, also has the effect of antihistamine, cholinolytic, gastric acid inhibitory and pancreatic secretion.Be mainly used in clinically that treatment hypercalcinemia, osteoporosis, scleromalacia (Pagete ' s disease), bone are painful, bone transfer, the different nutrition disease of kidney bone, fracture, hyperphosphatemia, peptide ulceration, acute pancreatitis, hyperparathyroidism and the rheumatic arthritis etc. of spinal canal stenosis disease, malignant tumour, can be one of important biochemical drug also as the diagnostic agent of some cancer.New " calcium migration " theory is thought, osteoporosis makes in the bone calcium loss in blood, and deposits in brain, blood vessel, thereby causes geriatric diseases such as senile dementia, arteriosclerosis, therefore, thyrocalcitonin is having good application prospects aspect prevention and the treatment senile osteoporosis.China is entering an aging society, and the elderly easily suffers from osteoporosis, and this disease also is a worldwide problem.The U.S. will spend about 10,000,000,000 dollars every year and is used for the treatment of osteoporosis according to statistics, there are every year 1300000 people to cause fracture because of osteoporosis, hip fracture wherein can cause severe complications, and about 5%～20% patient fractures dead in back 1 year, and the survivor more than 50% is disabled.Because calcitonin content atomic (only containing 5～6mg thyrocalcitonin in the bright pig thyroid gland of per kilogram), extraction process complexity and chemosynthesis are than reasons such as costlinesses in the biomaterial, limited the extensive application of thyrocalcitonin, so national capital active development genetically engineered thyrocalcitonins such as U.S., day, English, the thyrocalcitonin that how to obtain biological activity height, long half time, no antigen is paid close attention to by people always.

Produce medical protein or industrial enzymes with transgenic plant, get more and more people's extensive concerning in recent years.Express foreign protein in vegetable oils, goal gene is inserted in the C-terminal or the N end of oil body protein (Oleosin) gene, constitutes antigen-4 fusion protein gene.Because Oleosin albumen is embedded in the oil body surface, antigen-4 fusion protein gene is in the oil body of recipient plant seed behind the specifically expressing, utilize the hydrophobic characteristic of oil body lipophilic, with seed pulverizing → liquid extracting → centrifugal, reclaim upper oil phase, fusion rotein or target protein can be separated with intracellular other component, thereby can obviously simplify the separation and purification process of target protein.

For finishing the structure of oil body expression system involved in the present invention, the inventor has at first separated, has cloned the promotor of rape oil body protein gene, the structure gene of sesame oil body protein and the mutator gene msCT[Trp of salmon calcitonin see calcimar ¹, Ser ⁶, Phe ⁷, del-Leu ¹⁹], the C that then the msCT gene is inserted in the sesame oil body protein gene holds, and has made up the antigen-4 fusion protein gene plant expression vector by the promoters driven of rape oil body protein gene, transforms rape and cotton, has obtained transfer-gen plant and strain system respectively.

Transgene rape detects through PCR, proves that calcitonin gene has been incorporated in the rape genome.Transgene cotton detects through PCR-Southem and Western, prove that the msCT gene is put in order to be incorporated in the oil body to express in cotton, and having obtained T2 at present is 44 for the transgene cotton strain.Owing in the field T1, T2 are smeared with kantlex (Kan) solution of high density (5000ppm) for the blade of plant, so the kalamycin resistance (Kan that filters out ^R) strain should be the individuality of high expression level in theory.

The aminoacid sequence of natural salmon calcitonin see calcimar is as follows:

Cys-Ser-Asn-Leu-Ser-Thr-Cys-Val-Leu-Gly-Lys-Leu-Ser-Gln-Glu-Leu-His-Lys-Leu-Gln-Thr-Tyr-Pro-Arg-Thr-Asn-Thr-Gly-Ser-Gly-Thr-Pro-NH ₂

The inventor is through extensively and profoundly research, now invented a kind of novel salmon calcitonin analogues msCT, its aminoacid sequence is: Trp-Ser-Asn-Leu-Ser-Ser-Phe-Val-Leu-Gly-Lys-Leu-Ser-Gln-Glu-Leu-His-Lys-Gln-Thr-Tyr-Pro-Arg-Thr-Asn-Thr-Gly-Ser-Gly-Thr-Pro-NH ₂, the 1st amino acids Cys that is about to natural salmon calcitonin see calcimar sports Trp, and the 6th Thr sports Ser, and the 7th Cys sports Phe, the 19th Leu disappearance (its nucleotide sequence is seen sequence table sequence identifier symbol 3).The invention effect

MsCT compares with natural salmon calcitonin see calcimar, and the the the 1st, the 6th, the 7th, the 19th amino acid is all transformed, and makes its biological activity obviously improve (6,000～8,000U/mg), the biological activity of natural salmon calcitonin see calcimar and human calcitonin is respectively 4,500 and 150U/mg.

Utilize transgenic plant in vegetable oils, to express exogenous object protein such as salmon calcitonin analogues, can simplify the separation and purification process of target protein greatly, reduce production costs; The seed of transgenic plant is easy to storing, helps suitability for industrialized production, and obviously improves the added value of agricultural byproducts.

Brief description

Fig. 1 is the structural representation of plant expression vector pNOC121.

Fig. 2 is the design of graphics of pNOP carrier.

Fig. 3 is that the enzyme of pNOP is cut evaluation figure, wherein the 1:pNOP/HindIII+PstI double digestion; 2: λ DNA/EcoRI+HindIII marker.

Fig. 4 is the design of graphics of pSO carrier.

Fig. 5 is that the enzyme of pSO is cut evaluation figure, wherein 1: λ DNA/EcoRI+HindIIImarker; The 2:pSO/PstI+BamHI double digestion.

Fig. 6 is the design of graphics of pCT carrier.

Fig. 7 is that the enzyme of pCT is cut evaluation figure, wherein 1:pBR322 DNA/BstNI marker; The 2:pCT/BamHI+XhoI double digestion.

Fig. 8 is the design of graphics of intermediate carrier pNOPM.

Fig. 9 is that the enzyme of pNOPM is cut evaluation figure, wherein the 1:pNOPM/HindIII+PstI double digestion; 2: λ DNA/EcoRI+HindIII marker.

Figure 10 is the design of graphics of intermediate carrier pNsOM.

Figure 11 is that the enzyme of pNsOM is cut evaluation figure, wherein 1: λ DNA/EcoRI+HindIIImarker; The 2:pNsOM/PstI+BamHI double digestion.

Figure 12 is the design of graphics of intermediate carrier pNOCM.

Figure 13 is that the enzyme of pNOCM is cut evaluation figure, wherein the 1:pNOCM/BamHI+XhoI double digestion; 2: λ DNA/EcoRI+HindIII marker.

Figure 14 is the design of graphics of plant expression vector pNOC121.

Figure 15 is that the enzyme of pNOC121 is cut evaluation figure, wherein 1: λ DNA/EcoRI+HindIIImarker:2:pNOC121/HindIII+EcoRI double digestion.

Figure 16 is that the PCR of transgene rape nptII detects, wherein 1: λ DNA/EcoRI+HindIII marker; The purpose fragment of 2～5:750bp pcr amplification.

Figure 17 is that the PCR of transgene rape sOle/msCT detects, wherein the purpose fragment of 1～4:577bpPCR amplification; 5: λ DNA/EcoRI+HindIII marker.

Figure 18 is the transgene cotton T1 PCR-Southem hybridization (nptII) in generation, and wherein 1～11,13～23,25～34 is transgene cotton; 12,24,36 is λ DNA/EcoRI+HindIIImarker; 35 are the contrast of non-transgenic cotton.

Figure 19 is that the Western of oil body protein in the transgenic cotton seed oil body-msCT fusion rotein detects, wherein 1: protein molecular weight maker; 2: the contrast of non-transgenic cotton; 3: the transgene cotton strain is 351.

Figure 20 is the pEA structure iron.Figure 21 is the pMV structure iron.

Be to realize the specific embodiment of the present invention below

We are with 3 ' end of salmon's calcitonin gene msCT insertion sesame oil body protein gene (sOle) in this research, and structure is with the plant expression vector pNOC121 of the sOle/msCT antigen-4 fusion protein gene of promotor (NOP) driving of rape oil body protein gene.The pNOC121 structural representation is seen Fig. 1.

The pcr amplification and the clone of embodiment 1 Canola oil body protein gene promoter

Because rape is the important large oil crops of China, oleaginousness height (42～45%), and the amount of 20kD oil body protein is 10 times of 24kD oil body protein amount in the rape oil body, thus we according to the sequences Design of 20kD oil body protein gene promotor primer NP5, NP3, its sequence is as follows:

NP5：ATTCAAGCTTGTCGGATCATGACGTTTCCAG

NP3：GCTTCTGCAGAATTGAGAGAGATCGAAGAG

Total DNA with blue or green oily 14 kinds of turnip type rape (B.campestris) is a template, pcr amplification the promotor of 20KD oleosin gene of 896bp (the PCR reaction conditions is: 94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 1 minute, 72 ℃ were extended 10 minutes after 35 loop ends), be connected on the pUC19 with the HindIII+PstI double digestion, obtain pNOP.The building process of pNOP carrier and enzyme are cut evaluation and are seen Fig. 2,3 respectively.The pNOP sequencing result shows that clone's product is the promotor (seeing sequence table sequence identifier symbol 1) of 896bp rape oil body protein gene.

The amplification and the clone of embodiment 2 sesame oil body protein genes

With plasmid pEA (Figure 20) DNA that has the sesame oil body protein gene is template, design primer Ole5, Ole3, and its sequence is as follows:

Ole5：GTGCTGCAGACAACAATGGCGGACGAACCCCACG

Ole3：AAAGGATCCCGGTCTTATTACATCTTGGCTTC

Pcr amplification obtains the sesame oil body protein gene that 440 bp do not contain the terminator sequence.The PCR reaction conditions is: 94 ℃ 30 seconds, 52 ℃ 30 seconds, 72 ℃ 1 minute, 72 ℃ were extended 10 minutes after 35 loop ends.PCR product PstI/BamHI double digestion is connected on the carrier pUC19, obtains cloning vector pSO.The vector construction of pSO, enzyme are cut evaluation and are seen Fig. 4,5 respectively.Its sequence is seen sequence table sequence identifier symbol 2.

The synthetic of embodiment 3 salmon calcitonin analogues genes

We have designed corresponding gene order according to codon, GC content and the required restriction enzyme site of plant-preference, have carried out the synthetic (138bp altogether) of salmon calcitonin analogues msCT gene.The G/C content of this gene is 51.5%, and cloning vector is pBluescriptSK.Cloning vector called after pCT after the msCT gene is inserted in the BamHI/XhoI site.The structure of pCT carrier and enzyme are cut evaluation and are seen Fig. 6,7.

The structure of embodiment 4 intermediate carrier pNOPM

Extract the plasmid DNA of pNOP, with the HindIII/PstI double digestion, reclaim 896 bp purpose fragments (promotor of rape oil body protein gene), be connected to carrier pMV and go up (Figure 21), obtain intermediate carrier pNOPM, connect correct through HindIII/PstI double digestion assay certificate.The structure of pNOPM intermediate carrier and enzyme are cut evaluation and are seen Fig. 8,9.

The structure of embodiment 5 intermediate carrier pNsOM

Extract the pSO plasmid DNA,, reclaim 440bp purpose fragment (sesame oil body protein gene), be connected on the pNOPM, obtain intermediate carrier pNsOM, identify that through the PstI/BamHI double digestion endonuclease bamhi size is 440bp with the PstI/BamHI double digestion.The structure of pNsOM intermediate carrier and enzyme are cut evaluation and are seen Figure 10,11.

The structure of embodiment 6 intermediate carrier pNOCM

Extract the pCT plasmid DNA,, be connected on the pNsOM carrier, obtain intermediate carrier pNOCM (Figure 12) with reclaiming 138bp purpose fragment (salmon calcitonin analogues msCT gene) behind the BamHI/XhoI double digestion.Identify that through the BamHI/XhoI double digestion endonuclease bamhi size is 138bp (Figure 13).

The structure of embodiment 7 plant expression vector pNOC121

Extract the pNOCM plasmid DNA, use the HindIII/EcoRI double digestion, reclaim the dna fragmentation of about 2.0kb, be connected to pBI121 (available from CLONTECH company) and go up (Figure 14), the HindIII/EcoRI double digestion is identified and is confirmed that the endonuclease bamhi size is 2.0kb (Figure 15).So far finished the structure of NOP/sOle/msCT plant expression vector pNOC121.

Embodiment 8 agriculture bacillus mediated rape genetic transformation 1.pNOC121 plasmid DNA change Agrobacterium over to

2 microgram pNOC121 plasmid DNA join in the 100 microlitre LBA4404 competent cells, mixing, ice bath 5 minutes.Go to warm the bath 5 minutes in 37 ℃ of water-baths in the liquid nitrogen after freezing 5 minutes rapidly.Add 1 milliliter of YEB liquid nutrient medium, the 250rpm shaking culture is 4～5 hours on 28 ℃ of shaking tables.Get an amount of bacterium liquid and be applied on the YEB solid medium that contains Streptomycin sulphate 125mg/L and kantlex 100mg/L, put 28 ℃ and cultivated 24～48 hours, screening obtains to have the single bacterium colony of Agrobacterium of pNOC121 plasmid DNA.2. the activation of Agrobacterium

The single bacterium colony of picking Agrobacterium from the flat board, be inoculated in 5 milliliters of YEB liquid nutrient mediums and (contain kantlex 100mg/L, Streptomycin sulphate 100mg/L), shaking culture is spent the night, getting 1 milliliter of bacterium liquid is inoculated into 50 milliliters of YEB liquid nutrient mediums and (contains kantlex 100mg/L, Streptomycin sulphate 100mg/L) in, thermal agitation is cultured to OD ₆₀₀Be 0.4～0.5 (about 3～4 hours), centrifugal 5 minutes of 5000rpm, thalline is washed once with MS1 (MS+6BA 1.0mg/L+NAA0.05mg/L) substratum, with MS ₀(not containing any hormone and microbiotic) is resuspended, makes OD ₆₀₀Be 0.1～0.2.3. the genetic transformation of rape

Cut the rape hypocotyls that germinateed 7 days, at above-mentioned MS ₀Soaked 1 minute in the resuspended Agrobacterium bacterium liquid, be put on MS1 (MS+BA1mg/L+NAA 0.05mg/L) solid medium and cultivated altogether 4 days, forward to afterwards and proceed bud differentiation selection cultivation on the MS1 solid medium that contains kantlex 10mg/L+ Reflin (Cef) 100mg/L, there is resistant buds to occur about about 4 weeks, treat that resistant buds goes to when being stretched to 1～2 centimetre on the root media MS2 (MS+NAA 0.1mg/L+Kan 100mg/L+Cef 100mg/L), can take root in general about 10 days.

The PCR of embodiment 9 transgene rapes detects

Extract the transgene rape genomic dna, carry out pcr amplification with npt5/npt3 and two pairs of primers of sOle/msCT respectively and detect, each primer sequence is:

npt5：GAACAAGATGGATTGCACGC

npt3：AGAAGGCGATAGAAGGCGATG

sOle：TGGCGGACGAACCCCACGACC

msCT：CTTACTCAGCCTCGAGTTACTATCCT

The PCR reaction conditions of npt5/npt3 is: 94 ℃ 30 seconds, 52 ℃ 30 seconds, 72 ℃ 1 minute; The PCR reaction conditions of sOle/msCT is: 94 ℃ 30 seconds, 62 ℃ 30 seconds, 72 ℃ 1 minute.All extended 10 minutes after 35 circulations at 72 °.Amplify the sesame oleosin-msCT purpose fragment of the 750bpnptII and the 578bp of expection respectively.PCR detects photo and sees Figure 16 and 17 respectively.

The pollen tube passage method in embodiment 10 sea island cotton seas 7124 transforms

A large amount of pNOC 121 plasmid DNA of extracting, be diluted to 0.02 μ g/ μ l with aseptic redistilled water, bloom about 24 hours the time when sea 7124 in Beijing, the dna solution that dilution is good spends the amount (0.2 micrograms of DNA) of 10 microlitres to inject in the cotton ovary with every, and smear 1% Plant hormones regulators,gibberellins at flower bud handle place, to prevent fruit abscission rate.Gathered in the crops 5 kilograms of about 50,000 cotton seeds altogether, sent south, Hainan numerous, after planting smeared blade with the kantlex solution of 5000ppm, filtered out 101 strain kalamycin resistance (Kan in seedling stage ^R) plant.

Embodiment 11 extra large 7124 transgene cotton T2 are for plant

Kalamycin resistance (Kan ^R) detect

The numerous Kan in south, Hainan ^RThe T2 that gathers in the crops in the strain is for seed, in Beijing sowing, 4 leaf phases and budding before on each strain blade of each plant, smear the kantlex of 5000ppm, each plant Kan of twice field investigation at twice ^RAnd Kan ^s(kantlex sensitivity) strain the results are shown in table 1.

Table 1 Beijing T2 is for plant field Kan resistance questionnaire

Beijing plant	Hainan numbering	?Kan RStrain	?Kan sStrain	Total strain number	Beijing plant	Hainan numbering	??Kan RStrain	?Kan sStrain	Total strain number
										????1	????1	????5	????1	????6	????48	????91	????0	????25	????25
????2	????2	????12	????9	????21	????49	????92	????0	????18	????18
										????5	????7	????10	????10	????20	????50	????93	????0	????19	????19
????6	????8	????11	????45	????56	????51	????94	????1	????16	????17
										????7	????10	????0	????47	????47	????52	????96	????5	????13	????18
????8	????11	????1	????10	????11	????53	????100	????0	????18	????18
										????9	????13	????0	????32	????32	????54	????101	????2	????45	????47
????10	????15	????0	????19	????19	????55	????102	????0	????88	????88
										????11	????16	????0	????56	????56	????56	????103	????2	????77	????79
????13	????19	????11	????8	????19	????57	????104	????0	????22	????22
										????14	????20	????11	????17	????28	????58	????105	????1	????58	????59
????15	????21	????0	????41	????41	????59	????106	????1	????61	????62
										????16	????23	????3	????44	????47	????60	????107	????3	????41	????44
????17	????24	????2	????8	????10	????61	????108	????1	????4	????5
										????19	????26	????0	????51	????51	????63	????109	????2	????62	????64
????21	????28	????1	????25	????26	????64	????110	????6	????86	????92
										????23	????31	????0	????31	????31	????65	????111	????2	????34	????36
????26	????36	????2	????18	????20	????66	????112	????2	????47	????49
										????29	????39	????1	????33	????34	????67	????114	????2	????51	????53
????30	????44	????4	????52	????56	????68	????117	????18	????13	????31
										????32	????46	????1	????21	????22	????69	????120	????5	????29	????34
????34	????48	????0	????33	????33	????71	????351	????4	????22	????26
										????35	????50	????3	????8	????11	????72	????6	????1	????43	????44
????36	????51	????0	????7	????7	????73	????9	????0	????21	????21
										????37	????76	????1	????46	????47	????74	????12	????1	????2	????3
????38	????77	????1	????36	????37	????75	????18	????0	????3	????3
										????39	????78	????1	????67	????68	????76	????41	????3	????10	????13
????40	????80	????3	????70	????73	????77	????79	????0	????30	????30
										????41	????82	????0	????20	????20	????78	????90	????0	????3	????3
????42	????84	????1	????41	????42	????79	????95	????0	????2	????2
										????44	????86	????0	????15	????15	????80	????97	????2	????3	????5
????45	????87	????0	????47	????47	????81	????98	????1	????1	????2
										????46	????88	????2	????24	????26	????82	????14	????1	????4	????5
????47	????89	????2	????27	????29

Embodiment 12 T2 detect for the PCR-S0uthern of transgene cotton

Extract Kan ^RThe genomic dna of strain carries out pcr amplification with npt5/npt3 and two pairs of primers of sOle/msCT to genomic dna.The reaction conditions of PCR is: npt5/npt3:94 ℃ 30 seconds, 52 ℃ 30 seconds, 72 ℃ 1 minute; SOle/msCT:94 ℃ 30 seconds, 62 ℃ 30 seconds, 72 ℃ 1 minute.All extended 10 minutes down after 35 circulations at 72 ℃.The result shows that it is the nptII positive that 63 strains are arranged, and it is the sOle/msCT positive that 44 strains are arranged in this 63 strain.

Getting T2 and be 32 strains of male transgene cotton for nptII and sOle/msCTPCR, is probe with the fragment of pNOC121 plasmid DNA/HindIII+EcoRI double digestion, carries out PCR-Southern hybridization, 29 strains as a result positive (Figure 18).

Oleosin oil body protein-calcitonin target protein in embodiment 13 cottonseeds

Western detects

Extract the oil body protein in the cottonseed, sds polyacrylamide gel electrophoresis.Polyclonal antibody with the anti-salmon calcitonin see calcimar of goat after changeing film carries out the Western analysis.The result shows in the seed of transgene cotton 351 strains system the proteic expression of salmon calcitonin analogues is arranged, and the expression product size is about 19kD, with big or small consistent (the sesame Oleosinn protein 15 .5kD+msCT albumen 3.45kD) of expection, as shown in figure 19.

The extraction that separates oil body protein in 1. cottonseeds-salmon calcitonin analogues fusion rotein of embodiment 14 oil body proteins and salmon calcitonin analogues

(1) gets 10 of cotton seeds and remove shell, add buffer A (0.15MTricine-KOH pH7.5,10mM KCl, the 1mM MgCl of about 3 times of volumes ₂, 1mM EDTA, 0.6M sucrose) grind, 5000xg, 4 ℃ are centrifugal 10 minutes.

(2) supernatant is resuspended with the buffer A that contains 0.6M sucrose.

(3) on the liquid level coated with isopyknic buffer A that contains 0.1M sucrose.

(4) 18000xg, 4 ℃ are centrifugal 20 minutes, repeat twice, get supernatant.

Annotate; So far oil body and other composition in the seed are separated.The composition of oil body comprises: neutral lipid, phosphatide, oil body protein.

(5) add the ether of 2 times of volumes in the supernatant, centrifugal 4 minutes of 13600xg mostly is neutral lipid in the ether layer on top, and phosphatide is stayed following aqueous phase, gets the intermediary egg white layer.

(6) contain the resuspended albumen of buffer A of 0.1M sucrose with 250 microlitres, add 750 microlitre chloroform/methanol (2: 1) mixtures, extracting 2～3 times.

(7) get middle egg white layer, with the ether extracting once, freeze-drying is preserved in-70 ℃ of refrigerators.2. oil body protein and salmon calcitonin analogues separates

(1) fusion rotein with oil body protein-salmon calcitonin analogues is dissolved in the least possible sterilized water.

(2) add 50 microlitre zymoplasm endonuclease reaction damping fluids (0.1M triethanolamine pH8.4,0.5% sarcosyl).

(3) add the 0.02U zymoplasm, 37 ℃ of enzymes are cut and are spent the night.

(4) separate through HPLC, obtain salmon calcitonin analogues.3. the HPLC purifying procedure of salmon calcitonin analogues

Analysis mode reversed-phase column C18 (5 μ, 8 * 250mm, Dalian Chemical Physics Research Institute); Ultraviolet wavelength 214nm; Mobile phase A-0.1% trifluoroacetic acid, B-70% acetonitrile (0.1% trifluoroacetic acid).Gradient: B rose in 60%, 10 minute by 0% in 20 minutes and reduces to 0% again, and flow velocity is 0.5 ml/min, collected salmon calcitonin analogues, freeze-drying ,-70 ℃ of preservations.

Sequence table

＜110〉Biological Technology institute, Chinese Academy of Agricultural Sciences

＜120〉a kind of novel salmon calcitonin analogues and the method in vegetable oils, expressed thereof

<160>4

<170>PatentIn?Version?2.1

<210>1

<211>896

<212>DNA

＜213〉rape (Brassica campestris)

<400>1ATTCAACGTTGTCGGATCATGACGTTTCCAGAAAACATCGAGCAAGCTCTCAAAGCTGACCTCTTTCGGATCGTACTGAACCCGAACAATCTCGTTATGCCCCGTCGTCTCCGAACAGACATCCTCGTAAGTAGGATTGTCGACGAATCCATGGCTATACCCAACCTCCGTCTTCGTCACGCCTGGAACCCTCTGGTAAGCCAATTCCGCTCCCCAGAAGCAACCGGCGCCGAATTGCGCGAATTGCTGACCAGGCGAAGGAACATCGTCGTCGGGTCCTTGTGCGATTGCGGAGGAAGCCGCCGGGTCGGGTTGGGGACGAGACCCGAATCCGAGCCTGGTGAATAGGTTGTTCATCGGAGATTTATAGACGGAGATGGATCGAGCGGTTTTGGGGAAAGGGGAAGTGGGTTTGGCTCTTTTGGATAGAGAGAGTGCAGCTTTGGCGAGAGACTGGAGAGGTTTAGAGAGAGACACGGCGGAGATTACCGGAGGAGAGGCGACGATAGATAGCATTATCGAAGGGACGGGAGAAAGAGTGACGTGGAGAAATAAGAAACCGTTAAGAGTCGGATATTTATTATATTAAAAGCCCACTGGGCCTAACCCATTTAAACAAGACAAGATAAATGGGCCGTGTGTGAGTGTTAACGTTCGGTTTCAAATGCCAACGCCATTGGAACAAAACAAACGTGTCCTCAAGTAAACCCCTGTCGTTTACACCTCAATGGCTGCATGGTGAAGCCATTAACACGTGGCGTAGAATGCATGACGACGCCATTGACACCTGACTCTCTTTCCTTCTCTTCATATATCTCTAATCAATTCAACACTCATTGTCATAGCTATTCGGAAAATATATACACATCCTTTTCTCTTCGATCTCTCTCAATTC

<210>2

<211>440

<212>DNA

＜213〉sesame (Sesamum indicum L.)

<400>2ATGGCGGacGAACCCCACGACCaGCGCCCCACCGACGTCATCaaGAGCTACCTCCCCGAAAaGGGTCCCTCCACCTCTCAAGTCCTCGCCGTCGTGACCCTCTTCCCCCTCGGCGCCGTCCTCCTCTGCCTAGCCGGTCTCATTCTTACCGGGACCATCATCGGCCTCGCCGTCGCCACCCCGCTCTTCGTCATCTTCAGCCCCATCTTGGTCCCCGCCGCCCTAACCATCGCCCTAGCCGTCACCGGTTTCTTGACCTCCGGAGCTTTCGGCATCACCGCCCTGTCCTCGATTTCGTGGTTGCTGAACTACGTTAGGCGAATGCGGGGGAGCTTGCCAGAGCaGCTGGATCATGCACGGCGGCGCGTGCaGGAGAcGGTGGGCCaGAaGACAAGGGAGGCGGGGCaGAGAAGCCAAGATGTAATAAGACCGTGA

<210>3

<211>138

<212>DNA

＜213〉artificial sequence

<400>3GGATCCCATA?TGCTTGTTCC?AAGGGGATCT?TGG?AGC?AAC?CTC?AGC?AGC?TTC?GTG?CTC?GGAAAG?CTC?AGC?CAA?GAG?CTC?CAC?AAG?CAA?ACC?TAC?CCA?AGG?ACC?AAC?ACC?GGA?TCTGGA?ACC?CCA?GGA?TAG?TAA?CTCGAG

<210>4

<211>31

<212>PRT

＜213〉artificial sequence

<400>4

Trp-Ser-Asn-Leu-Ser-Ser-Phe-Val-Leu-Gly-Lys-Leu-Ser-Gln-Glu-Leu-His-Lys-Gln-Thr-Tyr-Pro-Arg-Thr-Asn-Thr-Gly-Ser-Gly-Thr-Pro-NH ₂

Claims (11)

1. One kind the coding salmon calcitonin analogues msCT (31aa) gene msCT[Trp ¹, Ser ⁶, Phe ⁷, del-Leu ¹⁹], the aminoacid sequence structure of its coded product is: Trp-Ser-Asn-Leu-Ser-Ser-Phe-Val-Leu-Gly-Lys-Leu-Ser-Gln-Glu-Leu-His-Lys-Gln-Thr-Tyr-Pro-Arg-Thr-Asn-Thr-Gly-Ser-Gly-Thr-Pro-NH ₂, the 1st amino acids Cys that is about to natural salmon calcitonin see calcimar sports Trp, and the 6th Thr sports Ser, and the 7th Cys sports Phe, the 19th Leu disappearance.
2. 2. a recombinant vectors contains the described gene of claim 1.
3. 3. carrier according to claim 2, this carrier comprise the promotor of oil body protein (oleosin) gene, the structure gene of oil body protein and the gene of coding salmon calcitonin analogues.
4. 4. method for preparing calcitonin-like comprises:

   (1) C end or the N that the described gene of claim 1 is inserted in oil body protein gene holds; (2) place the oil body protein gene promotor to make up plant expression vector afterwards the fusion gene that obtains; (3) with the plant expression vector transformation receptor plant that makes up; (4) obtain transgenic plant; (5) separate and target protein that purifying gives expression in the transgenic plant oil body.
5. 5. preparation method according to claim 4, the gene of wherein said claim 1 is coding salmon calcitonin analogues msCT[Trp ¹, Ser ⁶, Phe ⁷, del-Leu ¹⁹] gene.
6. 6. preparation method according to claim 4, wherein said oil body protein gene comprises the oil body protein gene of all plant origins.
7. 7. preparation method according to claim 4, wherein the promotor of said oil body protein gene is the promotor of the oil body protein gene of all plant origins.
8. 8. preparation method according to claim 4, wherein said recipient plant and transgenic plant include but not limited to all oilseed plants (as draft such as Sunflower Receptacle, soybean, peanut, sesame, oil palm, Fructus oleae europaeae and xylophyta etc.) of rape, cotton.
9. 9. utilize the transgenic plant of the expression target protein that the described preparation method of claim 4-8 obtained comprise root, stem, leaf, flower, really, all plant materialss part and cell, tissues etc. such as seed.
10. 10. utilize the target protein of the expression that the described preparation method of claim 4-8 obtained, comprise salmon calcitonin analogues but be not limited to all target proteins of salmon calcitonin analogues.
11. 11. contain the described gene of claim 1 or contain fungi, bacterium, Agrobacterium, yeast of the described recombinant vectors of claim 2 etc.

Images